ID: 1172624789

View in Genome Browser
Species Human (GRCh38)
Location 20:36340775-36340797
Sequence GGCTCCCGACAGCCCCCCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 133}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172624789_1172624795 14 Left 1172624789 20:36340775-36340797 CCCTCGGGGGGCTGTCGGGAGCC 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1172624795 20:36340812-36340834 AGGTGCTGCGATCCAGCGGGTGG 0: 1
1: 0
2: 0
3: 9
4: 74
1172624789_1172624796 17 Left 1172624789 20:36340775-36340797 CCCTCGGGGGGCTGTCGGGAGCC 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1172624796 20:36340815-36340837 TGCTGCGATCCAGCGGGTGGAGG 0: 1
1: 0
2: 1
3: 12
4: 210
1172624789_1172624797 18 Left 1172624789 20:36340775-36340797 CCCTCGGGGGGCTGTCGGGAGCC 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1172624797 20:36340816-36340838 GCTGCGATCCAGCGGGTGGAGGG 0: 1
1: 0
2: 0
3: 10
4: 70
1172624789_1172624791 -6 Left 1172624789 20:36340775-36340797 CCCTCGGGGGGCTGTCGGGAGCC 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1172624791 20:36340792-36340814 GGAGCCAAAGAGCTTGATGCAGG 0: 1
1: 0
2: 3
3: 29
4: 207
1172624789_1172624793 10 Left 1172624789 20:36340775-36340797 CCCTCGGGGGGCTGTCGGGAGCC 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1172624793 20:36340808-36340830 ATGCAGGTGCTGCGATCCAGCGG 0: 1
1: 0
2: 0
3: 9
4: 131
1172624789_1172624794 11 Left 1172624789 20:36340775-36340797 CCCTCGGGGGGCTGTCGGGAGCC 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1172624794 20:36340809-36340831 TGCAGGTGCTGCGATCCAGCGGG 0: 1
1: 0
2: 2
3: 16
4: 129
1172624789_1172624799 20 Left 1172624789 20:36340775-36340797 CCCTCGGGGGGCTGTCGGGAGCC 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1172624799 20:36340818-36340840 TGCGATCCAGCGGGTGGAGGGGG 0: 1
1: 0
2: 0
3: 11
4: 134
1172624789_1172624800 23 Left 1172624789 20:36340775-36340797 CCCTCGGGGGGCTGTCGGGAGCC 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1172624800 20:36340821-36340843 GATCCAGCGGGTGGAGGGGGAGG 0: 1
1: 0
2: 1
3: 43
4: 465
1172624789_1172624798 19 Left 1172624789 20:36340775-36340797 CCCTCGGGGGGCTGTCGGGAGCC 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1172624798 20:36340817-36340839 CTGCGATCCAGCGGGTGGAGGGG 0: 1
1: 0
2: 0
3: 2
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172624789 Original CRISPR GGCTCCCGACAGCCCCCCGA GGG (reversed) Intronic
900386283 1:2412472-2412494 GGCCGCCGCCAGCCCCCCGGAGG - Exonic
900530581 1:3151066-3151088 GGGTCCCGCCACCTCCCCGAGGG - Intronic
900595839 1:3479773-3479795 GCCTCCCGACAGCCCTGTGATGG + Intronic
900625470 1:3606573-3606595 GGCTCCCGACAGCCCTCAGGAGG + Intronic
915938468 1:160103020-160103042 GGCTCCCAGCACCCACCCGATGG - Intergenic
1063469567 10:6273467-6273489 GTTTCCCGACAGCCCCCTCAAGG - Intergenic
1073785054 10:106879839-106879861 GCCTCCCCAGAGCCCCCAGATGG + Intronic
1075753311 10:124791600-124791622 TGCTCCCGTCACGCCCCCGAGGG + Intronic
1076503784 10:130958143-130958165 GGCCCCCATCAGCCCCCCGCTGG + Intergenic
1076611345 10:131727724-131727746 GGCTCCCCAGAGCCACCTGAAGG + Intergenic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1077160917 11:1112571-1112593 GGCCCAGGACAGCCCCCCAAAGG + Intergenic
1077328751 11:1974805-1974827 GCCTCCCCACAGGCCCCCGCTGG - Intronic
1077417788 11:2432882-2432904 GGCTTCGGGCTGCCCCCCGAGGG - Intergenic
1083807265 11:65082172-65082194 TTCTCCCCACAGCCCCCAGAGGG + Intronic
1085055015 11:73398330-73398352 GCCTCCCGACAGCCCCAGCATGG - Intergenic
1091291971 11:134445664-134445686 GGGACCCCACAACCCCCCGATGG - Intergenic
1202811730 11_KI270721v1_random:29984-30006 GCCTCCCCACAGGCCCCCGCTGG - Intergenic
1091649419 12:2298814-2298836 GACTCCAGAGAGCCCCTCGATGG - Intronic
1094376874 12:29800046-29800068 GCCTCACCACAGCCCCCAGAAGG - Intergenic
1096178390 12:49538065-49538087 GGCTCCCTGCAGCCGCCCCAGGG + Intergenic
1096571277 12:52524658-52524680 TGCTCCCCACAGCCCCCTGCAGG - Intergenic
1096981021 12:55728412-55728434 GGCTCCCGGCCGGCCCTCGAGGG + Intronic
1098282060 12:68871714-68871736 GGCTCCCGACAGGCACCTGTTGG - Intronic
1102838260 12:116088381-116088403 GGCTCTCAACAGCCCTCGGAAGG + Intronic
1103775603 12:123364613-123364635 GGCCCCGCACGGCCCCCCGAGGG + Intronic
1104879920 12:132063716-132063738 CCCTCCCGACAGCCCCAGGAGGG - Intronic
1105375686 13:19842246-19842268 GGCTCTTGACAGCCCCCTGCGGG - Intronic
1113913219 13:113854528-113854550 TGCTCCCGACAGCCCCCAGCAGG + Intronic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1121335749 14:93076681-93076703 GGTTCCCGACAGCCGGCTGAGGG + Intronic
1122635869 14:103129418-103129440 GGCTCCCATCAGCTCCCCGCTGG - Intronic
1123214080 14:106790609-106790631 GGTTCCCGACCGCCCCCTGGTGG + Intergenic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202860687 14_GL000225v1_random:79433-79455 GGCCCACGAAAGCCCCCTGAGGG + Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1127165691 15:56243549-56243571 GGCGCCCCTCAGCCCCCCGCTGG + Intergenic
1128092039 15:64925872-64925894 GACTCCTGCCAGCCCCCCTAAGG + Intronic
1129332576 15:74835423-74835445 TGCTCCACACTGCCCCCCGATGG + Intergenic
1129775784 15:78235419-78235441 GTCTGCCCACAGCCCCCAGAGGG - Intronic
1132244168 15:100281353-100281375 CGCTCCCGCCAGTCCCGCGAAGG + Exonic
1132785863 16:1656722-1656744 GCCTGCCGCCAGGCCCCCGAAGG + Exonic
1133209948 16:4258010-4258032 GGCTCCCTCCAGCCCCCAGAAGG + Exonic
1133976355 16:10602094-10602116 GTCCCCCGCCAGCCCCCAGAAGG - Intergenic
1134668364 16:16036485-16036507 GGCTACCGCCAGCCCCTGGAGGG + Exonic
1137588500 16:49679270-49679292 GGCTCCCGCCAGCTCCACGGAGG - Intronic
1141728395 16:85805922-85805944 GGTCCCCGACAGCCCACCAATGG - Intronic
1141855486 16:86678215-86678237 GGCTCTCCACAGCCACCGGAAGG - Intergenic
1142496547 17:309410-309432 GGCTCCTGCCAGCCCCCTGCTGG + Intronic
1142496633 17:309638-309660 GGCTCCTGCCAGCCCCCTGCTGG + Intronic
1144269150 17:13600953-13600975 GCCGCCGGACAGCCCCACGACGG + Exonic
1144483253 17:15644661-15644683 GGCTCCCGAGAGCCTCAGGATGG - Intronic
1144678275 17:17175618-17175640 GGATCCCCACAGCCCCTCGAGGG - Intronic
1144778448 17:17796299-17796321 GGCCTCCGACAGCAGCCCGATGG + Exonic
1146911391 17:36650653-36650675 GGCTCTGCACAGCCCCCAGAAGG - Intergenic
1147420728 17:40321059-40321081 GGCTCCAGACAGCAGCCAGAGGG - Intronic
1147885001 17:43678468-43678490 GTCTCCTGACAGTCCCCAGAGGG - Intergenic
1148700202 17:49582418-49582440 GGCCCCCGGCAGCCCCCAGCTGG - Intronic
1151659992 17:75514070-75514092 GGCTTCCGACAGCTCCAGGATGG + Exonic
1152579900 17:81161236-81161258 GGATCCCGCCAGCGCCTCGAGGG - Intronic
1160809689 19:1008016-1008038 GGCTCCCCACTGCCCCCAGGAGG - Intronic
1161231973 19:3178935-3178957 GGCCACCGACAGCCCCCGCAGGG - Exonic
1162105842 19:8369155-8369177 GGCTCCTGAGACCCCCCCCAGGG + Intronic
1163347069 19:16750004-16750026 GCCTCTCAACTGCCCCCCGAGGG + Exonic
1163453046 19:17390531-17390553 GGCCGCCGGCAGCCCCCGGAGGG + Intergenic
1165391612 19:35542337-35542359 GGCTCCCGACAGCCCTCCAGGGG - Exonic
1167374774 19:49104750-49104772 GGCCCCCGAGAGCCCGTCGAAGG - Intronic
1167455642 19:49595767-49595789 GGCCCCCCACAGCCCCCCAGCGG + Exonic
925139823 2:1542455-1542477 GGCTGCCGAGAGCCCTCTGAGGG + Exonic
930023360 2:47014698-47014720 GGCTCACGTCAGCCCCCAGCAGG + Intronic
932485459 2:72081840-72081862 GGGTCCAGACAGCACCCCGAGGG - Intergenic
938003320 2:127764958-127764980 GGCTCACGACAGCCCAGTGAGGG - Exonic
947641699 2:231710669-231710691 GGATCCCGACAGCACCTCGGGGG - Intronic
947860684 2:233355038-233355060 GGCTCCCGGCTGCGCCCCGCGGG + Intronic
1170736431 20:19017339-19017361 GGCTGCAGCCAGCCACCCGATGG - Intergenic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1172522800 20:35579175-35579197 GGCTCCAGAGGGCCCTCCGATGG - Intergenic
1172624789 20:36340775-36340797 GGCTCCCGACAGCCCCCCGAGGG - Intronic
1172756202 20:37286516-37286538 GGCTCCTCACAGCCCTCAGAAGG - Intergenic
1173821128 20:46021545-46021567 GGCTCCCCAGTGCCACCCGAAGG - Intergenic
1174564018 20:51451821-51451843 GTCTCCCGTCAACCCCCAGATGG + Intronic
1178288175 21:31343611-31343633 GGCTCCCGACCGCACCTGGATGG - Intronic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1180414305 22:12694068-12694090 GGCTCACGAAAGCCCCCTGAGGG + Intergenic
1180613010 22:17109617-17109639 AGCTCCCCGCAGCCCCCCGAGGG + Exonic
1180935964 22:19625568-19625590 GCCTCCCGTCAGCCCACCCAGGG + Intergenic
1181365191 22:22371099-22371121 GGCTTCAGACAGCCCCCTGGAGG + Intergenic
1181368375 22:22397464-22397486 GGCTTCAGACAGCCCCCTGGAGG + Intergenic
957084852 3:75669536-75669558 GGCTCCCGAAAGCCCCCTGTGGG - Intergenic
966787562 3:183635457-183635479 GGCACCCGACACCCACCCCACGG + Intergenic
969309570 4:6345653-6345675 TGCTCCCCAGAGCCTCCCGAAGG + Intronic
974827644 4:67151407-67151429 ACCTACCTACAGCCCCCCGAGGG - Intergenic
978407773 4:108398227-108398249 AGCCACAGACAGCCCCCCGAGGG + Intergenic
978869360 4:113556690-113556712 GGCTCCCCAAAGACCCCTGAAGG + Intronic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
994620381 5:102155214-102155236 GTCTCCCGGCAGCCCGCCGTGGG + Intergenic
997479855 5:134176878-134176900 GGCTCTCGTCAGCCTCCCGCCGG - Exonic
1002102991 5:176866525-176866547 GGCTCCCCACAGCACCACGGGGG + Intronic
1007178396 6:39911840-39911862 GGGTCCCGACATCCCCCACAGGG + Intronic
1012550929 6:100464496-100464518 CGCTCGCGACAGCCCCTCGCAGG + Intronic
1019698318 7:2460243-2460265 GGCTCCTGGCAGCCCCAGGAAGG - Intergenic
1022547473 7:31202236-31202258 GTCTCCCTACAGCCCCCCACAGG - Intergenic
1039060170 8:33566651-33566673 GGCTCCCACCAGCCCCACGTAGG + Intronic
1039413856 8:37377225-37377247 GGCTGCAGACATCCCCCAGATGG + Intergenic
1043358091 8:79437579-79437601 GGCTCCCAATATCACCCCGAGGG - Intergenic
1047262516 8:123274907-123274929 GACTCGCAGCAGCCCCCCGAGGG - Intronic
1048867765 8:138773294-138773316 GGCTTCTGGCTGCCCCCCGAGGG + Intronic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1056795475 9:89655934-89655956 GGCCCCCGACACCCCTCAGAGGG + Intergenic
1057212023 9:93205564-93205586 GGCTCCAGACAGCCGGCCGCGGG - Intronic
1057619113 9:96619442-96619464 GGCTCCCGCCAGCCCCGCGCGGG + Exonic
1060355688 9:122905141-122905163 CGCTCCCGGGAGCCCCGCGACGG + Intronic
1061052489 9:128204575-128204597 GGCTCCCCACAAACCCCCAAAGG + Intronic
1062043521 9:134414950-134414972 GGCTCCGGTCAGCCCCCACATGG - Intronic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1195278756 X:103310134-103310156 GGCTCCCCTCGCCCCCCCGAGGG - Intronic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic