ID: 1172624639

View in Genome Browser
Species Human (GRCh38)
Location 20:36340216-36340238
Sequence GCTGTTGGGCAGCCAGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 357}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172624639_1172624653 26 Left 1172624639 20:36340216-36340238 CCTTCTCCTGGCTGCCCAACAGC 0: 1
1: 0
2: 2
3: 29
4: 357
Right 1172624653 20:36340265-36340287 ACTTCTGGCTGTTCCGGAAGTGG 0: 1
1: 0
2: 0
3: 3
4: 102
1172624639_1172624652 20 Left 1172624639 20:36340216-36340238 CCTTCTCCTGGCTGCCCAACAGC 0: 1
1: 0
2: 2
3: 29
4: 357
Right 1172624652 20:36340259-36340281 TCGGGAACTTCTGGCTGTTCCGG 0: 1
1: 0
2: 0
3: 6
4: 71
1172624639_1172624646 1 Left 1172624639 20:36340216-36340238 CCTTCTCCTGGCTGCCCAACAGC 0: 1
1: 0
2: 2
3: 29
4: 357
Right 1172624646 20:36340240-36340262 CCTGCACACCCTCCGTTTCTCGG 0: 1
1: 0
2: 0
3: 8
4: 189
1172624639_1172624650 11 Left 1172624639 20:36340216-36340238 CCTTCTCCTGGCTGCCCAACAGC 0: 1
1: 0
2: 2
3: 29
4: 357
Right 1172624650 20:36340250-36340272 CTCCGTTTCTCGGGAACTTCTGG 0: 1
1: 0
2: 0
3: 0
4: 53
1172624639_1172624647 2 Left 1172624639 20:36340216-36340238 CCTTCTCCTGGCTGCCCAACAGC 0: 1
1: 0
2: 2
3: 29
4: 357
Right 1172624647 20:36340241-36340263 CTGCACACCCTCCGTTTCTCGGG 0: 1
1: 0
2: 2
3: 9
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172624639 Original CRISPR GCTGTTGGGCAGCCAGGAGA AGG (reversed) Intronic
900399922 1:2468747-2468769 GCTGCTGGGCAGACTGGGGACGG + Intronic
900486051 1:2923338-2923360 GGTCATGGTCAGCCAGGAGAAGG - Intergenic
900792531 1:4689833-4689855 GCTGCTGGGCATCCGCGAGAGGG - Intronic
901691862 1:10978869-10978891 GCTGGTGGGCAAAAAGGAGAGGG + Intronic
902105616 1:14033485-14033507 GCACTTGCGCAGCCAGGAGACGG - Intergenic
902215496 1:14932052-14932074 GCTGGTGGGCAGCCTGGAGCCGG - Intronic
902369861 1:15999243-15999265 GCAGCTGGGGAGCCAGCAGAGGG + Intergenic
903065501 1:20697118-20697140 CCTCTGGGGCAGACAGGAGAAGG - Intronic
903283580 1:22263776-22263798 GGTCTTGGGCAGCCAGAACAGGG + Intergenic
903344421 1:22675348-22675370 GGAGATGGGCAGGCAGGAGAAGG - Intergenic
903743126 1:25569889-25569911 GCTCCTGGGAAGCCAGGACATGG - Intergenic
903768316 1:25748802-25748824 GCTGTGGGGCAGACAGGGAAAGG - Intronic
904013292 1:27402490-27402512 GCCACTGGGCAGCCAGGAGGGGG + Intergenic
904037043 1:27564595-27564617 CCAGGTGGGGAGCCAGGAGATGG - Intronic
904207175 1:28862899-28862921 GCTGTCGGGCTCCAAGGAGAAGG + Exonic
904239629 1:29135294-29135316 GCACTTGGGCAGCCTGGAGCAGG + Intergenic
904479853 1:30786904-30786926 GCTGCTGGGAAGTCAGGGGAGGG + Intergenic
904592665 1:31623707-31623729 GCTGATGGGCAGGTAGCAGAGGG - Exonic
905178208 1:36151053-36151075 GCTGTTGGACAGGCAGGGAAAGG - Intronic
905246330 1:36616841-36616863 GCTGCTGGGCAGACAGGCAAGGG + Intergenic
905886000 1:41492311-41492333 GCTGATGCTCAGACAGGAGAAGG - Intergenic
906011339 1:42529625-42529647 GGTGTTTGGCAGCCAGGTGATGG + Intronic
907482503 1:54754702-54754724 ACTGTGGGGAAGCCGGGAGAAGG - Intergenic
907831822 1:58071430-58071452 GCTGCTGGGCTGCTAAGAGAAGG + Intronic
908288954 1:62641663-62641685 GCCGCTGGGCAACCCGGAGATGG + Intronic
909253042 1:73382379-73382401 GCTGTTGAGCAGCTTAGAGACGG + Intergenic
910621387 1:89259631-89259653 GCTGCAGGGCAGCTAGGGGAGGG - Intronic
912715740 1:111982513-111982535 CCTGCTGGGCAGCACGGAGAAGG - Exonic
915994632 1:160550381-160550403 GCTGGTGGGGACACAGGAGAGGG + Intronic
916498241 1:165364728-165364750 GCTTTGGGGCTGCCTGGAGAGGG - Intergenic
916602605 1:166307652-166307674 GCTGTTAGGCAGGCAGAGGAGGG - Intergenic
918119639 1:181527229-181527251 GCTGTCCAGCAGCCAGGAAAGGG - Intronic
918308021 1:183264839-183264861 GAGGTAGGGCAACCAGGAGAGGG - Intronic
920039560 1:203086461-203086483 GCTGTCAGGAAGCAAGGAGATGG - Intergenic
920118823 1:203640197-203640219 GGGGTTGGGCAGTCAAGAGAAGG - Intronic
921048006 1:211491054-211491076 GCAGAGGTGCAGCCAGGAGAGGG + Intronic
921117233 1:212104641-212104663 TCAGTAGGGCTGCCAGGAGATGG - Exonic
921866752 1:220094438-220094460 GCTGCTGGGCCGCCAGCAGCCGG + Exonic
922593972 1:226799409-226799431 GCTGAGGGACAGCCAGGAGAAGG + Intergenic
922695067 1:227727031-227727053 GGTCTTGGGCAGCCACAAGACGG - Intergenic
922785281 1:228279506-228279528 GCTGTTGGGAGGCCTGGACAGGG + Intronic
922874279 1:228927576-228927598 GCAACTGGGCAGCCAGGAAAAGG - Intergenic
922960843 1:229644536-229644558 CGTGTTGGGCTGCCAGGAGCAGG + Intronic
922987174 1:229874790-229874812 GCTGATGAGCACCCAGGGGAAGG + Intergenic
924567906 1:245213242-245213264 GCTGGTGGGGGGCCTGGAGAGGG + Intronic
924749743 1:246875018-246875040 GTTGTTGGCCTGTCAGGAGATGG - Intronic
924842732 1:247730760-247730782 GATGTTGGAGGGCCAGGAGAAGG + Intergenic
1062931437 10:1355092-1355114 GGAGGTGGGCAGCCAGGGGAGGG - Intronic
1064100873 10:12463028-12463050 TCTGTTGGGCAACCAGCAGCTGG + Intronic
1065188187 10:23189230-23189252 GCAGTTGGGGAGCCTGGAGAGGG - Intergenic
1066250867 10:33631599-33631621 TGTCTTGGGCAGCCATGAGAAGG - Intergenic
1067038193 10:42934235-42934257 GCTGGTGGGCAGCCATAAGGAGG - Intergenic
1067087189 10:43249223-43249245 GGTGTGGGGCAGTGAGGAGATGG - Intronic
1069557406 10:69407221-69407243 GTGGTAGGGCAGCCAGCAGATGG + Exonic
1069691816 10:70358693-70358715 GCTGGTGGGCAGAGAGGGGAGGG - Intronic
1070666738 10:78350412-78350434 GCTGTGGGGCAGAGGGGAGAGGG - Intergenic
1070748097 10:78947301-78947323 GCTGCTGGGCTGGCAGGGGAGGG - Intergenic
1072632277 10:97154634-97154656 GCTGGTTGGCAGCCAACAGAGGG - Intronic
1072718140 10:97765159-97765181 GCTGTGGGGCAGCAGGGCGAGGG - Intergenic
1072957066 10:99896572-99896594 GACAATGGGCAGCCAGGAGAGGG + Intronic
1073209480 10:101787710-101787732 TCTGTTGGCCAGGCTGGAGAGGG + Intronic
1073570407 10:104576514-104576536 GATGTGGGCCAGCCAGGACAGGG - Intergenic
1074534333 10:114317915-114317937 GCTGTTTAGCAGTCAGCAGAAGG + Intronic
1075015702 10:118908695-118908717 ACTTTGGGGAAGCCAGGAGAGGG + Intergenic
1075027971 10:119000905-119000927 CCTGGAGGGCAGCCAGGAGCCGG - Intergenic
1075051793 10:119187651-119187673 GCTGTGGGGCCACCAGGACATGG + Intergenic
1075326188 10:121533962-121533984 GCTGTTGGACTTGCAGGAGAGGG - Intronic
1075339325 10:121632993-121633015 GCTGTTGGGCGGCAGGGAGGGGG + Intergenic
1076667508 10:132101652-132101674 GTGGTGCGGCAGCCAGGAGAGGG + Intergenic
1076893605 10:133297665-133297687 GCTGTGGGGCAGCCTGCAGCAGG - Intronic
1077250828 11:1559937-1559959 GCTGTGTGGCAGGCAGGAGGAGG - Intronic
1077480663 11:2812927-2812949 GCAGCTTTGCAGCCAGGAGAGGG - Intronic
1077805426 11:5587253-5587275 GCTTTTGGGCAGCTAGGAGGAGG + Intronic
1077995631 11:7449897-7449919 GTAGTTGGGCAGGCAGGAGAGGG - Intronic
1079436234 11:20454027-20454049 ATTGTTTGGCAGCCAGTAGATGG - Intronic
1080599179 11:33805983-33806005 GCACATGGGCAGCAAGGAGAAGG + Intergenic
1080836626 11:35945546-35945568 GACATTGGGCAGCCAGGAGCAGG + Intronic
1080896083 11:36449751-36449773 GCTGTTTGGCAGCCAAGCCAAGG + Intronic
1083451942 11:62752160-62752182 GCTGTTGGGGAGCCAGGGAGAGG + Exonic
1083871875 11:65493403-65493425 GAAGGTGGGCAGCCAGGGGATGG + Intergenic
1084711089 11:70844121-70844143 GATGTGGGGAAGCCAGGCGAGGG - Intronic
1084932386 11:72567416-72567438 GCTGTTGATCCGACAGGAGATGG + Intergenic
1084948463 11:72651776-72651798 TCACTTGGGCAGCCAGGAAAGGG - Intronic
1086956772 11:92941811-92941833 GGTGTTCGGCAGGCAGGAGTAGG + Intergenic
1088640832 11:111871374-111871396 GCTGCTGGGCAGCCGAGAGGCGG - Intronic
1089640243 11:119843191-119843213 GCTCCAGGGGAGCCAGGAGAGGG + Intergenic
1090102535 11:123815299-123815321 GCTGCTGGGCTGGCAGGAGATGG - Intergenic
1091457334 12:617774-617796 TCTGTTGGGCAGCGAGGTCAGGG + Intronic
1091995115 12:4987264-4987286 GCTGCCAGGCAGGCAGGAGAAGG - Intergenic
1092015394 12:5154298-5154320 GCAGATGCACAGCCAGGAGAGGG - Intergenic
1092283268 12:7113595-7113617 GCTGTTTGGATTCCAGGAGAGGG - Intergenic
1092359892 12:7827742-7827764 CCTGTAAGGCAGCCAGGAAAGGG + Intronic
1092372630 12:7929932-7929954 CCTGTAAGGCAGCCAGGAAAGGG + Intronic
1093581562 12:20790021-20790043 GCTGTTTGGGAGCCAGGAATTGG + Intergenic
1093850234 12:24027595-24027617 GCTTTGGGGCAGCAAGTAGAGGG - Intergenic
1094022842 12:25932354-25932376 TTAGTTGGGCAGCCAGGAGTGGG + Intergenic
1094310661 12:29077222-29077244 GGTGTTGGGGAGCTAGGGGAGGG + Intergenic
1095206331 12:39443487-39443509 GCTGCTGGGCAGGGAGGCGAGGG + Intergenic
1095906172 12:47380299-47380321 TGTCTTGGGCAGCCATGAGATGG + Intergenic
1096193547 12:49634748-49634770 GCTGGAGGGCCTCCAGGAGAAGG + Intronic
1096279693 12:50242035-50242057 GCTGTGGGGCAGGCAGCTGATGG + Intronic
1096816516 12:54205200-54205222 TCTAATGGGCAGCCAGGTGATGG - Intergenic
1096933270 12:55239987-55240009 TCTGTTGGCTAGCCTGGAGAAGG + Intergenic
1097167792 12:57094829-57094851 GCAGGTGGGGAGGCAGGAGAAGG - Exonic
1101230542 12:102736787-102736809 GCTGCTGGTCAGATAGGAGAAGG + Intergenic
1103039558 12:117684106-117684128 GCTCTAGGGGAGCCAGGTGATGG - Intronic
1103899400 12:124295506-124295528 GCTGGGGGGCAGCCCGGAGTCGG - Intronic
1104650350 12:130526931-130526953 GCTGGTGGGAAGCCTGGAGAGGG + Intronic
1104966621 12:132511291-132511313 ACTGTGGGGAAGCCGGGAGAAGG - Intronic
1105492482 13:20902444-20902466 GGTGCTGGGCAGCCAGGGGAAGG + Intronic
1106634250 13:31510133-31510155 GCTGGTGGGCAGTCAGGGGATGG + Intergenic
1108074979 13:46670584-46670606 GCTGTTGGGCTGCCACCAAAGGG + Intronic
1111069461 13:83145676-83145698 CCTGCTGAGCATCCAGGAGAAGG + Intergenic
1111939458 13:94594569-94594591 AATGTTGGGCTCCCAGGAGAGGG + Intronic
1113027567 13:105957837-105957859 GCTGTTGGCCAGAAAGGAAATGG + Intergenic
1113494905 13:110719323-110719345 GCTGATCCGCAGCCAGGAGCTGG + Exonic
1113571916 13:111363816-111363838 GCTGATGGGCAGCTATGGGAAGG + Intergenic
1113970529 13:114185338-114185360 GCAGTTGGGCACACAGGAGCAGG + Intergenic
1122549780 14:102543688-102543710 TCTGTTGGGCTCCCTGGAGAGGG - Intergenic
1122837420 14:104436988-104437010 GGTGTTAGGCAGCCAGCAGTGGG + Intergenic
1124002471 15:25770549-25770571 ACTGTTACCCAGCCAGGAGAAGG + Intronic
1127066723 15:55247897-55247919 GGTGTTGGGTAGGCAGGACAAGG - Intronic
1127793935 15:62422645-62422667 GCTGCTGGAGTGCCAGGAGATGG - Intronic
1128006469 15:64246733-64246755 GCTGCTGGGAAGCCAGGATATGG + Intronic
1128313455 15:66645856-66645878 CCTGTTGGGAAGACTGGAGATGG + Intronic
1130067212 15:80614758-80614780 GCTGTTTGGCAGCCATTAAAAGG + Intergenic
1131030909 15:89185358-89185380 GCAGGCGGGCAGCCAGGAGGGGG - Intronic
1131057381 15:89383717-89383739 GAGGAGGGGCAGCCAGGAGAGGG - Intergenic
1131229700 15:90651037-90651059 TGTCTCGGGCAGCCAGGAGATGG - Intergenic
1131233649 15:90677950-90677972 TCTGTTGAGCAGCCAGGACTGGG + Intergenic
1131486202 15:92822854-92822876 GATAGTGGGAAGCCAGGAGAAGG + Intergenic
1132251125 15:100336176-100336198 GCTGGTGGGCAGCCTGGTGCAGG + Intronic
1132864035 16:2084914-2084936 GATGGTGGGCACCCAGGTGAGGG - Intronic
1132877855 16:2148359-2148381 GGTGGTGTGCAGCCAGCAGAGGG + Intronic
1133217742 16:4303640-4303662 TCTGTTGGGTAGCCAGGGCATGG + Intergenic
1133255615 16:4514087-4514109 GCTGTGGGGCCCCCAGGATAAGG + Exonic
1133775893 16:8894795-8894817 CCTGCTGGACATCCAGGAGAAGG - Exonic
1134090672 16:11390190-11390212 TCTGTTGGGCGGCCTGGAGAGGG + Exonic
1135811017 16:25586868-25586890 GTTCTTGGGCATACAGGAGACGG - Intergenic
1136101149 16:27997186-27997208 GCATGTGGGCATCCAGGAGAAGG - Intronic
1136374814 16:29859156-29859178 GCAGGTGGGCAGCCAGGACCCGG + Exonic
1136628198 16:31474360-31474382 GCCTTTGGGAGGCCAGGAGACGG - Exonic
1138137911 16:54539569-54539591 GATGATGGGCAGGAAGGAGATGG - Intergenic
1138519677 16:57563805-57563827 GCTGTTTGGCAACCAGGACCTGG - Intronic
1138706936 16:58924792-58924814 GCTGTTGGGGAGGCAGAAGTGGG - Intergenic
1141703105 16:85651390-85651412 GCTGGGGGGCAGCCAGCAGGCGG - Intronic
1141941280 16:87277833-87277855 GCTGCGGGGCAGCCTGGAGGAGG - Intronic
1142341541 16:89526307-89526329 GCTGGGGGGCAGAAAGGAGAGGG - Exonic
1142713551 17:1736235-1736257 GGGGTTGGGCAGCAAGGGGAGGG - Intronic
1143130311 17:4673305-4673327 GGAGGTGGGCAGCGAGGAGACGG + Exonic
1144262512 17:13536450-13536472 TCTCTTGGGTACCCAGGAGATGG - Intronic
1144579464 17:16450245-16450267 GCTGATGGGAAGGCAAGAGAAGG + Intronic
1144713238 17:17416769-17416791 GCTGCTGGGCAGACAGGAAGGGG + Intergenic
1145894918 17:28450353-28450375 GATGTTGGGCAGCCAAGGGGAGG + Intergenic
1146892229 17:36513645-36513667 TGGGTTGGGCAGCCAGGAGAAGG + Exonic
1147723834 17:42554453-42554475 GGTGTTGGGCAGCCCAGAGGAGG + Exonic
1148161214 17:45451261-45451283 GCGGATGGGCAGCCAGCAGGGGG + Intronic
1149036097 17:52135843-52135865 GCAATGGGGAAGCCAGGAGAGGG - Intronic
1149658783 17:58324015-58324037 GCTTGGGGGAAGCCAGGAGAAGG - Intronic
1149863329 17:60136582-60136604 AGGGTTGGACAGCCAGGAGAAGG - Intergenic
1150409748 17:64933702-64933724 GCTATTGGCCAGGCAGGAAATGG + Intergenic
1151680461 17:75620175-75620197 GCAGGTGGGCAGGCAGGACAGGG + Intergenic
1151703571 17:75755537-75755559 GGTGCTGGGCAGCCTGGACAGGG + Intronic
1151758425 17:76087678-76087700 GCTTTTGGACTTCCAGGAGACGG - Exonic
1151895084 17:76974724-76974746 GCTCTTGGGGGGCCAGGAGCAGG + Intergenic
1151966792 17:77435735-77435757 GCTGCAGGACAGCCAGGAGGAGG - Intronic
1152009198 17:77700589-77700611 GCATGTGGGCACCCAGGAGAAGG + Intergenic
1152638500 17:81439880-81439902 GCTGAGGGGCAGCCAAGAGAGGG - Intronic
1152670311 17:81600276-81600298 TCTGTTGGGCATCCAGGCCAGGG - Intronic
1155155221 18:23151873-23151895 GCTGTGGGCCAGGCAGGACATGG + Intronic
1155421861 18:25664908-25664930 GATTCTGGGAAGCCAGGAGAGGG - Intergenic
1155476177 18:26237576-26237598 GCTGTAGGGAAGCTAGGATATGG + Intronic
1157433433 18:47649792-47649814 CCCGTTGGGCAGCCAGGAGTGGG - Intergenic
1157752970 18:50194820-50194842 GCCGCGGGGCAGCCAGGAGCCGG - Exonic
1158970790 18:62664399-62664421 GCCCTTGGACTGCCAGGAGATGG + Intergenic
1160163358 18:76491634-76491656 GTTGCTGGGCTGCCAGGAGGAGG - Intronic
1160790951 19:923505-923527 GCTGCTGTGCCCCCAGGAGATGG + Intergenic
1161354433 19:3811016-3811038 GCTGTTGAGTGGCCACGAGACGG + Intronic
1161950190 19:7463567-7463589 GCTGTGGGGCAGCCATGGGGAGG - Intronic
1161961632 19:7526627-7526649 GCTGGTGGGCAGGCAGGTGCAGG + Intronic
1162249124 19:9427708-9427730 TCTGTTGGGTAGCCTGGAAAAGG - Intronic
1162397477 19:10425433-10425455 GGTGCTGGGCAGCCAGGAGCTGG + Intronic
1162535583 19:11261700-11261722 GCTGGTGGGCAGACGGGGGAGGG - Intronic
1164511304 19:28899386-28899408 GCTATTAGGCTGCCAGGAGCAGG + Intergenic
1165905816 19:39194001-39194023 GAGGGTGGGCAGCCAGGACAAGG + Intergenic
1166309632 19:41955719-41955741 GCTCGAGGGCAGCCAGGAGGTGG - Intergenic
1166898044 19:46036325-46036347 GCTCTTGGGGGGCCAGGAGCAGG + Intergenic
1166965630 19:46528147-46528169 GCTGTCTGGCAGGCAGTAGAAGG - Intronic
1167659288 19:50786400-50786422 GGTGCTGGGGAGCCATGAGAGGG + Intergenic
1167749333 19:51370508-51370530 CCTGAGGGGCAGCCAGGAGCAGG - Intergenic
925608593 2:5684108-5684130 GCTGCTGGGGAACCAGGAGATGG - Intergenic
926715417 2:15920183-15920205 ACTGTTGGGCACCCAGGACTTGG - Intergenic
928107628 2:28481536-28481558 GCTGTTTTGCAGGCAGGGGATGG + Intronic
928142865 2:28745658-28745680 GCTCTTGTGCAGGAAGGAGAGGG + Intergenic
928407287 2:31024329-31024351 TGAGTTGTGCAGCCAGGAGAAGG - Intronic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
931056151 2:58473714-58473736 GCTGTGGGGCTGTCAGCAGAGGG - Intergenic
935634895 2:105242688-105242710 GGAGTGGGGCAGCCAGCAGAGGG - Exonic
937052548 2:118904266-118904288 GCTGTTGTGCAAACAGGAGCTGG - Intergenic
937118235 2:119424671-119424693 GCTGTAGAGCAGCCATGAGCTGG + Intergenic
937365348 2:121257265-121257287 GCTGTAGGGGAGGCAGGAGGGGG - Intronic
938306838 2:130262409-130262431 GCTCTTGAGAAGCCAGGAGATGG + Intergenic
938307790 2:130266678-130266700 GCTGGAGGGCAGCCAGGGGCAGG - Intergenic
938447547 2:131390163-131390185 GCTGGAGGGCAGCCAGGGGCAGG + Intergenic
940811164 2:158244510-158244532 GCTGATGGCCAGCAAGGAAATGG - Intronic
941964531 2:171287828-171287850 GCTGTTGTACATCCAGGAAAAGG - Intergenic
942278965 2:174342303-174342325 GCGGCTGGGCAGGCAGGAGCCGG + Intergenic
942455676 2:176136753-176136775 GCTGGTGGGGAGCCCGGCGAGGG + Intergenic
942613327 2:177763892-177763914 GCACTTGGCCAGCCAAGAGAAGG + Intronic
944650354 2:201823750-201823772 TCTGTGGGCAAGCCAGGAGAGGG - Intronic
946172563 2:217904176-217904198 GCTAGTGGGCAGGAAGGAGAGGG - Intronic
946177716 2:217931590-217931612 TCTGTTTGCCAGCCAGGACAAGG + Intronic
946219108 2:218211265-218211287 GATGTAGGGGAGCCAGAAGAGGG + Intergenic
947523165 2:230863938-230863960 GCTGTTGGGCTGCCAGTGGAGGG - Intergenic
947584088 2:231341521-231341543 TCTGTTGGTCAGGAAGGAGAGGG + Intronic
947752244 2:232539271-232539293 GCTGTTGGGTAGGCATGTGAGGG - Intergenic
948589264 2:239038917-239038939 GCTGGTTGGCAGGAAGGAGAGGG + Intergenic
948777007 2:240294420-240294442 GCAGTTGGGGAGGCAGGAGGAGG - Intergenic
949047344 2:241877958-241877980 GTTGGGGGGCGGCCAGGAGAGGG - Intergenic
1168963683 20:1886120-1886142 GCAGCTGGGCAGCCAGGCAACGG - Intergenic
1169823357 20:9738659-9738681 GAGGTTGGGCAGACAGGAAAAGG + Intronic
1170462434 20:16589804-16589826 GCTGTTGAGAAACCATGAGACGG - Intergenic
1172135640 20:32684879-32684901 GCTGTTGTGCAGCCAGGGTGGGG + Intergenic
1172624639 20:36340216-36340238 GCTGTTGGGCAGCCAGGAGAAGG - Intronic
1174425186 20:50427240-50427262 GCTATTAGGCAGCCAGTAAAGGG + Intergenic
1174447898 20:50602632-50602654 GCTGTAGGACAGACTGGAGAGGG + Exonic
1174672203 20:52318766-52318788 GTTTTTGAGGAGCCAGGAGAAGG + Intergenic
1175515513 20:59567445-59567467 CCTGCTGCACAGCCAGGAGAGGG - Intergenic
1175717737 20:61266623-61266645 GCTGGTGGGGAGTCTGGAGAGGG + Intronic
1175916808 20:62429813-62429835 CCTGGTGGGCAGCCAGGAAATGG - Intergenic
1175950927 20:62582589-62582611 GCAGCTGGGGAGCCTGGAGAAGG + Intergenic
1176101743 20:63367620-63367642 GATGTGGTGCAGCCAGGGGAGGG + Intronic
1179910653 21:44446057-44446079 GCTGTGGGGAAGCCTGGGGATGG - Intergenic
1179949664 21:44702683-44702705 GCAGCTGGGCTGGCAGGAGAAGG - Intronic
1180945268 22:19689051-19689073 GGTGTGGGGCATCCAGGAGCTGG + Intergenic
1181803215 22:25360483-25360505 GCTGGTGTGTGGCCAGGAGAGGG - Exonic
1182162354 22:28135507-28135529 GCTGTGTGGCAGACAGGAGAAGG + Intronic
1183194001 22:36340781-36340803 TCTGTTGGCCAGTCTGGAGAAGG + Intronic
1183202617 22:36396265-36396287 GCTGTTGGGGAAAGAGGAGATGG + Intergenic
1183382301 22:37496312-37496334 GCAGGCGGGGAGCCAGGAGAAGG + Intronic
1184283156 22:43450303-43450325 CCTGCTGGGCAGCCCTGAGAAGG + Intronic
1185019909 22:48367957-48367979 GCTGTAGGGGAGCCAGGTGGGGG + Intergenic
1185066847 22:48636722-48636744 GCTGCTGTGAAGCCTGGAGATGG + Intronic
1185075162 22:48679028-48679050 GGAGCTGGGGAGCCAGGAGAGGG - Intronic
1185075229 22:48679220-48679242 GGAGCTGGGGAGCCAGGAGAGGG - Intronic
1185075426 22:48679734-48679756 GGAGCTGGGGAGCCAGGAGAGGG - Intronic
1185338263 22:50280384-50280406 CCTGTTGGGCCCCCAGGAGCCGG - Intronic
1185418189 22:50721160-50721182 GCTCTCGGGCAGCCAGGGCAAGG - Intergenic
949202845 3:1400574-1400596 GCTTTTGGGAAGCCAGAAAAGGG - Intronic
950554293 3:13685957-13685979 GCTGCTGGGAGGCCAGGAAATGG + Intergenic
952428743 3:33201699-33201721 GCTGTTGGGTAGGCCTGAGATGG - Intronic
954715257 3:52523732-52523754 GCTGTGGGGGTGCCAGGAGGGGG - Exonic
954855907 3:53643306-53643328 GCTGGTGGGCAGGCAGGCGTCGG - Intronic
955667151 3:61362675-61362697 GCTTTTAGGCAGTAAGGAGAGGG - Intergenic
956917753 3:73891037-73891059 TCTGCTGTGCAGACAGGAGATGG - Intergenic
958892112 3:99794694-99794716 CCTGTTGGACTGCCAGGAGTGGG + Exonic
959863780 3:111243302-111243324 GCTCTTGGGGGGCCAGGAGCAGG - Intronic
960801512 3:121545339-121545361 GCTGTTCGGCGTCCAGGGGAAGG - Intronic
960950125 3:122993779-122993801 GCTGTGGGGGAGGCAGGAGCGGG - Intronic
961029546 3:123589884-123589906 GCTGTTGGTCTGGCAGGAGGTGG + Intergenic
961261590 3:125606412-125606434 GCTGTAGGGTGGCCAGGATATGG - Intergenic
961306388 3:125960958-125960980 ACTGTGGGGAAGCCAGGAGAAGG - Intergenic
961611380 3:128142664-128142686 GCATGTGGGCAGCCTGGAGAAGG - Intronic
962278624 3:134033754-134033776 GCTGCTGGGGAGGCAAGAGAAGG + Intronic
963934930 3:151042751-151042773 GGTGGTGGGCAGGCAAGAGAAGG - Intergenic
964075706 3:152688944-152688966 GTTGGTGGCCAGCCAGGAGGTGG - Intergenic
965657507 3:171004170-171004192 GCTGTTGGGCAGCCTAAAAATGG - Intronic
966627611 3:182035458-182035480 TTAGTTGAGCAGCCAGGAGAAGG - Intergenic
966681141 3:182643368-182643390 GATGGTGGGGAGACAGGAGAGGG - Intergenic
967995377 3:195162256-195162278 GCTCCTGGGCAGCCAGGATACGG + Intronic
968120564 3:196123039-196123061 GGTGGTGGGCAGCAGGGAGATGG - Intergenic
968137920 3:196232424-196232446 GCTGTAGGGCAGTCAGGATGAGG - Exonic
968262931 3:197339768-197339790 GCTGCTGCCCAGGCAGGAGACGG - Intergenic
968661738 4:1801475-1801497 GCCGTTCTTCAGCCAGGAGATGG - Exonic
968761277 4:2443778-2443800 CCTGCTGGGGAGGCAGGAGAAGG - Intronic
969057379 4:4410184-4410206 GCGGTGGGACAGGCAGGAGAGGG - Intronic
969348100 4:6581763-6581785 CCTGGCGGGCAGCCAGGAGTGGG - Intronic
975767928 4:77688532-77688554 ATTGTTGGGAAGCCTGGAGAAGG - Intergenic
976493019 4:85693677-85693699 CCTGTTGGGTAGCCAGGCAAGGG + Intronic
976903026 4:90203338-90203360 GGTGGTGGGGAGCTAGGAGAGGG - Intronic
977312793 4:95407794-95407816 TGTATTGGGCAGCTAGGAGAGGG + Intronic
977791606 4:101111397-101111419 TCTGTTAGGCAGCAAGGAGAGGG - Intronic
979024457 4:115551185-115551207 CTTGTTGGGCATCCAGGTGAAGG - Intergenic
979551331 4:121994440-121994462 GCTGATGGGAAGCCATGGGATGG + Intergenic
982767875 4:159368741-159368763 GCTGCTGGTCTGACAGGAGACGG - Intergenic
984608173 4:181808462-181808484 CAGGTTGGGCAGCCTGGAGAAGG + Intergenic
984961488 4:185102052-185102074 GCTGCTGCGGAGCCAGGAAATGG - Intergenic
986016739 5:3764030-3764052 GCTGTAGAGGAGTCAGGAGAAGG + Intergenic
986856864 5:11879203-11879225 GCTGTGGGGCAGACAGGCTACGG + Intronic
988725555 5:33922893-33922915 GCTGTGGGGCAGCCTAGAGGTGG - Intergenic
988961414 5:36375097-36375119 GCTGATGGGGAAGCAGGAGAGGG + Intergenic
990701951 5:58483426-58483448 GCAGTTGTGCAGGCAAGAGATGG + Intergenic
992282439 5:75195164-75195186 GCAGTTGGGATGCCAGGGGAGGG - Intronic
994575990 5:101580291-101580313 GCTTTTAGGCACACAGGAGAAGG + Intergenic
995530022 5:113083245-113083267 GGTGCTGGGCAGCCAGGATGGGG + Intronic
995745057 5:115394167-115394189 GCTCTTGGGGGGCCAGGAGCAGG - Intergenic
999303466 5:150505252-150505274 GCTGGTGGACAGCCGGGAGCAGG - Intronic
1001028501 5:168244535-168244557 GCTGCTGGGCAGCCAGAGGAAGG - Exonic
1001075892 5:168627754-168627776 TCTCCTGGGCAGCCAGAAGACGG - Intergenic
1001360310 5:171077628-171077650 GCTGATGGGCAGAAAGGAAAGGG + Intronic
1002197260 5:177508278-177508300 GGTGCTGAGCAGCCAGTAGATGG + Exonic
1002252608 5:177939059-177939081 GCTGCTGGGGAGCCTGGAGCTGG + Intergenic
1002336580 5:178483471-178483493 GGTGCTGGAAAGCCAGGAGAAGG - Intronic
1002461101 5:179374252-179374274 GCTGTTCGGCAGCCAGGCATAGG + Intergenic
1002574986 5:180169555-180169577 GCTGCTGGTCAGCTGGGAGAGGG + Intronic
1003512015 6:6789728-6789750 GGAGGTGGGCAGCCAGGAGGTGG - Intergenic
1004457173 6:15801954-15801976 GCTGATGGCCAACCAGGAAATGG - Intergenic
1006297911 6:33178252-33178274 GCTCTGGGGAAGCCAGGAGGGGG - Intronic
1006451595 6:34108787-34108809 CTCGGTGGGCAGCCAGGAGATGG - Intronic
1006935725 6:37716150-37716172 GATGTTGGGCAGCCAAGAGGTGG - Intergenic
1007520796 6:42450984-42451006 GATGCTGTGCAGCCCGGAGAGGG + Intronic
1007690556 6:43698406-43698428 GCTGCAGGGCAGGCAGGACAGGG + Intergenic
1008641965 6:53473657-53473679 GCTGTTTGGGAGCCAGGAACTGG + Intergenic
1009750149 6:67871477-67871499 ACTGTTGGGCAGGTGGGAGAGGG - Intergenic
1009844765 6:69121735-69121757 GATGATGGGCAGCCAGGCGTAGG + Intronic
1010723992 6:79312703-79312725 GCTGTTGGGGCCCCAAGAGAAGG - Intergenic
1013599659 6:111692332-111692354 GCAGCTGGGCAGCCGGCAGAAGG + Intronic
1014070120 6:117171650-117171672 GAAGTTGGGGAGCAAGGAGAAGG + Intergenic
1014947342 6:127514831-127514853 GCTGTTGCGCAGCCTGGAGCAGG - Exonic
1016012670 6:139154600-139154622 CCTGTTGGGCAGACAAGGGAAGG + Intronic
1016927347 6:149364114-149364136 GCTGTAGTTCAGCCAGGAAATGG - Intronic
1017475405 6:154786205-154786227 GCTGTTGGTCAGGTTGGAGATGG + Intronic
1017628660 6:156374312-156374334 GTTGTGGTGCAGGCAGGAGAAGG - Intergenic
1017887095 6:158608345-158608367 GCTGTTGACCAGGAAGGAGAGGG - Exonic
1018317339 6:162569757-162569779 GCTCTGGGGCAGCCACCAGAGGG - Intronic
1018678864 6:166246567-166246589 GCTGTCTGCCAGCCAGGAGGAGG - Intergenic
1019454981 7:1122338-1122360 GCTGTTTGGCTGCCTGGAAATGG - Intronic
1019571725 7:1715955-1715977 GCTGTTTGGCACCCAGCAGGAGG + Intronic
1019572846 7:1721230-1721252 CTGGTTGGGCAGCCAGGAGGAGG - Intronic
1019634801 7:2069829-2069851 CCTCTTGGGCAGCCTGGAGTTGG - Intronic
1019638322 7:2088754-2088776 GCTTTGGGGCACCCAGGAAATGG - Intronic
1019718638 7:2554998-2555020 GCTGTTCTGCAGCCAGTAGGAGG + Intronic
1020077657 7:5269106-5269128 GGTGCTGAGCTGCCAGGAGATGG - Intergenic
1021328578 7:19305584-19305606 GCTGTTGTACAACCAAGAGAAGG + Intergenic
1022617635 7:31948322-31948344 GCTGGTTGGCAACCAGGAAAAGG + Intronic
1022983453 7:35626390-35626412 GCTGTTGGTCTGACAGGAGGTGG - Intergenic
1023821499 7:43983105-43983127 GCTGATGGGCAGGTAGGGGAGGG - Intergenic
1024217107 7:47256857-47256879 AGAATTGGGCAGCCAGGAGATGG + Intergenic
1029749761 7:102536526-102536548 GCTGATGGGCAGGTAGGGGAGGG - Intergenic
1029767711 7:102635631-102635653 GCTGATGGGCAGGTAGGGGAGGG - Intronic
1030309289 7:108053439-108053461 GCTGTGGGGCACCCTGGACAGGG - Intronic
1031098067 7:117444547-117444569 GTGGTTGGGCAGGCAGTAGAGGG - Intergenic
1032292530 7:130601664-130601686 GCGGGTGGGAAGCCAGGGGAGGG + Intronic
1033129750 7:138735591-138735613 GCTGCTGGGAAGCGGGGAGAAGG + Intronic
1034824781 7:154251784-154251806 GCAGTAAGGCAGGCAGGAGAAGG - Intronic
1034858900 7:154579716-154579738 GCAGATGGGCAGCAGGGAGATGG + Intronic
1035574568 8:696505-696527 GCTGATGGGGAGGAAGGAGAGGG - Intronic
1035574579 8:696550-696572 GCTGATGGGGAGGAAGGAGAGGG - Intronic
1035574646 8:696853-696875 GCTGATGGGGAGGAAGGAGAGGG - Intronic
1035574657 8:696898-696920 GCTGATGGGGAGGAAGGAGAGGG - Intronic
1037528941 8:19755947-19755969 GGTGTTGGGCTGCCGGAAGATGG - Intronic
1037608516 8:20457392-20457414 GCTTTTGGGCAGCCAGGAGTTGG - Intergenic
1037841483 8:22248330-22248352 GCTTCTGGGGAGCCAGGTGAGGG + Intronic
1038153554 8:24964781-24964803 GGTGCTGGGCAGCCAGAAAAAGG + Intergenic
1039828681 8:41195556-41195578 GCTTGTGGGCAGCCAGGGCAGGG - Intergenic
1040974387 8:53174094-53174116 GCTGTTAGTCATCCATGAGATGG + Intergenic
1042644433 8:70970459-70970481 GGGGGTGGGCAGCTAGGAGAGGG - Intergenic
1043035206 8:75188886-75188908 CCTCTGGGGCAGCGAGGAGATGG + Intergenic
1044198981 8:89412566-89412588 GCTGTGGGGCAGCCACAGGATGG + Intergenic
1047211680 8:122845705-122845727 GCTGTGGGGCCACCAGGAGTGGG - Intronic
1048494917 8:134927075-134927097 GCTGCTGCGTAGCGAGGAGAGGG + Intergenic
1048987511 8:139742634-139742656 GGAGTTAGGGAGCCAGGAGATGG + Intronic
1049038048 8:140091931-140091953 GCTGTGGGGCCGGCGGGAGATGG - Intronic
1049168148 8:141139798-141139820 GCTGCTGGGAAGGCAGGAGCAGG - Intronic
1049354851 8:142182530-142182552 GCTGTGGGGCAGGCAGGGGCAGG + Intergenic
1049510612 8:143025000-143025022 GCTGCTGGGCGGCCAGGCGGGGG + Intergenic
1049569132 8:143360144-143360166 GCTGACGGGCACCCAGGAGGTGG + Intergenic
1049642868 8:143723260-143723282 GGTGTTGGGCTGCCAGGAGAGGG + Intergenic
1049682245 8:143924609-143924631 GCTGCTGGCCAGCAAGGCGAGGG - Exonic
1049759158 8:144324138-144324160 GCTGTGAGGCAGGCAGGAGAGGG - Intronic
1051049319 9:12913013-12913035 GCTGATTGCCAGCCAGGAAATGG - Intergenic
1053005019 9:34598764-34598786 GGTCTTCAGCAGCCAGGAGAGGG + Intergenic
1053102784 9:35385237-35385259 ACTGTTCTGCAGCCAGCAGATGG - Intronic
1055235743 9:74120721-74120743 GCTGTGAGGCAGGCAGGAGTAGG + Intergenic
1057974118 9:99585883-99585905 ACTTTTGGGGAGCAAGGAGAAGG + Intergenic
1060537301 9:124400422-124400444 GCTGCTGGGCAGCCCAGAAAAGG - Intronic
1060557267 9:124514440-124514462 CCTGATGGGCAGCCAGGCCAAGG + Intergenic
1060775527 9:126371161-126371183 GCTGGTCGGCACCCAGGGGAAGG - Intronic
1060796398 9:126515213-126515235 CCTGAAGGGCAGCCAGGGGAGGG - Intergenic
1060926968 9:127461814-127461836 GCTTAAGGACAGCCAGGAGAAGG - Intronic
1060985051 9:127815087-127815109 CCGGTCGGGCAGCCAGCAGAGGG - Exonic
1061184160 9:129042378-129042400 GCTGGTGGGCAGCCAGGGCCAGG - Exonic
1061487939 9:130929716-130929738 GCTGGTGGGCGACCAGGAGCAGG - Exonic
1062290117 9:135790628-135790650 GCTGCTGGCCAGCCAGGTGGGGG - Intronic
1062645780 9:137547465-137547487 GTGGTTGGGCAGCCAGGGGTGGG - Intronic
1185702724 X:2243230-2243252 ACTGTGGGGCAAGCAGGAGAAGG + Exonic
1196117612 X:112014547-112014569 GCTGTTGAGCATCCAAGGGAAGG - Intronic
1200112935 X:153752091-153752113 GCTGCTGATCTGCCAGGAGATGG - Intergenic
1200776130 Y:7171848-7171870 GCTGTAGGGAAGCTAGGATATGG - Intergenic