ID: 1172625592

View in Genome Browser
Species Human (GRCh38)
Location 20:36344847-36344869
Sequence AGGGTCCCCCCTCCTTCCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 303}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172625585_1172625592 30 Left 1172625585 20:36344794-36344816 CCTCATCTTGGCCGTGTGGAGGC 0: 1
1: 0
2: 0
3: 7
4: 93
Right 1172625592 20:36344847-36344869 AGGGTCCCCCCTCCTTCCCTAGG 0: 1
1: 0
2: 2
3: 36
4: 303
1172625587_1172625592 19 Left 1172625587 20:36344805-36344827 CCGTGTGGAGGCAGCAGGACTCT 0: 1
1: 0
2: 2
3: 35
4: 294
Right 1172625592 20:36344847-36344869 AGGGTCCCCCCTCCTTCCCTAGG 0: 1
1: 0
2: 2
3: 36
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172625592 Original CRISPR AGGGTCCCCCCTCCTTCCCT AGG Intronic
900135509 1:1115609-1115631 AGGGACCCCCCTCCCTCCCCAGG + Intronic
900600991 1:3502571-3502593 AGGGTCCCCCCTGCTCCACCCGG + Intronic
900809864 1:4793708-4793730 TGGGACCCCCCTCCTGGCCTAGG - Intergenic
901156968 1:7146634-7146656 TGGGTCCTCACTGCTTCCCTGGG + Intronic
901738105 1:11325114-11325136 GGGGTCCTCGCTCCCTCCCTGGG - Intergenic
902555326 1:17243270-17243292 GGGGGCACCTCTCCTTCCCTTGG - Intronic
903216928 1:21848573-21848595 AGAGTCCCCCCTCTTCCCATTGG + Intronic
903781304 1:25821542-25821564 AGGGTCCCCTCTTCTACCCTTGG - Intronic
904028920 1:27521754-27521776 AGCTTCCTGCCTCCTTCCCTTGG - Intergenic
904600152 1:31668528-31668550 GGGGGCTCCCCTCCCTCCCTCGG - Intronic
905107650 1:35573905-35573927 AGGCACCCCTCTCCTTCCCCAGG + Exonic
905171972 1:36114938-36114960 AGGTTCTCCGCTGCTTCCCTAGG + Intronic
905202006 1:36322081-36322103 AGGGTCCCCACTCCCTCTCTGGG - Exonic
905454139 1:38075955-38075977 AGGGTCCCCTCTTCCTTCCTGGG - Intergenic
906129033 1:43445033-43445055 AGGCTGGCCCCTCCTACCCTGGG + Intronic
907880648 1:58546566-58546588 AGGATCCCCACTCCTTGCCCGGG + Intronic
909504891 1:76377581-76377603 CAGGTCCCCCCTCCAACCCTGGG + Intronic
914322389 1:146577756-146577778 AGAGGCCCCTTTCCTTCCCTAGG + Intergenic
915146566 1:153799200-153799222 TGGGTGGCCCCACCTTCCCTGGG - Intergenic
915895540 1:159808637-159808659 AATCTCCCCCCTCCTTCCCCTGG - Intronic
915920741 1:159973583-159973605 AATCTCCCCCCTCCTTCCCCTGG + Intergenic
915952641 1:160199750-160199772 ACTGTCCCCTCTCCATCCCTGGG + Intronic
917309938 1:173668498-173668520 AGGGTCCCTTTGCCTTCCCTTGG - Intronic
918018998 1:180665997-180666019 AGGGTCCACCTTCCTTCTTTTGG + Intronic
921553980 1:216574909-216574931 AGCCACCTCCCTCCTTCCCTTGG + Intronic
921638867 1:217528051-217528073 ACAGTCACCCCTCCTTCCATTGG - Intronic
921930360 1:220749322-220749344 AGTGTCCCCCCTTCTCCCATAGG + Intronic
923234036 1:232015191-232015213 AGGAGTCCCCTTCCTTCCCTTGG - Intronic
923531964 1:234818817-234818839 CGGGGCCCTCCTCCTGCCCTGGG - Intergenic
923765289 1:236887679-236887701 AGGGTCCGCCCTGCTGCCCCAGG + Intronic
923790573 1:237107850-237107872 GGGCTCCTCCCTCCTTCCCTGGG + Intronic
1062780728 10:204170-204192 AGGGCTCCCTCTCCTTTCCTAGG + Intronic
1063956047 10:11268381-11268403 ACGATCCCCATTCCTTCCCTTGG + Intronic
1066010210 10:31188003-31188025 TGGAGCCCCCCTCCTGCCCTGGG + Intergenic
1066061271 10:31725518-31725540 ATGCTTCCCCTTCCTTCCCTGGG - Intergenic
1067030890 10:42878388-42878410 AGGTTCTGCCTTCCTTCCCTGGG + Intergenic
1067684561 10:48458790-48458812 AGGGTCCCCCGTACCTCCCTGGG + Intronic
1067716746 10:48696176-48696198 AGTGTCCCCACTTCTTACCTGGG - Intronic
1067771708 10:49131432-49131454 AGGAACCCCCTTCCTGCCCTAGG - Exonic
1069722810 10:70560488-70560510 ACAGTCCCGCCTCCTTCACTGGG + Intronic
1069748391 10:70730415-70730437 AGGGACCCCTCTACTTCCCACGG - Intronic
1069831914 10:71286905-71286927 AGGCTCTCTCCTCCCTCCCTTGG - Intronic
1069897924 10:71690353-71690375 AGGGTCCCACGTCCTCCTCTTGG + Intronic
1070601473 10:77869197-77869219 ATGGTCTCCCCTCTTTCCCCAGG - Exonic
1070811115 10:79298584-79298606 AGGGCCCTCCCTCCCTCTCTTGG + Intronic
1070829413 10:79409489-79409511 GGGGTCCCCTCTGATTCCCTGGG + Intronic
1071974390 10:90940233-90940255 AGGGCTCCCACTCCTTCACTGGG - Intergenic
1072660588 10:97361287-97361309 CGGGCTCTCCCTCCTTCCCTTGG - Intronic
1073073386 10:100808750-100808772 ATGGTTCCCCCTCCTCCCCAAGG + Intronic
1073295908 10:102438608-102438630 AGGGGCCCTCCTCCCTCACTGGG + Intergenic
1076429343 10:130390940-130390962 GGTGAGCCCCCTCCTTCCCTTGG - Intergenic
1076677736 10:132156194-132156216 AGGCCCCCGCCTCCCTCCCTCGG + Intronic
1076786976 10:132754738-132754760 TGGGGGCCCCCTCCTTCCCATGG - Intronic
1077164516 11:1129102-1129124 GGGCTCGGCCCTCCTTCCCTGGG - Intergenic
1077399941 11:2349933-2349955 AGTGGCCCCCTTCCTTCCCATGG - Intergenic
1078544223 11:12235123-12235145 AGGCTCCCCCATCCTTTTCTGGG - Intronic
1080628753 11:34053138-34053160 AGCGTCCCCTCTTCTTCCGTAGG + Intronic
1081627782 11:44665856-44665878 GGTCTCCCCACTCCTTCCCTTGG + Intergenic
1082044731 11:47715438-47715460 GGGGTCCCCGCTCCCTCCTTGGG - Intergenic
1082801732 11:57419856-57419878 TGGGTTCTCCCTCCTTCCCCTGG - Intronic
1084117841 11:67052315-67052337 AGAGTGACCCCTCCCTCCCTTGG - Intergenic
1084349263 11:68582860-68582882 AAGGGCACCCTTCCTTCCCTCGG - Intronic
1084764721 11:71300827-71300849 AGGCCCCTGCCTCCTTCCCTGGG - Intergenic
1084790491 11:71472687-71472709 AGGGTGGCTCCTCCTTGCCTTGG + Intronic
1085260949 11:75204378-75204400 AGGGTCCCCATTCTTTCCCCAGG + Exonic
1085517818 11:77121714-77121736 AGGGTACCCCATCCTTCCCCAGG - Intronic
1085986995 11:81799873-81799895 AGGGCTCTTCCTCCTTCCCTGGG + Intergenic
1088469129 11:110175594-110175616 AGGGTCCCCCTTCAGCCCCTGGG + Intronic
1089559766 11:119337996-119338018 AGAGGCCCCCCCCCTTCCTTGGG + Intergenic
1091347720 11:134866504-134866526 AGGGTCCAGACTCCTTCCCTAGG - Intergenic
1092280363 12:7093214-7093236 AGGGTCCCTCCTCCCTCCCAGGG - Intronic
1093426122 12:19031335-19031357 CGGGTACCTCCTACTTCCCTGGG + Intergenic
1096745937 12:53727020-53727042 AAGGTCCCCCTTCCTCCCCAGGG + Intronic
1096787849 12:54027994-54028016 AGGGACCCCCCTCCTGTGCTGGG + Intronic
1100247914 12:92782845-92782867 AGGGTCCTGCCTCATACCCTGGG + Intronic
1100798572 12:98208187-98208209 AGTGTTCTCTCTCCTTCCCTAGG - Intergenic
1101440592 12:104701739-104701761 AGGCTTCCCCCTACTTCCCATGG - Intronic
1103004134 12:117408304-117408326 AACCTCCCCCCTCCTTCCCCAGG + Intronic
1105290349 13:19049210-19049232 TGGGTCCCTCCTCCCTCCGTTGG - Intergenic
1105884328 13:24628998-24629020 AGGGTCCCCACTGCTGCCATGGG + Intergenic
1106182325 13:27380400-27380422 AGGGTCCCCCTTCTGTTCCTTGG + Intergenic
1106479114 13:30123697-30123719 TGGGTCCCGCCTGCCTCCCTGGG + Intergenic
1107569730 13:41644159-41644181 AGGGTTCACCTTGCTTCCCTGGG - Intronic
1110282990 13:73717277-73717299 AGGGTCTCTCCTTCTTGCCTAGG - Intronic
1112379958 13:98879263-98879285 TGGGTCCCCCCTGCTTCCCCTGG - Intronic
1112499376 13:99930668-99930690 AGGCCTCCTCCTCCTTCCCTGGG - Intergenic
1113909637 13:113836122-113836144 AGGGTTGCCCCTCCTACCCCAGG - Intronic
1114187248 14:20412231-20412253 AGTTTCCCCACTCCTTTCCTTGG - Intronic
1118819043 14:69333191-69333213 GGGGGACCCCTTCCTTCCCTGGG + Intronic
1119266830 14:73267694-73267716 CGGCTCCCACCGCCTTCCCTGGG - Intronic
1121413988 14:93766313-93766335 TGGGTCCCACAGCCTTCCCTTGG + Intronic
1121535267 14:94686633-94686655 AGGAGACCCCCTCCCTCCCTGGG - Intergenic
1122066477 14:99177162-99177184 AGTGTGCCCCCGCCTTCCCTGGG - Intronic
1122149131 14:99715390-99715412 AGGGCCCCCTCCCGTTCCCTGGG + Intronic
1122245126 14:100397050-100397072 GGGGTCTCCCCTCATGCCCTTGG + Intronic
1122454370 14:101838669-101838691 GGGCTGCCTCCTCCTTCCCTGGG - Intronic
1122906693 14:104804943-104804965 AGGGTCCAGCCTCCTTCCCCAGG - Intergenic
1123115694 14:105893063-105893085 AGGCCACCCCCTCCTTCCCAGGG - Intergenic
1123119933 14:105911779-105911801 AGGCCACCCCCTCCTTCCCAGGG - Intergenic
1123936022 15:25194451-25194473 ATGGTGCCCTCTCCTTTCCTTGG - Intergenic
1124215457 15:27804734-27804756 TGGGGCGCCCCTCCTCCCCTTGG + Intronic
1126240328 15:46434604-46434626 AGGGTCCCACCTCCAACACTGGG + Intergenic
1128271670 15:66315906-66315928 AGGGGCCCTCTGCCTTCCCTGGG + Intronic
1128310521 15:66629174-66629196 GGGCTCCCTCCTCCTTCCCCTGG - Intronic
1129155047 15:73712487-73712509 AGGGGCCCTCCTCCTTCCCTTGG - Intronic
1129171916 15:73813074-73813096 AAGGGCCTCCCTCCCTCCCTGGG - Intergenic
1129540304 15:76342700-76342722 CGGGTCCCGCCTCCTGCCCGCGG - Intergenic
1129978435 15:79844248-79844270 AGTGTCACACCTGCTTCCCTTGG - Intronic
1130910254 15:88265867-88265889 GGGGTCCTCCCTCCTTCCTTCGG - Intergenic
1130913192 15:88284829-88284851 AGGAACCCTCCTCCTTGCCTGGG + Intergenic
1132077631 15:98835542-98835564 AGGGTTCATCCTCCTTGCCTGGG - Intronic
1132461129 16:55426-55448 AGGGTTCCCACTTCTGCCCTTGG + Intronic
1132653351 16:1031355-1031377 AGGGGCCCCCCAGCTTCCCTTGG - Intergenic
1132805340 16:1772694-1772716 AGGCTCCCACCTCCTGACCTCGG - Intronic
1134007169 16:10825750-10825772 GGGGACCCTCCTTCTTCCCTTGG - Intergenic
1135114496 16:19713480-19713502 AGGGGCCACCCTTCTTCCTTTGG + Intronic
1135158811 16:20075305-20075327 AGTGTCCCCCATCCCTGCCTGGG - Intergenic
1136021911 16:27445867-27445889 AGGCGCCTCCCTCCTTCCCTGGG - Intronic
1136141726 16:28292781-28292803 AGGGCCCCCCCTCTTCCCCGAGG - Exonic
1136483800 16:30558280-30558302 AGTAACCTCCCTCCTTCCCTTGG - Intronic
1138350515 16:56344074-56344096 ATGCTCCCTCCTCCCTCCCTTGG - Exonic
1138529064 16:57625251-57625273 CAGGTCCCCCCTGCTTCCCAAGG - Intronic
1138549850 16:57741617-57741639 AGGGTCACCCCTCCTTCACAAGG + Intronic
1139916492 16:70431422-70431444 AGGGTCCCCTCTCTGCCCCTGGG + Intronic
1140011234 16:71133413-71133435 AGAGGCCCCTTTCCTTCCCTAGG - Intronic
1141567021 16:84909611-84909633 AAGCTCCTCCCTCCTTCCCGCGG - Intronic
1141569479 16:84925552-84925574 AGGGTCCCGCCCCCATCCCAGGG + Intergenic
1141755842 16:85990258-85990280 AGCCTCCCCACTCCTTCCCTTGG - Intergenic
1141792620 16:86246811-86246833 AGGGTGCCCGCTCCCTCCCAAGG - Intergenic
1142198375 16:88749366-88749388 AGGGTCCCCTGGCCTTACCTTGG + Exonic
1142201389 16:88762613-88762635 AGGCTGCCCCTTCCTTGCCTTGG - Intronic
1142809015 17:2386724-2386746 AGGGTGGCCCTTCCCTCCCTTGG + Exonic
1143166070 17:4897811-4897833 GGGGTCCCCCCTCCATTCCCTGG - Exonic
1143287303 17:5799835-5799857 AGGGGACCCCCTCCTTTCCCTGG - Intronic
1143382739 17:6506746-6506768 AGGGTCCCTGCTCCTTAGCTTGG + Intronic
1143513542 17:7408224-7408246 GGGACCCCCCCTCCCTCCCTGGG - Exonic
1143977107 17:10837957-10837979 CAGGTCCCCCATCCTCCCCTGGG - Exonic
1144941980 17:18948228-18948250 AATGACCCCCCTCCTCCCCTGGG - Intergenic
1145970362 17:28952608-28952630 AGGGCGCCCGCTCCTCCCCTTGG + Intronic
1147967412 17:44200418-44200440 AGGCTCCCCCGCCCTTCCCTCGG + Intergenic
1150488178 17:65558520-65558542 GGGGTCTCCCCTTCTTCCCCTGG + Exonic
1151540868 17:74764005-74764027 TGGGTCCCCCTTCAATCCCTGGG + Intronic
1151802792 17:76387622-76387644 AGGACCCTTCCTCCTTCCCTAGG + Exonic
1151836284 17:76585080-76585102 GGAGTCACCCCTCTTTCCCTCGG + Intronic
1155038832 18:22047781-22047803 AGGGTCTCTCCTCCTTTGCTTGG - Intergenic
1155121619 18:22826620-22826642 AGAGTCCTCCCTCCTACCCAGGG + Intronic
1156944958 18:42817655-42817677 AAAGTCCTCCCTCCTTCCCCTGG - Intronic
1158656431 18:59339700-59339722 AGTGTCCCCCCTTCTCTCCTTGG - Intronic
1160147997 18:76379646-76379668 ACGGGCCCCCCGCCTGCCCTCGG - Exonic
1160418232 18:78726744-78726766 AGGCGCCCTCCTCCTCCCCTGGG - Intergenic
1160861047 19:1237380-1237402 AGGAGCCCCCCTCTTCCCCTCGG - Intronic
1161171461 19:2814351-2814373 AGGAGCCCCCCTCGTGCCCTGGG + Exonic
1161300875 19:3542785-3542807 TGGGTCCCCCAGTCTTCCCTGGG + Intronic
1161456705 19:4373236-4373258 AGGCTCCCTCCATCTTCCCTTGG - Intronic
1161666369 19:5579513-5579535 TGGCTCGCCCCTCCTTCCCCAGG + Intergenic
1162397151 19:10423894-10423916 AGGGTCCTCCCCCATTCCCAGGG + Intronic
1162918246 19:13885620-13885642 TGGGTCCCCTCCCCTTCCCAGGG + Intronic
1163002970 19:14380578-14380600 AGGGCCCCTTCTCCCTCCCTGGG + Intronic
1163063822 19:14778461-14778483 AGGGCCCCTTCTCCCTCCCTGGG - Exonic
1163202205 19:15777476-15777498 AGAGTCACCTCTGCTTCCCTGGG - Intergenic
1163323949 19:16591227-16591249 AGGGCCCACCCTCCTTCCCCAGG - Intronic
1163613480 19:18312532-18312554 AGCCTCCTCCCTCCCTCCCTGGG - Intronic
1163689331 19:18730273-18730295 AGGGTCCCTCCTGCCTCCCCTGG + Intronic
1164530875 19:29047341-29047363 AGTGTCCCCTCACCCTCCCTAGG + Intergenic
1164788837 19:30959129-30959151 AGGGGCCCACCTCCATCCCAGGG - Intergenic
1165783313 19:38446377-38446399 AGGGGCCCTGCTCCTCCCCTGGG - Intronic
1166377726 19:42337028-42337050 GGAGTCCCCCCACCTCCCCTAGG + Intronic
1167454981 19:49593236-49593258 AGGGTCCCCCCAACTCCCCGGGG + Intronic
1167574827 19:50312926-50312948 AGTCCCCCCCATCCTTCCCTCGG - Intronic
1168310428 19:55457128-55457150 AGGGTCCCCCTTCTTTCCTATGG - Intronic
925448745 2:3951125-3951147 AGGGTGTACCCTCCTTCACTGGG - Intergenic
927895811 2:26780987-26781009 AGGGTCCCCTCAGCTTCACTGGG + Exonic
928364865 2:30692621-30692643 AGGCTCCCCACTCCCTGCCTCGG - Intergenic
928898799 2:36295725-36295747 AGGGTCCCCTCTGCCTTCCTGGG - Intergenic
929154236 2:38775012-38775034 ATGGTGCCACCTCCTTTCCTAGG - Intronic
930144334 2:47985965-47985987 AGGGGCTTCCCCCCTTCCCTGGG - Intergenic
932396610 2:71453420-71453442 AGGATCCCCCGTCCTACCCCGGG + Intergenic
933709649 2:85315891-85315913 TGGGTGCCCTGTCCTTCCCTGGG - Intergenic
933713417 2:85343883-85343905 TGGGTGCCCTGTCCTTCCCTGGG + Intronic
934233646 2:90210104-90210126 AGGGTTCTCCTTCCTTACCTGGG - Intergenic
937211885 2:120279052-120279074 AGGCTCCTCTCTCCTCCCCTGGG - Intronic
938200124 2:129366074-129366096 AGTGTCCCGCCTCCTTGGCTAGG + Intergenic
940236223 2:151513414-151513436 AGGGTCCTCCATCCTTTCATTGG + Intronic
940381903 2:153024751-153024773 AGGGTCCCCGGCCCTTCCTTTGG - Intergenic
942346262 2:175005470-175005492 AGGGTGCGCCCTCATTCCCGCGG + Intergenic
942472012 2:176269876-176269898 GGAGTCCCGTCTCCTTCCCTTGG + Intronic
944169828 2:196762371-196762393 AGTTTCCTCCCGCCTTCCCTGGG - Intronic
946228564 2:218277859-218277881 TGGGTCCCCATCCCTTCCCTGGG + Intronic
947520648 2:230843596-230843618 AGGTTTCTTCCTCCTTCCCTTGG + Intergenic
947588361 2:231370655-231370677 AGGGCCCCCACTCTCTCCCTGGG + Intronic
948257258 2:236577403-236577425 AGGGACCCCCATCCAGCCCTTGG - Intronic
948261083 2:236604921-236604943 AGGGCCCCTTCTGCTTCCCTAGG + Intergenic
948783547 2:240339531-240339553 AGGTTTACCCCTCCTTCCTTGGG - Intergenic
948843978 2:240674495-240674517 AGGATCCCCTCTCCTTCCTGGGG + Intergenic
948849834 2:240700140-240700162 AGGATCCCCTCTCCTTCCTGGGG - Intergenic
948979372 2:241485285-241485307 AGAGTCCTCCCTCCCTCCCTGGG + Intronic
948979420 2:241485441-241485463 AGAGTCCTCCCTCCCTCCCTGGG + Intronic
1169149465 20:3277832-3277854 AGGGACCAGCCTCCTGCCCTGGG + Intronic
1170407111 20:16049975-16049997 AGGATTCCCCGTCCTTCCATGGG - Exonic
1171473428 20:25390200-25390222 AGGGTCCCCCCGGCTTCCCCGGG + Intronic
1171944784 20:31367030-31367052 AGAGTACCCCCTCCCTCTCTGGG + Intergenic
1172223182 20:33287513-33287535 TGGCTACCCCCTCCATCCCTAGG - Intronic
1172625592 20:36344847-36344869 AGGGTCCCCCCTCCTTCCCTAGG + Intronic
1172636873 20:36415923-36415945 AGGTTCCCCCATCCTCACCTAGG - Intronic
1173135512 20:40435343-40435365 AGACTCCACCTTCCTTCCCTAGG - Intergenic
1173348446 20:42222544-42222566 AGGGTCCCACCTCATACCCAGGG + Intronic
1175415324 20:58797098-58797120 AGGGCCCACCCTCATTCCCGAGG + Intergenic
1177332794 21:19683757-19683779 TGGGTGCCTCCTCCTTCCTTTGG + Intergenic
1177479981 21:21674314-21674336 AGAGTCCACCCACATTCCCTAGG + Intergenic
1179644382 21:42766754-42766776 CGGCGCCTCCCTCCTTCCCTTGG - Intronic
1180132036 21:45833117-45833139 GGGGTGCCCACTCCTTCCCTTGG - Intronic
1180606640 22:17063987-17064009 ATGTCCCCCCATCCTTCCCTTGG - Intergenic
1181437399 22:22918711-22918733 TGGGTCCCTCCTCCTCCCCCGGG + Intergenic
1182357746 22:29729911-29729933 AGGGTGCCCGCTCCTGCCCAAGG - Exonic
1182418612 22:30237663-30237685 AGGGTACCCTCTGCCTCCCTGGG + Intergenic
1183617370 22:38953883-38953905 TGGGACGCCCCTCCTTCTCTGGG + Intronic
1183830276 22:40415198-40415220 GGGGTAGCACCTCCTTCCCTTGG + Intronic
1184055438 22:42044609-42044631 AGGGTCTCCCCTCGTTGCCCAGG - Intronic
951903073 3:27676527-27676549 AGGATTCTCTCTCCTTCCCTTGG - Intergenic
952882039 3:37991335-37991357 AGGCTCCCCTCTCTTTCCCGGGG - Intronic
953574466 3:44101864-44101886 AGGGATGCCCCTCCTGCCCTAGG - Intergenic
953734232 3:45477547-45477569 AGAGCTCCCCCTCCCTCCCTGGG - Intronic
954199654 3:49016719-49016741 AGAGTCCCCCCTCATTACCCTGG + Intronic
954675214 3:52311849-52311871 AGGGACCCCCCTCCTGCTCTGGG + Intergenic
954904956 3:54053428-54053450 AAGGTCCCTCCTCCCTCTCTTGG - Intergenic
955349949 3:58185944-58185966 ATGGGCCTCCCTCCTTCTCTCGG + Intergenic
956791427 3:72683128-72683150 AAGTCCCCTCCTCCTTCCCTGGG + Intergenic
957550514 3:81697710-81697732 AGGGTCCTGCCTCATACCCTGGG - Intronic
960024985 3:112998555-112998577 AGGGTCCCACCTCATACCCTGGG - Intronic
960522727 3:118674352-118674374 AGGGTACCCCCCCCATCCCTGGG + Intergenic
960939262 3:122922781-122922803 AGGCTCCCCTCTCCTACCTTGGG + Intronic
962350565 3:134652780-134652802 AGAGTCCCCCCAACTACCCTGGG + Intronic
963635602 3:147791697-147791719 AGGATGCCCCTTCCATCCCTTGG - Intergenic
968132927 3:196202565-196202587 TGGGTTCCTGCTCCTTCCCTCGG - Intronic
968234613 3:197024248-197024270 AGGCCTCCCCCTCCTTTCCTTGG - Intronic
968235276 3:197027568-197027590 AGGCTCCCACCTCCTGGCCTGGG + Intronic
968273452 3:197422528-197422550 AGGGTTCGCCCTCCTCCCCCTGG - Intergenic
968456504 4:703317-703339 AGGGTGCCCCAACCTTCCCCAGG - Intergenic
968576075 4:1366758-1366780 AGGGGCCACCATCCTACCCTTGG + Intronic
968619182 4:1596065-1596087 AGGGTCCCTGCTCCTGCGCTGGG + Intergenic
968813227 4:2809304-2809326 AGTGCCCTCCCTCCCTCCCTGGG + Intronic
970931235 4:21514808-21514830 AGGCTCTCCACTCCTTCCCAAGG + Intronic
971981254 4:33754021-33754043 AAGTTCCCCCCTCCTTGGCTAGG - Intergenic
972941137 4:44196762-44196784 AGAGAACCCCCTCCTTTCCTGGG + Intronic
978805068 4:112791183-112791205 AGGGTCCTCCCTGCTTCACAAGG - Intergenic
980117907 4:128697584-128697606 AGGGATGCCCCGCCTTCCCTTGG - Intergenic
981905039 4:149912914-149912936 AGGATCACCCCTCCCTTCCTAGG + Intergenic
983939120 4:173523112-173523134 AGGGTACCCATTCCTTCCATTGG - Intergenic
984782209 4:183536200-183536222 AGGGCCCCAGCTCCTTTCCTGGG - Intergenic
985680556 5:1253640-1253662 TGGGCCGCCCCTCCCTCCCTGGG + Exonic
986284193 5:6347866-6347888 AGGGTCCCACCGCATTCCCTGGG - Intergenic
986469144 5:8057120-8057142 AGCATTCCTCCTCCTTCCCTGGG - Intergenic
989332776 5:40279095-40279117 ATGATCCCTTCTCCTTCCCTTGG - Intergenic
990243275 5:53837202-53837224 AGCGTCCCCCCACCTGCCATGGG + Intergenic
993852157 5:93023768-93023790 AGGATCCCCACTCCTCCCTTAGG - Intergenic
994416264 5:99475833-99475855 AAGGTCACCCCTGCTTTCCTGGG - Intergenic
994463704 5:100099339-100099361 AAGGTCACCCCTGCTTTCCTGGG + Intergenic
995684004 5:114751048-114751070 AGGGACACCCCTGCTTCCCCAGG - Intergenic
996319080 5:122193711-122193733 AGGGTACCTACTCCATCCCTGGG + Intergenic
997513021 5:134466131-134466153 GGAGACCTCCCTCCTTCCCTGGG - Intergenic
999921800 5:156329472-156329494 AGCCTGCCCCCTCCTTGCCTAGG - Intronic
1000659043 5:163916386-163916408 GGGGTTCCCCTTCCTTCCCAGGG - Intergenic
1000715432 5:164637885-164637907 AGTGTCATGCCTCCTTCCCTAGG - Intergenic
1001742576 5:174066090-174066112 AGGGACCACACTCCTCCCCTGGG - Intronic
1002498427 5:179631890-179631912 AGGGTCTCCCCACTTTGCCTAGG - Intronic
1003765381 6:9230436-9230458 AGATTTCCCCCTCCTTGCCTGGG - Intergenic
1004343627 6:14828768-14828790 TGGGTCCCCTCTCCTGTCCTTGG - Intergenic
1007818465 6:44541886-44541908 AGGGTCCTCCCTCTCTCCCTGGG - Intergenic
1016306797 6:142693293-142693315 ATGATTCTCCCTCCTTCCCTGGG - Intergenic
1018955904 6:168410562-168410584 CGGGCCGCCCCTCCTTCCCAAGG - Intergenic
1019109851 6:169701400-169701422 AGGGTCCACGCTCCCGCCCTCGG + Intronic
1019502246 7:1370104-1370126 AGGGTTGCCCTTCCTTCCTTTGG + Intergenic
1021886888 7:25148056-25148078 AGTGTCCCTTCTCCTTCCCTGGG + Intronic
1022506332 7:30910462-30910484 AGGGTCCCCCTGCGTCCCCTAGG - Intergenic
1022508650 7:30921956-30921978 AGGGTCCGCCCTTCATGCCTGGG + Intronic
1025940605 7:66074089-66074111 ATGTTCTCCCCTTCTTCCCTGGG + Intergenic
1027237727 7:76307807-76307829 AGGTTCCCCCCATATTCCCTGGG - Intergenic
1028928377 7:96385826-96385848 ATGGGCCCTCCTCCTGCCCTAGG + Intergenic
1030623909 7:111822597-111822619 AGGGTCATGACTCCTTCCCTTGG - Intronic
1030831009 7:114221617-114221639 AGGGTCCCCCATGTCTCCCTAGG + Intronic
1033290523 7:140079147-140079169 AGGGTCACCCTTCCTCCCCCTGG + Intergenic
1033603039 7:142902715-142902737 ATCGTCCCTCCTCCTACCCTGGG - Intergenic
1034269000 7:149794636-149794658 AAGGTCCCTCCTCCTTCCCTTGG - Intergenic
1035687468 8:1536110-1536132 AGGGTGCCCCCACCTGCCCTAGG - Intronic
1037582598 8:20254490-20254512 AGGGCTCCCTCTCCTTCCCGAGG + Intronic
1037735829 8:21565222-21565244 AGGGACCTTCCTCTTTCCCTGGG - Intergenic
1037754694 8:21703283-21703305 AGGTGGCCCCCTCCTCCCCTAGG - Intronic
1038043069 8:23743028-23743050 AGGTTCCTCTCTCCTTCCATAGG + Intergenic
1038631692 8:29251123-29251145 AGGGTCTCCCCTCGTTGCCCAGG - Intronic
1041390475 8:57343271-57343293 AGCGTCCTCCCTACTTTCCTGGG - Intergenic
1041453837 8:58036100-58036122 AGGCTGCCTACTCCTTCCCTTGG - Intronic
1041989114 8:63964505-63964527 GGGATTCCCCCTCCATCCCTTGG + Intergenic
1042505488 8:69555263-69555285 AAGTTCCTTCCTCCTTCCCTTGG - Intronic
1042801466 8:72722421-72722443 GGGGCCTTCCCTCCTTCCCTGGG + Intronic
1043969638 8:86514873-86514895 GGGATCCGCCCTCCTTCCCTGGG + Intronic
1045337736 8:101223931-101223953 AAGGTCCCGCCGCCTTCCCCAGG - Intergenic
1046769941 8:118108921-118108943 GAGGTTCCCCTTCCTTCCCTGGG + Intronic
1047723981 8:127668803-127668825 AGGCTGCCCTGTCCTTCCCTGGG - Intergenic
1048898211 8:139013696-139013718 AGGGTCCTGGCTCCTTCCCCAGG - Intergenic
1049498041 8:142945877-142945899 TGGGTCCCCCCTGGGTCCCTGGG - Intergenic
1050722263 9:8604180-8604202 TGGGTCTCCCCTCCTCTCCTGGG - Intronic
1053353404 9:37428068-37428090 AGGGCCCACCCTGCTGCCCTGGG - Intronic
1053484077 9:38439088-38439110 AGGCTCCCTCCTTCTTCCCGTGG - Intergenic
1054796010 9:69302551-69302573 AGGCTGCCCTCTCCTTCCCTGGG - Intergenic
1055569084 9:77598276-77598298 AGTGTACCCCATTCTTCCCTAGG - Intronic
1055962640 9:81834984-81835006 AGGGTCCCCCCTCAATCCGTAGG + Intergenic
1056350155 9:85741669-85741691 GGGGTCGCCCCTCCTACCCCCGG + Intronic
1056792278 9:89633566-89633588 AGGGTCACACCTGATTCCCTGGG + Intergenic
1057021097 9:91698158-91698180 AGGGTCCTGCCCCCTACCCTGGG + Intronic
1057271702 9:93655364-93655386 TGGGTCCCTCCTCCCTCCGTTGG + Intronic
1057307291 9:93919817-93919839 TGGGCACCCCCTCCGTCCCTTGG + Intergenic
1057355862 9:94330935-94330957 GGGTTCTCCCCTCCTTGCCTGGG + Intergenic
1057651896 9:96926694-96926716 GGGTTCTCCCCTCCTTGCCTGGG - Intronic
1058082497 9:100714775-100714797 AGAGCCGCTCCTCCTTCCCTAGG + Intergenic
1058849620 9:108998197-108998219 AAGGTCCCCTCTCCTTCCATGGG - Intronic
1059190527 9:112321797-112321819 AGGGGCCCCCATACTTCCCTAGG + Intronic
1059322680 9:113481664-113481686 CCGGTCCCCACTCCTTCCATTGG + Intronic
1060153765 9:121304847-121304869 AGGGACCCACCTTCTTCACTTGG - Intronic
1061024736 9:128041165-128041187 AGGGTCCCACCTCACACCCTGGG + Intergenic
1061083700 9:128387036-128387058 AGGGTCACCTGTCCTTTCCTAGG - Intronic
1061188870 9:129070485-129070507 AGGCTCCTCCTCCCTTCCCTGGG + Exonic
1061246957 9:129405437-129405459 AGGCCCCCCCCTCCAGCCCTGGG - Intergenic
1061888651 9:133606116-133606138 ACTGTGCCTCCTCCTTCCCTCGG - Intergenic
1061956200 9:133962464-133962486 TGGGTCCTCCCTACTCCCCTGGG + Intronic
1062057339 9:134475393-134475415 CGGGTCCCTCCTCCTTCCCCGGG - Intergenic
1062073365 9:134571363-134571385 AGGGTCTCCACTCGTTCCCTGGG - Intergenic
1062220161 9:135410716-135410738 AGGGTCTCCCTTCCCTCCCCTGG + Intergenic
1062268642 9:135699024-135699046 AGGGTCCCAGCTCCTGCCTTCGG - Exonic
1062466950 9:136685764-136685786 AGGGGCCCCCCTCAGCCCCTGGG - Intronic
1062715893 9:138009900-138009922 AGCCTCCAGCCTCCTTCCCTTGG - Intronic
1186257894 X:7742385-7742407 AGGGTCACCCTTCTTCCCCTGGG - Intergenic
1187500224 X:19833182-19833204 ACAGTCCTCCCTCCTTCCCAGGG + Intronic
1189328926 X:40130907-40130929 AGCCACCCCCCACCTTCCCTGGG + Intronic
1190043152 X:47088436-47088458 AGGGTCGATCCTCCCTCCCTGGG - Intronic
1190065024 X:47233682-47233704 GAGGTCCCCGCTCCCTCCCTCGG - Intronic
1190332952 X:49247221-49247243 AGGGCCCCCCATCCTTCTCATGG + Intronic
1190775876 X:53551926-53551948 AGGCCCACCCCACCTTCCCTGGG + Intronic
1195129639 X:101840010-101840032 AAGGTCCCCCCACCTGTCCTGGG - Intronic
1195176599 X:102319819-102319841 AAGGTCCCCCCACCTGTCCTGGG + Intronic
1195182265 X:102367274-102367296 AAGGTCCCCCCACCTGTCCTGGG - Intronic
1195202464 X:102564510-102564532 AAGGTCCCCCCACCTGTCCTGGG + Intergenic
1199693983 X:150330492-150330514 AGGCTCCCACATCCTTCCCATGG + Intergenic