ID: 1172625592 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:36344847-36344869 |
Sequence | AGGGTCCCCCCTCCTTCCCT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1172625585_1172625592 | 30 | Left | 1172625585 | 20:36344794-36344816 | CCTCATCTTGGCCGTGTGGAGGC | No data | ||
Right | 1172625592 | 20:36344847-36344869 | AGGGTCCCCCCTCCTTCCCTAGG | No data | ||||
1172625587_1172625592 | 19 | Left | 1172625587 | 20:36344805-36344827 | CCGTGTGGAGGCAGCAGGACTCT | No data | ||
Right | 1172625592 | 20:36344847-36344869 | AGGGTCCCCCCTCCTTCCCTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1172625592 | Original CRISPR | AGGGTCCCCCCTCCTTCCCT AGG | Intronic | ||