ID: 1172626039

View in Genome Browser
Species Human (GRCh38)
Location 20:36347388-36347410
Sequence GTGCTCAGTGGCCCATGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172626039_1172626041 -8 Left 1172626039 20:36347388-36347410 CCAGATCATGGGCCACTGAGCAC 0: 1
1: 0
2: 0
3: 6
4: 141
Right 1172626041 20:36347403-36347425 CTGAGCACCAGCATCAACCCAGG 0: 1
1: 0
2: 0
3: 13
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172626039 Original CRISPR GTGCTCAGTGGCCCATGATC TGG (reversed) Intronic
900975117 1:6011932-6011954 GTGCTCAGAGGACAATGAGCTGG + Intronic
901185068 1:7367736-7367758 GTGCCCAGTGTCTCATGATCTGG - Intronic
902133649 1:14285411-14285433 GTGCACAATGGCCCAACATCTGG + Intergenic
902727487 1:18346856-18346878 GTGGTCAGGGGCCCCTGAGCTGG + Intronic
904034079 1:27549831-27549853 GTGCCCAGTGGCCCAGGCTTTGG - Exonic
904801717 1:33097729-33097751 TTGCTCAGAGGCACATGATAGGG - Intronic
906708919 1:47914903-47914925 GTCCTCTGTGGCCCGTGCTCTGG + Intronic
911552329 1:99298275-99298297 CTGCTCACAGGCACATGATCTGG - Intronic
914196407 1:145450259-145450281 CTGCCCGGTGGCCCATGTTCTGG - Intergenic
914446750 1:147757212-147757234 GGCCTCAGTGGCTGATGATCTGG + Exonic
916035025 1:160914115-160914137 GGGCACAGTGGCTCATGATGGGG - Intergenic
1064566063 10:16640516-16640538 AGGCCCAGTGGCCCATGTTCAGG - Intronic
1065111579 10:22445172-22445194 GTGGACAGTGGCCCCTGAGCTGG + Intronic
1070076408 10:73140632-73140654 TTGCTCAGTCGCCCATGCTGGGG - Intronic
1072545190 10:96431925-96431947 GTGCTCAGGGGCCTATGAGGGGG + Intronic
1072745256 10:97935029-97935051 TTGCTCAGTGTCTCATGATTTGG - Intronic
1073128029 10:101164404-101164426 GTGGTCAGTGGTCTCTGATCAGG + Intergenic
1074458488 10:113615614-113615636 GTGCTCAGAAGCCCCTGAGCTGG - Intronic
1074781085 10:116802811-116802833 ATGTTCTGTGGCCCATGATACGG - Intergenic
1076804370 10:132847709-132847731 GCCCTCAGGGGCCCCTGATCTGG + Intronic
1077348167 11:2073976-2073998 GTTCTCAGAGGCCCAGGTTCAGG - Intergenic
1078519750 11:12053429-12053451 GTGCCTTGTGGCCCATGTTCAGG + Intergenic
1079400579 11:20103456-20103478 GTGCACAGTGCCCCATCAGCTGG - Intronic
1079812204 11:25008843-25008865 GTGCTGATTGGCCCATGGGCGGG + Intronic
1080768210 11:35316524-35316546 GTTGCCAGTGGCCCAGGATCAGG - Intronic
1081774251 11:45666485-45666507 GTGATCAGTGGCCCCTGGGCTGG + Intergenic
1083475209 11:62910824-62910846 GAGCCCAGTGGCCCATGAGCAGG + Exonic
1083766023 11:64842059-64842081 GTGCTCCTTTGGCCATGATCAGG + Intronic
1084354151 11:68626038-68626060 CTGCTAAGTGGGCCATGAACGGG - Intergenic
1088185182 11:107159036-107159058 ATGGTCAGTGGCCAATGGTCTGG + Intergenic
1090237594 11:125160781-125160803 GTACTCTGGGGCCCATGAGCTGG + Intergenic
1091801379 12:3326752-3326774 CTGCCCCGTGGCCCAGGATCCGG - Intergenic
1091840421 12:3616614-3616636 GTGCTGAGGGGCCTCTGATCTGG + Intronic
1097078158 12:56410446-56410468 GTGCCAATTGGCCCATGAGCAGG + Intergenic
1098317837 12:69210796-69210818 ATGCTCAGTGGCAGATGATGTGG - Intergenic
1101315720 12:103627183-103627205 GTGCTTAGGGGCCCAGGCTCTGG - Intronic
1102230746 12:111260576-111260598 GTGCTCAGTAGCACATGGACCGG + Intronic
1102873836 12:116434583-116434605 GTGCTCTGTGGCCTCTGAACAGG - Intergenic
1106066002 13:26350493-26350515 GGGCTCAGTGGCACATGCTGTGG + Intronic
1106668564 13:31880146-31880168 GTGCTCAGTAGCACATGTACTGG + Intergenic
1106909533 13:34448633-34448655 GTGATCACTGGCCTATGATTTGG - Intergenic
1110025632 13:70535392-70535414 GAGATCAGTGGCCTATGGTCAGG - Intergenic
1111316267 13:86564923-86564945 GTTTGCAGTGACCCATGATCTGG - Intergenic
1121640321 14:95480947-95480969 GAGCTCTGTGGCCCATTAGCTGG + Intergenic
1122960653 14:105092436-105092458 GTGCTCAGTGGTGCTTGAACAGG - Intergenic
1123401710 15:19993904-19993926 ATGGTCAGTGGCCTCTGATCAGG - Intergenic
1123511053 15:21000565-21000587 ATGGTCAGTGGCCTCTGATCAGG - Intergenic
1124648970 15:31461053-31461075 GAGCTCAGGGGCCAATGATCTGG - Intergenic
1125523678 15:40362209-40362231 GTGCTCCATGGCCCATGACAGGG + Intronic
1126696926 15:51334208-51334230 TTCCTCAGTGGCCCAAGATGGGG + Intronic
1128308137 15:66613542-66613564 TTCCTCAGTGGACCATGCTCTGG - Intronic
1128472626 15:67968019-67968041 GTGCTCAGGGGGCCAGGAACAGG - Intergenic
1128686023 15:69686209-69686231 GTGCCCAGTGTCCAATCATCAGG + Intergenic
1130167163 15:81473240-81473262 GTGCACAGTTGTCCATTATCTGG + Intergenic
1130443026 15:83974266-83974288 TTGCTCAGTGTCACATGATGAGG - Intronic
1130788830 15:87130033-87130055 TTGCTCAGTGGGCCATGCTGAGG + Intergenic
1131556834 15:93406983-93407005 GTGCGCAGTGCCGAATGATCTGG + Intergenic
1132717530 16:1299404-1299426 GTGCTCCTTGGGCCAGGATCCGG - Intergenic
1132799011 16:1742320-1742342 GTGCTCAGTGCCCCCTGCTGTGG - Intronic
1133492611 16:6285155-6285177 CTGCTCAGTGGCCCTGGATAGGG + Intronic
1139519443 16:67472182-67472204 GTGCTCAGTGGCGGATGAACTGG - Intronic
1145278394 17:21450571-21450593 GCTGTCAGTGGCCCAGGATCTGG + Intergenic
1147599959 17:41739384-41739406 GGGCTCAGTGGCCCAGGAGTTGG - Intergenic
1147691152 17:42315496-42315518 GTTCTCTGAGACCCATGATCAGG - Exonic
1158288606 18:55913515-55913537 GTGCTCAGTAGCCCTTGTTTTGG + Intergenic
1160378189 18:78429718-78429740 GTGCTCAGCGGCCCACGGCCCGG - Intergenic
1164415824 19:28045827-28045849 GTGCTTATTGGACCCTGATCTGG + Intergenic
1167421129 19:49404047-49404069 CTGCCGAGTGGCCCAGGATCTGG + Intronic
925395972 2:3534008-3534030 GTGCTGATTGGCCCATGGGCGGG - Intronic
926670392 2:15572148-15572170 GTGGTCAGGGGCCTATGGTCAGG - Intergenic
926905394 2:17800778-17800800 GTTCTCAGTGACCAATTATCTGG - Intergenic
929526859 2:42712325-42712347 TTGCTCTGTTGCCCATGCTCTGG + Intronic
934495141 2:94789678-94789700 CTGGTCAGTGGACCATGGTCAGG - Intergenic
934745688 2:96758055-96758077 ATGCTCAGGGGTCCAGGATCAGG + Intergenic
935955927 2:108376657-108376679 TTTCTCTGTGGCCCATGTTCTGG - Intergenic
945021576 2:205578107-205578129 TTGCTCAGGGGCCAATGAGCAGG - Intronic
946067954 2:217006297-217006319 GTGTTCAGTGTCCCAGGAGCAGG - Intergenic
1168839218 20:898459-898481 CTGCTAAGTGGGCCATGAACGGG - Intronic
1172626039 20:36347388-36347410 GTGCTCAGTGGCCCATGATCTGG - Intronic
1172744583 20:37196876-37196898 GTGACTAGTGGCCCAAGATCAGG - Intronic
1172929065 20:38569775-38569797 GTGCTCAGTGACCAAGTATCAGG - Intronic
1173379610 20:42528041-42528063 GGCCTCATAGGCCCATGATCTGG + Intronic
1174167260 20:48593864-48593886 GTCCTCAGTGGCTCATGTCCTGG - Intergenic
1175825326 20:61933735-61933757 GTGCTCAGGGGGCCAGGAGCTGG - Intronic
1176044077 20:63083439-63083461 TTACTCAGTGACCCAGGATCCGG - Intergenic
1176044087 20:63083502-63083524 GCACTCAGTGACCCAGGATCTGG - Intergenic
1176110930 20:63410383-63410405 GTGCTCAGTGCCCCGTGAGGTGG + Intronic
1178626593 21:34223708-34223730 GAGCTCATTGGCCCAAGTTCTGG + Intergenic
1178679442 21:34660157-34660179 GTGCTCAGGTGCCAATGATGGGG - Intergenic
1179270903 21:39850334-39850356 GTGATCAATGCCCCATGATTTGG - Intergenic
1179958416 21:44754163-44754185 GAGCTGAGTCGCCCATGACCTGG + Intergenic
1180560907 22:16613548-16613570 CTGCTAAGTGGGCCATGACCTGG - Intergenic
1181529843 22:23511203-23511225 TTGCTCTGTGGCCCAGGATGGGG - Intergenic
1182313431 22:29425859-29425881 TTGCTCTGTGGCCCAGGATGGGG - Intergenic
1183442118 22:37829188-37829210 GAGCTCAGTGGTCCCTGAGCTGG - Intergenic
1183442126 22:37829230-37829252 GAGCTCAGTGGTCCCTGAGCTGG - Intergenic
950492913 3:13317016-13317038 GTTCACAGTGGCCCATGGTTGGG + Exonic
951509636 3:23486794-23486816 GTGCTGACTGGTCCATGGTCGGG + Intronic
956113812 3:65898271-65898293 GTGTTCAGTGGACCATTATTTGG - Intronic
960530070 3:118754223-118754245 GTGCTCAGAGTTACATGATCTGG + Intergenic
962014451 3:131425825-131425847 ATGCTCAGTGGGTCATGGTCAGG - Intergenic
964176088 3:153827071-153827093 CTGCTAAGTGGGCCATGAACCGG + Intergenic
966755702 3:183369340-183369362 GTGATCAGTGGCCTCTTATCAGG - Intronic
968015781 3:195331392-195331414 GTTCTCAGTGAGCCAAGATCGGG - Intronic
968243099 3:197110886-197110908 TTGCACAGAGGCTCATGATCAGG + Intronic
968558221 4:1261248-1261270 GTGCTCTGTGGGCCATGAGAAGG + Intergenic
972309295 4:37864896-37864918 GTGGTCACTGGCCTGTGATCGGG + Intergenic
972679135 4:41288632-41288654 GTGCTAATTGGTCCATGATTTGG + Intergenic
974015953 4:56649531-56649553 CTGCTCAGTGGCCCTGGAGCAGG - Intronic
974615214 4:64271599-64271621 GTGCTGAGTGGTCCATGAGTGGG - Intergenic
975841665 4:78480782-78480804 GTGCTGAGTGTCTCCTGATCTGG + Intronic
986353158 5:6899054-6899076 AGGCTCAGTGGCCCATGTGCAGG - Intergenic
986442796 5:7796555-7796577 GTGCTCATAGGCCTATGCTCGGG + Intronic
989977972 5:50608244-50608266 GTGCCCAGCCGCCCATCATCTGG + Intergenic
993642940 5:90427567-90427589 CTGCTCAGGGGCCCATGCTTTGG - Intergenic
997157245 5:131573778-131573800 CTGCTAAGTGGGCCATGAACTGG - Intronic
1001474967 5:172044097-172044119 ATGCTCAGTGGCACAGGCTCAGG + Exonic
1001669429 5:173461556-173461578 ATGCTCAGCAGCCCTTGATCAGG - Intergenic
1001867064 5:175114945-175114967 GTGTTCAGTGACCCAAGATTGGG - Intergenic
1004759410 6:18649558-18649580 GTGCTCTGTCGCCCAGGATGGGG + Intergenic
1008445163 6:51580771-51580793 GTGCTCAGTGTGCCATGTTGAGG - Intergenic
1013170767 6:107634809-107634831 GGGCTCGGTGGCCCACGGTCAGG - Exonic
1013230647 6:108158453-108158475 GTACTGAATGGCCCATGATCTGG + Intronic
1013952487 6:115800904-115800926 GTGTTCTGTGGCCCAGAATCTGG - Intergenic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1023871662 7:44266607-44266629 CTGCTCAGTGGCCACTGCTCTGG - Intronic
1026943839 7:74303936-74303958 TTGCTCTGTGGCCCAGGATGGGG + Intronic
1029317112 7:99725179-99725201 GTGCTAAGTGGGCCATGAACTGG - Intronic
1031016459 7:116581358-116581380 GTGCTCAGGGACAAATGATCTGG - Intergenic
1035418436 7:158707881-158707903 GTGCTGATTGGCCCATGGGCAGG + Intergenic
1038672756 8:29595625-29595647 GGGCTCAGGGGCACATGATGAGG + Intergenic
1039401526 8:37273994-37274016 GTTCACAGTGGCCCATCATTTGG - Intergenic
1039829035 8:41198257-41198279 TTGCTAATTGCCCCATGATCTGG + Intergenic
1042794645 8:72647987-72648009 GTGGTCAGGGGCCAATGGTCAGG + Intronic
1044729317 8:95217686-95217708 GGGCACAGTGGCTCATGAGCTGG - Intergenic
1047447224 8:124930301-124930323 GTGACCAGTGACCCATGACCAGG - Intergenic
1053442566 9:38128241-38128263 GTGCTCTGGGGTCCATGACCGGG - Intergenic
1057171412 9:92965421-92965443 TTGCTCAGTGGCCCCAGAGCCGG + Intronic
1057218358 9:93242124-93242146 CTGCACAGTGGCCCATGTCCTGG + Intronic
1060079195 9:120625458-120625480 GAGCTGAGTGTGCCATGATCGGG + Intronic
1061231095 9:129316234-129316256 GGGCAGAGTGGCCCATGAGCTGG + Intergenic
1061850235 9:133410607-133410629 ATGCCCTGTGGCCCATGTTCAGG - Intronic
1062698325 9:137886576-137886598 CTGCCCGGTGGCCCATGTTCTGG + Intronic
1186680604 X:11869964-11869986 ATATTCAGTGGCCCATGATATGG - Intergenic
1192764641 X:74128611-74128633 CTGCTAAGTGGGCCATGAACTGG + Intergenic
1197200256 X:123742457-123742479 ATGATCAGTGGCCTCTGATCAGG - Intergenic
1197881319 X:131169828-131169850 GTACTCAGTGTCATATGATCGGG - Intergenic
1202076558 Y:21042893-21042915 CTGCTAAGTGGGCCATGAACTGG + Intergenic