ID: 1172625592

View in Genome Browser
Species Human (GRCh38)
Location 20:36344847-36344869
Sequence AGGGTCCCCCCTCCTTCCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172625585_1172625592 30 Left 1172625585 20:36344794-36344816 CCTCATCTTGGCCGTGTGGAGGC No data
Right 1172625592 20:36344847-36344869 AGGGTCCCCCCTCCTTCCCTAGG No data
1172625587_1172625592 19 Left 1172625587 20:36344805-36344827 CCGTGTGGAGGCAGCAGGACTCT No data
Right 1172625592 20:36344847-36344869 AGGGTCCCCCCTCCTTCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172625592 Original CRISPR AGGGTCCCCCCTCCTTCCCT AGG Intronic