ID: 1172623145

View in Genome Browser
Species Human (GRCh38)
Location 20:36332634-36332656
Sequence GCACCCAAGATGGCACAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 171}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172623145_1172623153 17 Left 1172623145 20:36332634-36332656 CCCGCCTGTGCCATCTTGGGTGC 0: 1
1: 0
2: 1
3: 22
4: 171
Right 1172623153 20:36332674-36332696 GTCCCGGCAGCCCCAGGAGGAGG 0: 1
1: 0
2: 4
3: 41
4: 435
1172623145_1172623151 11 Left 1172623145 20:36332634-36332656 CCCGCCTGTGCCATCTTGGGTGC 0: 1
1: 0
2: 1
3: 22
4: 171
Right 1172623151 20:36332668-36332690 TCATCTGTCCCGGCAGCCCCAGG 0: 1
1: 0
2: 5
3: 44
4: 301
1172623145_1172623152 14 Left 1172623145 20:36332634-36332656 CCCGCCTGTGCCATCTTGGGTGC 0: 1
1: 0
2: 1
3: 22
4: 171
Right 1172623152 20:36332671-36332693 TCTGTCCCGGCAGCCCCAGGAGG 0: 1
1: 0
2: 2
3: 19
4: 244
1172623145_1172623150 1 Left 1172623145 20:36332634-36332656 CCCGCCTGTGCCATCTTGGGTGC 0: 1
1: 0
2: 1
3: 22
4: 171
Right 1172623150 20:36332658-36332680 TCACTGTGCATCATCTGTCCCGG 0: 1
1: 0
2: 1
3: 15
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172623145 Original CRISPR GCACCCAAGATGGCACAGGC GGG (reversed) Intronic
900479658 1:2891870-2891892 CCACCCAAAGTGGCAGAGGCAGG - Intergenic
901160996 1:7176786-7176808 CTGCCCAAGATGGCACAGCCAGG - Intronic
901780732 1:11593034-11593056 GCACCCAGGATGGCACAGCCTGG - Intergenic
902384209 1:16067216-16067238 GGCCCCATGATGTCACAGGCTGG + Intronic
902983214 1:20139970-20139992 GCACCCCAGATGGCAGAGCCAGG - Intronic
902983704 1:20142819-20142841 GCCCCCAGGAGGGCAGAGGCAGG + Intronic
903576717 1:24343944-24343966 GCTCCCAAGATGGCAAAGAGAGG - Intronic
906167429 1:43697321-43697343 GCACCAGAGATGGCAATGGCAGG + Intronic
906242579 1:44251050-44251072 GTACCCAAGATGGCAGGAGCTGG - Intronic
908847839 1:68342964-68342986 CCACCCAAGATGCGACAGGCCGG + Intergenic
911172599 1:94784882-94784904 GCACTTAACATGGCAAAGGCAGG - Intergenic
912550444 1:110482037-110482059 CCACCCAAGTTGACACAGACAGG + Intergenic
913140912 1:115940685-115940707 GCACACCACATGGCAAAGGCAGG + Intergenic
915517125 1:156420166-156420188 GCACCCCAGTCGGCACAGGTAGG - Intronic
915715344 1:157939972-157939994 GAACACAAGATATCACAGGCTGG - Intergenic
915844405 1:159248683-159248705 GCACTCCACATGGCACAAGCAGG - Intergenic
922119119 1:222644611-222644633 GGACCCAAGCTGTCACAGGCGGG + Intronic
922897892 1:229114676-229114698 GCACCCGAGGGGCCACAGGCAGG + Intergenic
923515629 1:234695719-234695741 TGCCCCAGGATGGCACAGGCAGG - Intergenic
1063196367 10:3747358-3747380 GCACCCAGGAAGGCTCAGCCTGG + Intergenic
1065144391 10:22753734-22753756 GCTCCCAAGTTGGCACAGAGGGG + Intergenic
1070820528 10:79351500-79351522 CCAACCACAATGGCACAGGCGGG + Exonic
1073176239 10:101559336-101559358 GGGCACAAGATGGGACAGGCAGG - Intergenic
1073598214 10:104821095-104821117 GCAGCCAAGAATGCACAAGCCGG - Intronic
1074154333 10:110785197-110785219 GCACCTGACATGCCACAGGCTGG + Intronic
1075560092 10:123461795-123461817 GCAGCCCAGGTGGCACAGGAAGG - Intergenic
1077194911 11:1274632-1274654 GGCTCCAAGATGGCACAGTCAGG + Exonic
1077533933 11:3110079-3110101 GCACTCAGGATGGCCCAGGAAGG + Intronic
1077563878 11:3283904-3283926 GCAGCCTAGATGGCCCAGCCAGG - Intergenic
1077569768 11:3329721-3329743 GCAGCCCAGATGGCCCAGCCAGG - Intergenic
1078265963 11:9756569-9756591 CCACCCAAGATGACACAGTAAGG - Intergenic
1078779286 11:14421866-14421888 GCAACCAAGAAGGTTCAGGCCGG + Intergenic
1079947673 11:26764410-26764432 GCACCCAACATAGAACTGGCAGG - Intergenic
1080675917 11:34426810-34426832 GAGCCCCAGATGGCACAGTCGGG - Intergenic
1081529567 11:43948667-43948689 TCTCCCTATATGGCACAGGCTGG + Intergenic
1082850090 11:57756695-57756717 GCAGTCAAGGTGGCTCAGGCTGG + Intronic
1083256521 11:61499418-61499440 GCACTTCAGATGGCAGAGGCGGG + Intergenic
1083307657 11:61769547-61769569 GCGTCCATGATGGCGCAGGCGGG - Intronic
1084500045 11:69530091-69530113 GCACCCAGGATGCCCCAGGCTGG + Intergenic
1089485390 11:118841601-118841623 GCACCCATGATGAGACTGGCTGG + Intergenic
1089689735 11:120179858-120179880 TTACCCAAGATTGCACAGCCAGG + Intronic
1089814063 11:121156859-121156881 CTACTCAAGATGGCACAGGTGGG + Intronic
1096799066 12:54097346-54097368 GAACCCAAGTTGGGACAGGCAGG + Intergenic
1098307593 12:69117151-69117173 GAACTGAAGATGGCACAGGGAGG - Intergenic
1101585362 12:106080925-106080947 GGACCCATGCTGGCAAAGGCAGG - Intronic
1103935574 12:124474806-124474828 GCCCCAAGGATGGCACAGGGCGG - Intronic
1104968009 12:132518074-132518096 GCACACAGGACTGCACAGGCAGG + Intronic
1107117470 13:36762491-36762513 GCAGACAAGGTGGCACTGGCTGG - Intergenic
1107173638 13:37375268-37375290 TCACCCAAGTTTGCACAGTCAGG + Intergenic
1108487876 13:50945397-50945419 GCAACCAAGAGGGGAAAGGCAGG - Intronic
1112415556 13:99200947-99200969 GCAGCCAGGATGGCGGAGGCCGG - Intronic
1113356601 13:109587098-109587120 GCACTCAAGATTCCACAGGTGGG + Intergenic
1116809071 14:49522101-49522123 ACACCCAAGAGGGCAAAGACTGG - Intergenic
1118732871 14:68681531-68681553 GCAGGCAAGATGGAGCAGGCAGG + Intronic
1119272986 14:73326091-73326113 GTACCAAAGAAGGCACAGGAAGG + Intronic
1120963770 14:90149470-90149492 GCAGGCAAGAGGGCACATGCAGG + Intronic
1122088673 14:99323771-99323793 GCACCCAAGAGGGACCAAGCCGG + Intergenic
1122447683 14:101781517-101781539 GCGCCCAGGAAGGCGCAGGCTGG - Intronic
1122626028 14:103085759-103085781 GCCTGCAAGAGGGCACAGGCAGG - Intergenic
1126719425 15:51561473-51561495 GCACCCGTGGTGGCAGAGGCAGG + Intronic
1127812216 15:62574000-62574022 GCACCAAAGATGGGACACCCAGG - Intronic
1127899631 15:63331346-63331368 GCATCAAAGATGGTACAGGGAGG + Intronic
1128040786 15:64571697-64571719 TCACCCAGGATCGCCCAGGCTGG + Intronic
1128340734 15:66821043-66821065 TGCCTCAAGATGGCACAGGCAGG - Intergenic
1129183989 15:73894586-73894608 GGACCCAAGATGGGGCTGGCAGG + Intergenic
1131437118 15:92431958-92431980 GGACACAAGATGGCAAAGGCTGG - Intronic
1137458094 16:48633630-48633652 GCTACCAAGAAGGCAGAGGCGGG + Intergenic
1137761103 16:50940922-50940944 GCACCCCAGCTGGCCCAAGCAGG - Intergenic
1138983227 16:62295854-62295876 GCAGACATGATGGCACATGCCGG + Intergenic
1139473268 16:67189571-67189593 GCAACAAAGATGGGACTGGCTGG - Intronic
1144550906 17:16240186-16240208 GCATCCTACATGGCAGAGGCAGG - Intronic
1146071090 17:29682537-29682559 GCACTCAGGAAGGCAGAGGCAGG + Intronic
1148165557 17:45481941-45481963 GTACCCAAGATAGCCCAGGAGGG + Intronic
1148954231 17:51340373-51340395 GCAGCCAAGAAGGCCAAGGCTGG - Intergenic
1149851836 17:60041745-60041767 GCAGCCAACATGTCAGAGGCAGG + Intergenic
1150221784 17:63499804-63499826 TCACCCAAGGAGGCAGAGGCAGG - Intronic
1150396783 17:64828659-64828681 GTACCCAAGATAGCCCAGGAGGG + Intergenic
1151345111 17:73496662-73496684 TGACCCAAGATGGCAGAGGTAGG - Intronic
1153667822 18:7382095-7382117 GCCCCCCATAAGGCACAGGCAGG + Intergenic
1153922868 18:9806599-9806621 CCACCCAAGATGCCACAGAATGG + Intronic
1157464613 18:47932049-47932071 GCACCCACTGTGACACAGGCAGG + Intergenic
1157596646 18:48868142-48868164 GCACAGCAGATGCCACAGGCAGG - Intergenic
1161633629 19:5373235-5373257 ACACCCAAGGTCGCTCAGGCAGG - Intergenic
1162904294 19:13814482-13814504 GCACCCAACATGGCTCAGTGAGG - Intronic
1164734498 19:30530921-30530943 GCACCCATCCTGGCACAGGCTGG + Intronic
1166006473 19:39911081-39911103 TCAACCAAGCTGGCCCAGGCTGG + Intronic
1166986000 19:46660390-46660412 TCACCCAAGGTGACACAGCCAGG - Intronic
1167402709 19:49283510-49283532 TCACCTAAGAATGCACAGGCTGG - Intergenic
1167454343 19:49590700-49590722 ATACACAAGATGGCACAGCCGGG - Exonic
925203231 2:1985879-1985901 GCACCCATTGAGGCACAGGCTGG - Intronic
925609124 2:5689959-5689981 GCACTGAAGGCGGCACAGGCGGG - Intergenic
926119923 2:10236282-10236304 GCTGCCCAGAGGGCACAGGCAGG + Intergenic
928304479 2:30155857-30155879 GCCTCCAAGATGGTCCAGGCTGG - Exonic
934602486 2:95668191-95668213 GCCCTCAAGATGGAACAGCCAGG + Intergenic
934714341 2:96534967-96534989 GTTCCCAGGCTGGCACAGGCAGG + Intergenic
935692439 2:105744167-105744189 GCAACCAGGATTCCACAGGCTGG + Intergenic
937122971 2:119453485-119453507 TCACACAAGATGGCACAAGATGG - Intronic
937904887 2:127048254-127048276 GCACACATGCGGGCACAGGCAGG + Exonic
940869248 2:158846521-158846543 GCACCCAAAGTGGCAAAGACTGG + Intronic
942251012 2:174047851-174047873 GCACCAGGGCTGGCACAGGCTGG - Intergenic
943464225 2:188208699-188208721 CCATTCATGATGGCACAGGCTGG + Intergenic
945281075 2:208036115-208036137 GCACTTAGGATGGCAGAGGCAGG + Intergenic
946024086 2:216661464-216661486 GGACCCAAGATGGCAGAGCTGGG - Intronic
946932858 2:224688636-224688658 TCACCCAGGCTGGCCCAGGCTGG + Intergenic
948974982 2:241458431-241458453 GCAGGTAGGATGGCACAGGCAGG + Intronic
1169217247 20:3800946-3800968 GCAGCCAAGATGGGAGAGGAGGG - Intronic
1169344711 20:4821231-4821253 GCTCCTAAGATGGCACAAACTGG + Intronic
1171797355 20:29577003-29577025 GAACCCAAGTTGGGACAGGCAGG - Intergenic
1171850896 20:30307158-30307180 GAACCCAAGTTGGGACAGGCAGG + Intergenic
1172210724 20:33196439-33196461 TTACCCCAGATGGCACCGGCAGG - Intergenic
1172623145 20:36332634-36332656 GCACCCAAGATGGCACAGGCGGG - Intronic
1173565698 20:44036854-44036876 GCACCCAGCCTGGCACAGGAGGG - Intronic
1173897231 20:46560285-46560307 TCACCCAAGATCGCACAGCCAGG + Intronic
1174210654 20:48875506-48875528 GCATCTAAGAGGGCACAGTCAGG + Intergenic
1176055060 20:63140991-63141013 GCACCCAGGATGCACCAGGCTGG + Intergenic
1176297364 21:5081240-5081262 GAAGACAAGATGGCTCAGGCGGG + Intergenic
1176412047 21:6454396-6454418 GTAGCCCAGGTGGCACAGGCAGG - Intergenic
1178373803 21:32050039-32050061 GCAGCCAGGCTGGCACAGGCTGG + Intergenic
1179687541 21:43062718-43062740 GTAGCCCAGGTGGCACAGGCAGG - Intronic
1179859665 21:44180708-44180730 GAAGACAAGATGGCTCAGGCGGG - Intergenic
1180931566 22:19595864-19595886 GAGCACAAGATGGCCCAGGCCGG + Intergenic
1181466599 22:23113778-23113800 GCACTCAGGATGGCCCAGGCAGG + Intronic
1185284705 22:49995067-49995089 GCACCCAAGGATGCACAGACAGG + Exonic
953203018 3:40794663-40794685 GCCCCCAAGATGTCTCATGCTGG - Intergenic
953343270 3:42153712-42153734 TCACCCAAGATGGCGGTGGCTGG + Intronic
954132828 3:48568981-48569003 CCACCCGCTATGGCACAGGCTGG - Intronic
960601472 3:119463272-119463294 ACACCCAAGAGGGCCGAGGCAGG + Intronic
962385916 3:134932553-134932575 AGACCCAAGATCACACAGGCAGG - Intronic
962676066 3:137759655-137759677 GCAGACAAGATGGCACAGGAGGG - Intergenic
963699515 3:148607059-148607081 TCACCCAAGATGGTTCTGGCTGG - Intergenic
967873491 3:194251012-194251034 ACACCCAAGACGGCACACTCAGG + Intergenic
968541225 4:1169383-1169405 GCACCGAGGCTGGCACAGGGAGG + Intronic
968754342 4:2407618-2407640 GCTCCCACAATTGCACAGGCTGG + Intronic
970993453 4:22238647-22238669 GCACCCAAGGTGGCCCAGGTGGG + Intergenic
973598781 4:52520419-52520441 GCTCCTGAGATGGCACAGGAGGG - Intergenic
973743051 4:53936858-53936880 GCAGCATAGATGGCTCAGGCTGG - Intronic
982088645 4:151861625-151861647 GGACCCAAGATGCAAAAGGCAGG - Intergenic
982464661 4:155715448-155715470 GCACCCATGCTGGCAAATGCTGG - Intronic
985963252 5:3319817-3319839 GCTCTCAAGGAGGCACAGGCTGG + Intergenic
989100481 5:37818394-37818416 GCAGGCAAGAGGGCATAGGCAGG - Intronic
991216918 5:64166051-64166073 GCCCCCACGTTGGCCCAGGCGGG + Intronic
992256103 5:74922771-74922793 GAACTCAAGATGGCTCAGGGAGG - Intergenic
994926042 5:106118353-106118375 TCACCCAGGCTGGCCCAGGCTGG - Intergenic
995551150 5:113282853-113282875 GCAGCCAGGAAGTCACAGGCTGG - Intronic
998272688 5:140721076-140721098 GAAGCCAAGATGGCACAGAAAGG - Intergenic
998273436 5:140728151-140728173 GAAGCCAAGATGGCACAGAAAGG - Intergenic
1002305359 5:178279724-178279746 GCACCCAAGATGGGCCGGGATGG - Intronic
1003190741 6:3872148-3872170 GCACCAAACATGGCAAAAGCAGG + Intergenic
1006028295 6:31161469-31161491 ACTCCCAAGAGGTCACAGGCTGG + Exonic
1006193286 6:32222472-32222494 GCAGCCAGGAGGGGACAGGCAGG - Intronic
1006449945 6:34099913-34099935 GCTCCCCAGATGGCTCTGGCGGG - Intronic
1006627261 6:35406222-35406244 GCACTAAAGATAGCACAGGCTGG - Intronic
1007100105 6:39240149-39240171 GGACCCAAGCTGGCCCAGCCTGG + Intergenic
1013778447 6:113704295-113704317 GCACTCAAAATGGCAAAGACAGG + Intergenic
1014736604 6:125101411-125101433 GCACCCTGGATGGTACAGGCAGG - Intergenic
1015485053 6:133760216-133760238 TCACAGAAGATGGCACAGCCTGG - Intergenic
1017904037 6:158743740-158743762 ACACTCAAAAAGGCACAGGCCGG - Intronic
1017959241 6:159207351-159207373 TCATGCAAGGTGGCACAGGCAGG - Intronic
1018800396 6:167217764-167217786 GCTCCTTAGAAGGCACAGGCTGG - Intergenic
1019927274 7:4201706-4201728 ACACCCAGCATGGCACAGGGTGG + Intronic
1022602624 7:31776107-31776129 GCATCCAGGATGGAACAGGATGG + Intronic
1022637019 7:32145820-32145842 GCACACAAAGTGGCAGAGGCAGG + Intronic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1029264126 7:99325348-99325370 GCTCCCAAGATGGCGCAGCAGGG - Intergenic
1029526720 7:101099238-101099260 GGACCCCAAATGCCACAGGCTGG - Intergenic
1032103820 7:129007219-129007241 TCGCCCAATATGGCACAGGTAGG + Intronic
1032459500 7:132099719-132099741 TCACCCAGGATGGACCAGGCTGG - Intergenic
1032513390 7:132489743-132489765 GCTCCCAAGATGGCGCTGGGAGG - Intronic
1033917641 7:146347163-146347185 GCATGCCAAATGGCACAGGCAGG - Intronic
1037461280 8:19112224-19112246 TCACCCAAGATCACACAGGGAGG - Intergenic
1040340997 8:46440988-46441010 GCACCCAAGCTGTTCCAGGCAGG - Intergenic
1041037954 8:53814366-53814388 GCTGCCAAGATGATACAGGCTGG - Intronic
1041096881 8:54359390-54359412 GCAGGCAAGATGGCACGTGCAGG - Intergenic
1044926161 8:97210356-97210378 ACACCCAGGATGGGTCAGGCTGG + Intergenic
1049717248 8:144098843-144098865 GTACCAGAGGTGGCACAGGCAGG - Intronic
1052352679 9:27473402-27473424 GCTCACAGGAGGGCACAGGCAGG + Intronic
1052494864 9:29213160-29213182 GCAGCCAAGTTGGCCCAGGAGGG - Intergenic
1053423265 9:37994523-37994545 GCTCCCCAGAGGGCATAGGCTGG - Intronic
1053788676 9:41670450-41670472 GAACCCAAGTTGGGACAGGCAGG + Intergenic
1054156462 9:61644318-61644340 GAACCCAAGTTGGGACAGGCAGG - Intergenic
1054176961 9:61881789-61881811 GAACCCAAGTTGGGACAGGCAGG + Intergenic
1054476233 9:65575327-65575349 GAACCCAAGTTGGGACAGGCAGG - Intergenic
1054660573 9:67699017-67699039 GAACCCAAGTTGGGACAGGCAGG - Intergenic
1054916597 9:70500250-70500272 GCTCCCAAGATGTCAGGGGCAGG - Intergenic
1055861939 9:80762146-80762168 GCATGCATGCTGGCACAGGCGGG - Intergenic
1055883965 9:81036993-81037015 GCTCCTAAGATGTCACAGGCTGG - Intergenic
1056019164 9:82423548-82423570 GCACTTAAGAAGCCACAGGCAGG + Intergenic
1061013052 9:127966724-127966746 GCACCCAGCATGGCCCAGCCTGG + Intronic
1062232248 9:135487943-135487965 CCAACCAGGAAGGCACAGGCAGG + Exonic
1186456959 X:9717343-9717365 GAACCGAAGAAGCCACAGGCAGG + Exonic
1187420747 X:19131560-19131582 ACTCCCAAGATGGCTGAGGCAGG + Intergenic
1194734795 X:97499304-97499326 GCACCTAAAATAGCACAGCCAGG + Intronic
1195065236 X:101233738-101233760 CCACCCAGGGTAGCACAGGCAGG + Intronic
1195321919 X:103727662-103727684 GCAACCAAGTGAGCACAGGCAGG + Intronic
1198128311 X:133669320-133669342 GTAGCCAAGATGACAAAGGCAGG - Intronic