ID: 1172628329

View in Genome Browser
Species Human (GRCh38)
Location 20:36361519-36361541
Sequence TCTTCTCTGCAGCAGCCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 527
Summary {0: 1, 1: 0, 2: 2, 3: 56, 4: 468}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172628329_1172628342 17 Left 1172628329 20:36361519-36361541 CCTTCTGGCTGCTGCAGAGAAGA 0: 1
1: 0
2: 2
3: 56
4: 468
Right 1172628342 20:36361559-36361581 CGGGCACCTAGGGAGGAAGCTGG 0: 1
1: 1
2: 1
3: 14
4: 193
1172628329_1172628339 7 Left 1172628329 20:36361519-36361541 CCTTCTGGCTGCTGCAGAGAAGA 0: 1
1: 0
2: 2
3: 56
4: 468
Right 1172628339 20:36361549-36361571 GGGAGGCAGCCGGGCACCTAGGG 0: 1
1: 0
2: 0
3: 20
4: 172
1172628329_1172628335 -3 Left 1172628329 20:36361519-36361541 CCTTCTGGCTGCTGCAGAGAAGA 0: 1
1: 0
2: 2
3: 56
4: 468
Right 1172628335 20:36361539-36361561 AGATGGGCCAGGGAGGCAGCCGG 0: 1
1: 1
2: 4
3: 90
4: 705
1172628329_1172628334 -10 Left 1172628329 20:36361519-36361541 CCTTCTGGCTGCTGCAGAGAAGA 0: 1
1: 0
2: 2
3: 56
4: 468
Right 1172628334 20:36361532-36361554 GCAGAGAAGATGGGCCAGGGAGG 0: 1
1: 0
2: 2
3: 57
4: 531
1172628329_1172628340 10 Left 1172628329 20:36361519-36361541 CCTTCTGGCTGCTGCAGAGAAGA 0: 1
1: 0
2: 2
3: 56
4: 468
Right 1172628340 20:36361552-36361574 AGGCAGCCGGGCACCTAGGGAGG 0: 1
1: 0
2: 0
3: 10
4: 174
1172628329_1172628338 6 Left 1172628329 20:36361519-36361541 CCTTCTGGCTGCTGCAGAGAAGA 0: 1
1: 0
2: 2
3: 56
4: 468
Right 1172628338 20:36361548-36361570 AGGGAGGCAGCCGGGCACCTAGG 0: 1
1: 0
2: 3
3: 58
4: 466
1172628329_1172628336 -2 Left 1172628329 20:36361519-36361541 CCTTCTGGCTGCTGCAGAGAAGA 0: 1
1: 0
2: 2
3: 56
4: 468
Right 1172628336 20:36361540-36361562 GATGGGCCAGGGAGGCAGCCGGG 0: 1
1: 0
2: 6
3: 81
4: 651

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172628329 Original CRISPR TCTTCTCTGCAGCAGCCAGA AGG (reversed) Intronic
900311129 1:2033640-2033662 TCCTCCCTGGAGCTGCCAGAGGG - Intergenic
900688425 1:3964493-3964515 TCTTGTCTGCAGCAGCTGCACGG - Intergenic
900780207 1:4613044-4613066 TTTTCTCTGCTGCTGCCAAATGG - Intergenic
900864730 1:5260238-5260260 TCTTCTCTGTGGCAGACAGCTGG + Intergenic
900900451 1:5512396-5512418 TCCTCTCTGCAGGTGCCAGCTGG + Intergenic
900913721 1:5620031-5620053 CTTGTTCTGCAGCAGCCAGAGGG - Intergenic
901012004 1:6207367-6207389 GCTTCTCTGCAGACACCAGACGG + Exonic
902037167 1:13466430-13466452 TCTTAGCTCCAGAAGCCAGAGGG + Intergenic
902140694 1:14351190-14351212 TCATTTCGCCAGCAGCCAGAAGG + Intergenic
902256352 1:15191252-15191274 TCTTCCCTGAAGCCTCCAGAAGG + Intronic
903303576 1:22396335-22396357 TCTTCCATACAGCAGCCAGAGGG + Intergenic
903683615 1:25114623-25114645 TCTTCCCTGGAGCCTCCAGAAGG - Intergenic
904236552 1:29121059-29121081 TGTTCAATGCAGGAGCCAGACGG + Exonic
904974290 1:34443942-34443964 TCTTCCCTGAAGCTTCCAGAAGG - Intergenic
905242345 1:36589082-36589104 GCTCCTCCGCAGCAGTCAGAAGG + Intergenic
906150513 1:43584738-43584760 ACTGCTCTGCGGCAGCCACAAGG + Intronic
906706854 1:47901303-47901325 TCTTCTCTGCAGCAATCAGCAGG + Intronic
907354448 1:53861048-53861070 TCTGCTCTCTATCAGCCAGAAGG + Intronic
908015397 1:59827328-59827350 TCTTCCCAGCAACATCCAGATGG + Intronic
908461089 1:64348824-64348846 TCTGCTCTGCAGCAGCCCCCAGG + Intergenic
909610395 1:77545843-77545865 TCTTCACTGCACCAGCAGGAGGG - Intronic
911282403 1:95946863-95946885 ATTTCTCTGCAACAGCCAAATGG - Intergenic
912769374 1:112449139-112449161 TGCTCTCAGCAGCAGCCAGCTGG - Exonic
913683909 1:121213670-121213692 GCTTATCTGTAGTAGCCAGATGG + Intronic
914035748 1:144001285-144001307 GCTTATCTGTAGTAGCCAGACGG + Intergenic
914153707 1:145066660-145066682 GCTTATCTGTAGTAGCCAGACGG - Intronic
915706142 1:157845673-157845695 TCCGCTCTGCAGCATCCACAAGG - Intronic
915735714 1:158083654-158083676 TCTGCCCTGGAGCAGACAGATGG - Intronic
915882460 1:159686224-159686246 TCATCTCTGCAGTACCCAGTGGG + Intergenic
916181413 1:162087072-162087094 TATTTTCTGCAGCAGACAGAGGG + Intronic
917444199 1:175092999-175093021 TATTCTCCTCAGAAGCCAGAGGG + Intronic
917681937 1:177376285-177376307 TCTTCTCTGCAGCATGAAAATGG - Intergenic
918006475 1:180546208-180546230 TGTTCTCTGAAGCATTCAGATGG - Intergenic
918098221 1:181351612-181351634 TCTCCTCTACAGCCCCCAGAGGG - Intergenic
918574063 1:186034245-186034267 TCTTCTCTAGAGCCTCCAGAAGG + Intronic
919131510 1:193456652-193456674 TCTTCTCTGCAGCTGTCTCAGGG - Intergenic
919169039 1:193930738-193930760 TCTTCACTGCACCTTCCAGAAGG - Intergenic
920471213 1:206232162-206232184 GCTTATCTGTAGTAGCCAGACGG + Intronic
922870746 1:228900085-228900107 TCTCCTCAGCTTCAGCCAGAGGG + Intergenic
923024966 1:230196787-230196809 TGCTCTCTGCATCACCCAGAGGG - Intronic
923204901 1:231749733-231749755 TCTTCTTTGCACCAACAAGATGG - Intronic
923350637 1:233101889-233101911 TCTACTCTACAGCAGGCAGAAGG - Intronic
1063096383 10:2912765-2912787 TCCACTCTGCAGCATCCAGGAGG + Intergenic
1063114659 10:3065713-3065735 TCTGCTCTTCTGCCGCCAGAAGG + Intergenic
1063134917 10:3208143-3208165 TCTTATATTCAGCAGCCAGGTGG - Intergenic
1063244792 10:4206679-4206701 TCTTCTTTCCTGCACCCAGACGG + Intergenic
1064406542 10:15069342-15069364 TCCTCCCTGCAGCAGCCACAGGG + Intronic
1064716288 10:18180251-18180273 GCTTCTCTGCAACAGACAGAGGG + Intronic
1066662171 10:37747491-37747513 TCTTATATTCAGCAACCAGATGG - Intergenic
1067007786 10:42681098-42681120 TCCTCTCTGGAGCCTCCAGAAGG - Intergenic
1067018912 10:42778461-42778483 TTTTCAATGAAGCAGCCAGAGGG - Intergenic
1067582849 10:47456383-47456405 TGGTCTCTGCAGAAGCCAGGAGG + Intergenic
1067704762 10:48598546-48598568 CCTTCTCTGCAGGTGGCAGACGG + Intronic
1068645754 10:59465248-59465270 TTTTATCAGAAGCAGCCAGAGGG - Intergenic
1069793658 10:71039348-71039370 TCCTCTGGGCAGCTGCCAGAAGG + Intergenic
1070055270 10:72928634-72928656 TGTCCTCTGCAGCAACCAGCAGG + Intronic
1071935799 10:90528869-90528891 TTTCCTCTGGAGCATCCAGAAGG - Intergenic
1072756240 10:98023108-98023130 GCTTCCCTGCAGCAGCCAGGTGG + Intronic
1073075598 10:100824232-100824254 TGGTCTCTCCAGCAGCCAAATGG - Intronic
1073745555 10:106464601-106464623 TTTTCCATACAGCAGCCAGAAGG - Intergenic
1073950632 10:108804968-108804990 GCTTCTAAGAAGCAGCCAGATGG + Intergenic
1075105719 10:119538798-119538820 TCTTTGCTGCAGCAGCCTGCGGG - Intronic
1075503007 10:122995272-122995294 CCTACTCTTCAGCTGCCAGAAGG + Intronic
1076071321 10:127492257-127492279 TCTCCTCTACAGCCTCCAGAAGG - Intergenic
1076122788 10:127949718-127949740 TCTTCTCTCCCGTAGCCACAGGG + Intronic
1076356943 10:129860250-129860272 TCCTCCCTGCAGCACCGAGAAGG + Intronic
1076616804 10:131760466-131760488 TCTTCTCTGCTCCAGACACATGG + Intergenic
1077009168 11:372647-372669 TTTTCTCTCCTGCAGCCCGAAGG + Exonic
1077119894 11:902247-902269 TCTCTTCAGCTGCAGCCAGACGG + Exonic
1078488025 11:11742045-11742067 TCTCCTCTGCTGGAACCAGAAGG + Intergenic
1079146619 11:17858024-17858046 TGTTCCCTGCAGCAGGCACAGGG - Intronic
1079326597 11:19498175-19498197 TCTTCTCTGGAGGAGCCACATGG - Intronic
1080340702 11:31260148-31260170 TCTTCCCAGTATCAGCCAGATGG - Intronic
1080457739 11:32431113-32431135 GCTTCTCTGCAGCCGCCGGCGGG - Intronic
1080788738 11:35500074-35500096 TCTCCTGTGGAGCATCCAGAAGG + Intronic
1081632304 11:44697902-44697924 TCTTGGCTCCAGCAGCCAGTTGG - Intergenic
1081647864 11:44802475-44802497 TTCTCCATGCAGCAGCCAGAGGG - Intronic
1083864867 11:65448259-65448281 TCTTCTCTTCCCCAGACAGAAGG - Intergenic
1085128442 11:74017865-74017887 TCTTCACTCCAGCCCCCAGATGG + Intronic
1085942352 11:81220299-81220321 TTTTCTCTGCGCCTGCCAGATGG + Intergenic
1086925196 11:92632555-92632577 ACTTCTCTTCTGCAGGCAGAAGG + Intronic
1087983425 11:104646357-104646379 TCTACTCTGCAACAGCCACCAGG - Intergenic
1088292716 11:108258546-108258568 TTTTATCTGCAGCAGCCTGTGGG + Intronic
1088547397 11:110973695-110973717 TCTTCTTAGCAGCAGCAGGAAGG - Intergenic
1088696505 11:112370706-112370728 TCTTCCAAACAGCAGCCAGAGGG - Intergenic
1089139947 11:116276851-116276873 TCTGCTCTGCGGGAGCCAGCGGG - Intergenic
1089391949 11:118108268-118108290 TCTTCCCTGGAGCATCAAGAAGG - Intronic
1089690207 11:120182472-120182494 TCTTCTCTGCAACCTTCAGATGG - Intronic
1090263946 11:125342456-125342478 TCTTCTCTGAGGCAGTCAGGAGG - Intronic
1091387871 12:106210-106232 TCTGCTCTTCATCAGCCACATGG - Intronic
1091501685 12:1023876-1023898 GTTTCTCTGGAGAAGCCAGAGGG + Intronic
1092141130 12:6184249-6184271 TCTCCCCTGCAGCCTCCAGAGGG - Intergenic
1092142625 12:6194376-6194398 TCTCCCCTGCAGCTGCCAGAGGG - Intergenic
1092776598 12:11949496-11949518 TGGGGTCTGCAGCAGCCAGAAGG + Intergenic
1094729725 12:33161050-33161072 TATCCGCTGCAGCAGACAGATGG - Intergenic
1095121616 12:38425758-38425780 TCTTCTCTGCATAGGCCAAATGG + Intergenic
1096785500 12:54014923-54014945 TCCTATCTGCAGCAGCCGAATGG - Intronic
1097572068 12:61346334-61346356 TATTCTCTGCAGCACCAAAATGG + Intergenic
1097586978 12:61526881-61526903 TCTTCTTTTCTGCAGTCAGATGG + Intergenic
1097655279 12:62353346-62353368 TCTTCTTTGCAGCAACATGATGG - Intronic
1097976617 12:65693334-65693356 TCTTCCCTCCAGCCTCCAGAAGG - Intergenic
1098014315 12:66088342-66088364 TCTGCCCTGCAGAAGCCAGGAGG + Intergenic
1098874582 12:75853833-75853855 TCTGCTCTGAAGTAGACAGAAGG + Intergenic
1099918970 12:88933347-88933369 TCTTCTCTGAAGAACTCAGATGG + Intergenic
1100302341 12:93319454-93319476 TCATCTCTTCAGCAGCAAAATGG - Intergenic
1100480397 12:94972479-94972501 TCTTCTCAGCAGGAGCCTCATGG - Intronic
1100677695 12:96886178-96886200 TCTCCCCTGGAGCATCCAGAAGG - Intergenic
1101289899 12:103357496-103357518 CCTTGCCTGCAGCAGACAGATGG - Intronic
1101561636 12:105862779-105862801 TCTCCCCTGGAGCATCCAGAAGG - Intergenic
1101839962 12:108320974-108320996 TATTCCCTGCAGCTGGCAGATGG - Intronic
1102251304 12:111389411-111389433 TCCTCTCTGCTGCAGCCACATGG - Intergenic
1102525762 12:113511559-113511581 ACGTCTCTGCAGCTGCAAGAAGG - Intergenic
1102593307 12:113973697-113973719 TCTCCCCTGCAGCCTCCAGAGGG - Intergenic
1103412542 12:120722736-120722758 TCTTCTTTGGAGAAGCTAGAAGG - Exonic
1103643476 12:122371891-122371913 GCTTCTCTGCAGCAGCATAAGGG + Intronic
1103936914 12:124481824-124481846 TCTTCCAAGCAGCAGCCAGAGGG - Intronic
1103960676 12:124607299-124607321 TCTTCCCCCCAGCAGCCAGAGGG + Intergenic
1104313876 12:127679270-127679292 TCTTCTCTGCAGTCCCCACAGGG + Intergenic
1104365217 12:128170639-128170661 TCTTCTATGGGGCAGCAAGAAGG - Intergenic
1104392415 12:128402171-128402193 TCTTCCCTGAAGCCTCCAGAAGG + Intronic
1104691157 12:130827451-130827473 TCCTGGCTGAAGCAGCCAGAAGG + Intronic
1105059388 12:133134480-133134502 TCTTCTCTAGAGCCTCCAGAAGG + Intronic
1105271365 13:18878386-18878408 TCTTACCTCCTGCAGCCAGAAGG + Intergenic
1105415327 13:20206854-20206876 TCTTCTCTGATACAGACAGAAGG - Intergenic
1107632524 13:42356561-42356583 TCTCCTCTGGAGCCTCCAGAAGG + Intergenic
1109570465 13:64182123-64182145 TCTTCTGAGTAGCACCCAGAAGG + Intergenic
1110770721 13:79341442-79341464 TTTTCCATACAGCAGCCAGAAGG + Intronic
1112261989 13:97885478-97885500 TCTGCTCTGTGGCATCCAGAAGG - Intergenic
1112926649 13:104683535-104683557 TGTTCCCTGCAGCAGCCAAAGGG + Intergenic
1113335540 13:109372846-109372868 TCTTCGCAGCAGGAGCCAGGAGG - Intergenic
1113975747 13:114225991-114226013 TCTTCCCTGCTGCCACCAGAAGG + Intergenic
1114822118 14:26033311-26033333 TCTTATCTCCTGCAGCCTGAGGG - Intergenic
1115653910 14:35424442-35424464 TCTTCTCTAGAGCCCCCAGAAGG + Intergenic
1116862228 14:50003707-50003729 TGGTCTCTGCAGCAGTCAGAAGG + Intronic
1118267170 14:64305751-64305773 TCTTTACTGCATCAACCAGATGG - Intronic
1118447363 14:65863823-65863845 TCTCCTCTACAGCTTCCAGAAGG - Intergenic
1118471540 14:66079407-66079429 TCTTTTCTGTGGAAGCCAGAGGG + Intergenic
1118717612 14:68571388-68571410 TCTTTTCTGCAGCCTCCAGAAGG - Intronic
1118885935 14:69865926-69865948 TCCTCTCTGTGGCAGCCAGAGGG + Intronic
1120073281 14:80126928-80126950 TTTGCTGTGCAGCAGCCAGGTGG + Intergenic
1120562957 14:86019024-86019046 TCTTCTCTCCTGTAGCCACAAGG - Intergenic
1120965121 14:90160068-90160090 TCTTTTTTGCCGCAGCCTGAAGG - Intronic
1122069396 14:99195848-99195870 TCTTCTGGGCAGCAGGCAGGAGG - Intronic
1122233226 14:100317640-100317662 TGTGGTCTGCAGCAGCCAGCTGG + Intergenic
1122242564 14:100378626-100378648 CCATCTCTGTAGCAGCCAGCTGG - Intronic
1122414496 14:101542427-101542449 TCTCCTCTGGAGCTTCCAGAAGG + Intergenic
1123965335 15:25450172-25450194 TCTTCTCTGCTGGAGTCACATGG - Intergenic
1124173470 15:27399333-27399355 TCATTTCTGCAGCAACCACAGGG - Intronic
1124636358 15:31367279-31367301 ACCTCTCTGCAGCAGGCTGAGGG + Intronic
1124694676 15:31854136-31854158 TCCTCCCTGGAGCATCCAGAAGG - Intronic
1126222887 15:46235341-46235363 CCTTATCTCCTGCAGCCAGAAGG - Intergenic
1126680745 15:51199724-51199746 TTCTCCGTGCAGCAGCCAGAGGG + Intergenic
1127996054 15:64153640-64153662 TCTTCTCTTCAGCACCCTGAGGG + Exonic
1129253224 15:74319897-74319919 TCATCTCTGCTGCAGCAGGAAGG + Intronic
1130919432 15:88331757-88331779 TCCTCTGTGCTGCAGCTAGAAGG - Intergenic
1131175952 15:90209977-90209999 GCTGCTATGCTGCAGCCAGAGGG - Intronic
1131378875 15:91947725-91947747 GCGTCTGTGCAGCAGCTAGACGG + Intronic
1131660595 15:94511612-94511634 TCTTCCCTGGAGCCTCCAGAAGG - Intergenic
1132384939 15:101393548-101393570 TGCTCTCAGCAGCATCCAGATGG - Intronic
1132594903 16:744280-744302 TCCTCCCTGCAGCCTCCAGAGGG - Intronic
1132894287 16:2220655-2220677 TTTTCTGTGCAGCAGTTAGAGGG + Intergenic
1133858355 16:9570994-9571016 TCCTCTCAGCAGCACCCAGCAGG - Intergenic
1134099507 16:11441807-11441829 TCTCCTCTGGAGCCTCCAGAAGG + Intronic
1134511893 16:14855127-14855149 TCCTCAATGCAGCTGCCAGAAGG - Intronic
1134687770 16:16170540-16170562 TCTGCACAGCTGCAGCCAGACGG + Intronic
1134699535 16:16253626-16253648 TCCTCAATGCAGCTGCCAGAAGG - Intronic
1134866224 16:17609594-17609616 TGTTCTCTTCACCAGCAAGATGG - Intergenic
1134972293 16:18541045-18541067 TCCTCAATGCAGCTGCCAGAAGG + Intronic
1135653465 16:24227173-24227195 TCTCCTCTGGAGCCTCCAGAAGG - Intergenic
1137352454 16:47725531-47725553 TGTGCTCAGCAGCAACCAGAAGG + Intergenic
1137691536 16:50431386-50431408 TCTTGTCTTCTGCAGCAAGAAGG - Intergenic
1137717613 16:50608381-50608403 TCTTCCCAGCAGCAGCGAGTGGG + Intronic
1137721469 16:50630068-50630090 TCTGCTTTGGGGCAGCCAGAGGG + Intronic
1140039628 16:71397401-71397423 CCTCCTCTGGAGCCGCCAGAGGG + Intergenic
1140801683 16:78494248-78494270 TGTTCTCTGCAGGAACTAGACGG - Intronic
1140863923 16:79043138-79043160 TCTTCTCTTCAGCTGCAAGTAGG - Intronic
1141168419 16:81676043-81676065 TCCTCACAGCAGCAGCCAGAGGG - Intronic
1141277799 16:82603964-82603986 TCTCCTCTCCAGCCTCCAGAGGG + Intergenic
1141750154 16:85953062-85953084 TCTTCCCTGGAGCCTCCAGAAGG - Intergenic
1141800208 16:86302897-86302919 TAGTCTCTGCAGCTACCAGAAGG + Intergenic
1141940861 16:87275087-87275109 CCTTCTCAGCAGCACCCAGATGG + Intronic
1142022120 16:87790351-87790373 TCTCCTCTGCAGCACCCCGCTGG + Intergenic
1142397171 16:89838766-89838788 TCATCTGTGCAGCAGGCAGGTGG + Intronic
1142510669 17:390678-390700 TCTCCCCTGCAGCCTCCAGAGGG + Intergenic
1143682551 17:8488124-8488146 CCTGCTCTGGAGCAGGCAGATGG + Intronic
1143683510 17:8495196-8495218 TCTTCTCTGCTTCTTCCAGAAGG + Exonic
1143830589 17:9647305-9647327 ACTGTTCTGCAGCAGCCAGTGGG + Intronic
1146660718 17:34663540-34663562 TCTGAGCTGCAGCAGCCAGCAGG + Intergenic
1147895399 17:43747826-43747848 TCTGCTATGCCGCTGCCAGATGG - Intergenic
1148769935 17:50060775-50060797 TCCCCTCAGCTGCAGCCAGAAGG - Intronic
1148994779 17:51700260-51700282 TCCTCAGTGCAGCAGCCAGAGGG + Intronic
1149651008 17:58276449-58276471 CCTTCTCTGCAGGGGCCAGAGGG + Intronic
1149771865 17:59328801-59328823 TTCTCTGTGCAGCAGCCAGATGG - Intergenic
1150697829 17:67421035-67421057 TCTTCCCTTCTGCACCCAGAAGG - Intronic
1151963768 17:77420684-77420706 TCTCCCCTGCAGCAGCCAGCTGG + Intronic
1152038778 17:77890055-77890077 TCTTCCCTGGAGCCGTCAGAAGG + Intergenic
1152089784 17:78240118-78240140 TCCTCTCTGCAGCAACCCGGGGG + Exonic
1152434277 17:80265657-80265679 TCTTCTCTCCTGTAGCCACAGGG + Intronic
1152668112 17:81583526-81583548 TCATCTCTGGGGCAGCCAGGTGG - Intronic
1154030403 18:10748539-10748561 TCTTCTTTGCAGCAGGAGGAAGG + Exonic
1154332441 18:13440968-13440990 GGTTCTCTGCAGGAGCCCGAGGG + Intronic
1155026609 18:21946316-21946338 TCTCCCCTGCAGCCTCCAGAAGG - Intergenic
1155166719 18:23237830-23237852 TCTCCTCTGCAGACACCAGAGGG + Intronic
1155280914 18:24238743-24238765 TCTTCTCTGCTCCAGACACATGG + Intronic
1155355470 18:24948737-24948759 TCTTAACTGGAGCAGTCAGAAGG - Intergenic
1155521874 18:26676509-26676531 TCTTCTCTAGAGCCTCCAGAAGG - Intergenic
1158007645 18:52691458-52691480 TCTTCTCTAAAGCCTCCAGAAGG - Intronic
1158327891 18:56329887-56329909 TCTTCTCTAGAGCCTCCAGAGGG + Intergenic
1159234047 18:65648105-65648127 TCTTCTCCTCATCAGCCAGAGGG - Intergenic
1160709450 19:544355-544377 TCCTCCCGGCAGCAGCCAGAAGG + Intronic
1161262437 19:3345344-3345366 TCCTCCCTGAAGCAGCCAGAGGG + Intergenic
1161273138 19:3401294-3401316 TCCTCCCTGCAGCAGGCAGAGGG - Intronic
1161518771 19:4711943-4711965 TCTCCTCTGGAGCCTCCAGAGGG + Intronic
1161597236 19:5156777-5156799 CCTTCCCTGCAGCTTCCAGACGG + Intergenic
1161605618 19:5213233-5213255 TCCTCCCTGCAGCAGCCAGAGGG + Intronic
1161608163 19:5226123-5226145 TCCTCCCCACAGCAGCCAGAGGG + Intronic
1161643565 19:5438583-5438605 GCTTGTCACCAGCAGCCAGATGG + Intergenic
1161644465 19:5444559-5444581 TCCTCTCTGAAGCAGCAAGAGGG + Intergenic
1161657141 19:5523275-5523297 TCCTCTCTTTGGCAGCCAGAGGG + Intergenic
1161874053 19:6893874-6893896 TCTTCCGTACAGCATCCAGAAGG - Intronic
1162451332 19:10756942-10756964 TCTGCCCTGCATCAGCCAGAGGG + Intronic
1163032611 19:14554201-14554223 TCTCTCCTGCAGCAGCCGGAGGG - Intronic
1164510305 19:28891095-28891117 TCTACTCTCCAGCAGCCACTGGG - Intergenic
1165223823 19:34339890-34339912 GCTTCTCTGCAGCAGGGACATGG - Exonic
1165949332 19:39465125-39465147 TATTCTCTGCAGCACAAAGAGGG - Intronic
1166882264 19:45936814-45936836 CCTTCTCTTCAGCACCCAGTAGG - Exonic
1167192469 19:48001020-48001042 TCTTCCCTACAGCCTCCAGAAGG - Intronic
1167758608 19:51428875-51428897 TCTCCTCTGGAGCCTCCAGAAGG + Intergenic
1168190676 19:54736333-54736355 TTTTCTCTCCAGCAGGCAGTGGG - Exonic
1168192900 19:54752728-54752750 TTTTCTCTCCAGCAGGCAGTGGG - Exonic
1168194989 19:54767556-54767578 TTTTCTCTCCAGCAGGCAGTGGG - Intronic
1168200815 19:54814196-54814218 TTTTCTCTGCAGCAGGCAGTGGG - Exonic
1168205593 19:54848263-54848285 TTTTCTCTCCAGCAGGCAGTGGG - Intronic
925449533 2:3956969-3956991 CCTGCTCTGCAGCAGCTGGAGGG - Intergenic
925672600 2:6327259-6327281 CATTCTGTGAAGCAGCCAGAAGG - Intergenic
927350727 2:22110505-22110527 CATTCTCTGCAGCAACCAGCAGG + Intergenic
927990867 2:27445981-27446003 TCTTCTTTGCTGCAGGCAGTTGG - Exonic
928320658 2:30280637-30280659 TTTTCCATGCAACAGCCAGAGGG + Intronic
929099871 2:38301525-38301547 TCCTCTCAGCAGCAACCACATGG + Intronic
929379938 2:41337594-41337616 TCTTCTCTGGAGCCTCCAGGAGG + Intergenic
929572828 2:43033438-43033460 TCTTTTCTGGAGCCTCCAGAAGG + Intergenic
932480031 2:72033498-72033520 CATTCCCTGCTGCAGCCAGAGGG + Intergenic
932709723 2:74053615-74053637 TCTTCCCTGAAGAAGCCACAGGG + Intronic
933165563 2:79070918-79070940 CCTTGTCTTCAGCAGCCACAAGG + Intergenic
933182952 2:79247890-79247912 TCTTCTCTGGAGCCTCTAGAAGG + Intronic
933429484 2:82157370-82157392 TTTTCCCTGGAGCATCCAGAAGG + Intergenic
934135839 2:88995634-88995656 TCTCCTCTGGAGCCTCCAGAAGG + Intergenic
934234476 2:90218141-90218163 TCTCCTCTGGAGCCTCCAGAAGG - Intergenic
935181029 2:100691409-100691431 TCTTCCCTGAGGCAGTCAGAGGG - Intergenic
935262554 2:101367899-101367921 TCTCCTCTGTAGCCTCCAGAAGG + Intronic
938894729 2:135738647-135738669 TCTTGTGTACAGAAGCCAGATGG - Intergenic
939711759 2:145530006-145530028 TCATCTCTGCAACATACAGATGG + Intergenic
940650402 2:156435841-156435863 TCTCCTCTCCCGCAGGCAGATGG + Intronic
941835538 2:170014045-170014067 CCTTATCAGCAGCAACCAGATGG + Intronic
942015929 2:171815192-171815214 TCTTCTCTGCAGCAGTCTCCTGG - Exonic
942045832 2:172099046-172099068 TGAGCTCTGCAGCAGCCTGAGGG - Intergenic
942084359 2:172429732-172429754 TCTTCTTAGCAGCTGACAGAGGG + Intronic
943158922 2:184221060-184221082 ACTTCTCAGCAGGAGCCAGAAGG - Intergenic
943169704 2:184382474-184382496 TCTTTCCTGCTGCTGCCAGAAGG + Intergenic
943356121 2:186858123-186858145 TCTTCTCTTTACCATCCAGATGG + Intergenic
944372035 2:198995706-198995728 TCTTCTCTGCTGTAGCTAAAAGG + Intergenic
944876877 2:203971424-203971446 TCTTCCCTGGAGCCTCCAGAAGG - Intergenic
946537843 2:220650809-220650831 TCTTCTCTGCAGTCACCATAGGG - Intergenic
946996389 2:225397085-225397107 TATTCTATACATCAGCCAGATGG - Intergenic
947528791 2:230895557-230895579 CTCTCTCTGCAGGAGCCAGAAGG - Intergenic
947738794 2:232475205-232475227 TCTTCTCTGCAGCCTCCATCAGG - Intergenic
948016310 2:234693480-234693502 CCTTCCATACAGCAGCCAGAGGG - Intergenic
948304369 2:236935734-236935756 TCTTCCCCACAGCAGCCACAAGG + Intergenic
948894686 2:240922622-240922644 TCTCCTCGGCAGCCTCCAGACGG - Exonic
1169453143 20:5729263-5729285 TCTTCTCTGGAGTCTCCAGAAGG + Intergenic
1169659968 20:7967690-7967712 TCTTCCCTGAAGCCTCCAGAAGG + Intergenic
1170708334 20:18766432-18766454 TCTTTTCTGATGCAGCCAGTGGG - Intergenic
1172628329 20:36361519-36361541 TCTTCTCTGCAGCAGCCAGAAGG - Intronic
1172901664 20:38339494-38339516 TAGTCTCCCCAGCAGCCAGAGGG - Intergenic
1172997526 20:39082340-39082362 TCTTCTCTAGAGCCTCCAGAAGG - Intergenic
1173000753 20:39103869-39103891 TCTTCCCTACAGCCTCCAGAGGG - Intergenic
1173231408 20:41201909-41201931 TGTCCTCTGAAGCAGCCAGGCGG + Intronic
1173921221 20:46746902-46746924 TCTTCCATGCAGCAGCCATAAGG + Intergenic
1174045388 20:47729388-47729410 TTTTCAATGCAGCAGCCAGAGGG - Intronic
1174095965 20:48089612-48089634 TCTTCTCGTCAGCATCCACAGGG + Intergenic
1174217984 20:48931928-48931950 TTTTCTCAACAGCAGCCAGAGGG - Intronic
1174295658 20:49543366-49543388 TCCTCCATCCAGCAGCCAGAGGG + Intronic
1174661074 20:52213744-52213766 TCTTCTCTAGAGCCTCCAGAAGG - Intergenic
1175170909 20:57080959-57080981 TATTCCTTGGAGCAGCCAGAAGG - Intergenic
1175418855 20:58818700-58818722 TCTTGTATGCAGCAGTAAGAAGG + Intergenic
1175516599 20:59574308-59574330 CCTTTTCTGCTCCAGCCAGAAGG + Intergenic
1175694134 20:61088620-61088642 ACTTCTCTGCAGCAGCCCAGGGG - Intergenic
1176447333 21:6831481-6831503 TCGGCCCCGCAGCAGCCAGAGGG - Intergenic
1176825501 21:13696507-13696529 TCGGCCCCGCAGCAGCCAGAGGG - Intergenic
1178047441 21:28711365-28711387 AATTCACTTCAGCAGCCAGAGGG - Intergenic
1179156785 21:38857907-38857929 TCTTCTCTGCAGGACACAGGAGG + Intergenic
1179179809 21:39035745-39035767 TCTTGGCTGGAGCAGCCAAAAGG - Intergenic
1179805627 21:43835341-43835363 TCTCCTCTGCAGAAGACAGATGG - Intergenic
1179879915 21:44289184-44289206 TCTTCCCTGGAGCCTCCAGAGGG - Intronic
1181145144 22:20840477-20840499 TTTTCTGTGTATCAGCCAGAGGG - Intronic
1181428564 22:22861126-22861148 TTTTCTCAGCAGCACCAAGAAGG - Intronic
1181461870 22:23090449-23090471 GCTTCAGCGCAGCAGCCAGAGGG + Intronic
1182112636 22:27734274-27734296 GTTGCTCTGCAGCTGCCAGAAGG - Intergenic
1182178816 22:28322831-28322853 TCTTCTCTGGAGGATCCAGAAGG - Intronic
1183943248 22:41308619-41308641 TCCTCCCTGCAGTAGCCAAAAGG + Intronic
1184011759 22:41754003-41754025 TCTTCTCTGGAGCTGAGAGAAGG - Exonic
1184241711 22:43214456-43214478 TCTGAGGTGCAGCAGCCAGAGGG - Intronic
1185131604 22:49042608-49042630 CCTACTTTTCAGCAGCCAGAAGG - Intergenic
949571514 3:5298025-5298047 ACATCTGAGCAGCAGCCAGAAGG - Intergenic
949864378 3:8535353-8535375 TATTCCCTGCAGCACCCTGAGGG + Intronic
949903627 3:8839994-8840016 TCTTCTCTGTCGGAGACAGATGG + Intronic
950240212 3:11362906-11362928 TCTGTTTTGCAGCATCCAGAAGG + Exonic
951051367 3:18097625-18097647 TCTTCCCTAGAGCATCCAGAAGG - Intronic
951856301 3:27200906-27200928 TTTTCTCTGCTCCAGCCACATGG - Intronic
952386882 3:32848385-32848407 TCTTGTCTGCAGAAGTCAGCTGG + Intronic
953025762 3:39144004-39144026 CCCTCCCTGCAGCAGCCACAGGG + Exonic
953605540 3:44411015-44411037 TCCTGCCTGCAGCAGGCAGAAGG - Intergenic
954709746 3:52499574-52499596 TTCTCCATGCAGCAGCCAGAGGG + Intronic
954894143 3:53961405-53961427 TCTCCTCTGGAGCCCCCAGAAGG + Intergenic
955004454 3:54955916-54955938 TTTTCTCTTCATCAGGCAGATGG - Intronic
955325603 3:58007709-58007731 TCTTCCCTACAGCCTCCAGAAGG + Intergenic
956533088 3:70243145-70243167 TCTTGTCTGCAGAAGACAAAAGG - Intergenic
956984703 3:74685265-74685287 TCTTCTCTGAGGCCTCCAGAAGG + Intergenic
959270346 3:104200184-104200206 TCTTCTCTGGAGTCTCCAGATGG + Intergenic
959776225 3:110167091-110167113 TTTTCTTCTCAGCAGCCAGAGGG - Intergenic
960817878 3:121691833-121691855 TATTCTCTGCAGCAGCCTCTTGG + Exonic
961448162 3:126990804-126990826 TTTTCTCTGCACCATACAGATGG + Intronic
961644275 3:128384315-128384337 TTTCCCCTGCAGCAGCCTGATGG + Intronic
961678239 3:128581328-128581350 TCATCTCTGCACCAGCCTGAAGG + Intergenic
962374322 3:134847525-134847547 TCTTCCCTGCAGCCACCAGAAGG - Intronic
962599986 3:136984371-136984393 CCTCCACTCCAGCAGCCAGATGG - Intronic
963005178 3:140720423-140720445 TGTTCTCTGGAGCTGGCAGATGG - Intergenic
964298037 3:155255420-155255442 TATTCTATGAAGCAGACAGAGGG - Intergenic
965468254 3:169059258-169059280 TCTTAGCTCCTGCAGCCAGAGGG + Intergenic
965813375 3:172614111-172614133 TCATCTCTGCAGCTGTCAGCAGG + Intergenic
966421305 3:179737126-179737148 TCTTCTCTTTAGCAGCTAGTAGG + Intronic
966951404 3:184821784-184821806 TCTTTTCTGCAGAAGCGAGCTGG + Intronic
967829785 3:193909214-193909236 ACCTCCCTGCAGCAGCCAGTGGG - Intergenic
967969388 3:194987959-194987981 TCTTCTCTACATCAGACACACGG + Intergenic
967983964 3:195081802-195081824 TGTGGTCTGCAGCAGCCAGTGGG + Intronic
968054144 3:195678192-195678214 TCATGTCTTCTGCAGCCAGACGG - Intergenic
968101746 3:195970950-195970972 TCATGTCTTCCGCAGCCAGACGG + Intergenic
968751816 4:2393982-2394004 TCTTCCCTGGAGCCTCCAGAAGG - Intronic
968789243 4:2648048-2648070 TGTTCTCTACTGCAGCCACAGGG + Intronic
969127611 4:4964407-4964429 TCTCCTCTACAGCATCTAGAAGG + Intergenic
969326900 4:6449315-6449337 TGTTCTCTGCAGCTGCCGCAGGG - Intronic
969450648 4:7271168-7271190 TGTGCCCAGCAGCAGCCAGAAGG + Intronic
969843550 4:9901498-9901520 TTTTGTCTACAGCAGTCAGAGGG + Intronic
970418514 4:15882786-15882808 TCTGCTCTTCAGCCACCAGAGGG + Intergenic
970432791 4:16004274-16004296 TCATCTCAGCAGCAGGAAGAAGG - Intronic
970476699 4:16430930-16430952 TCTTCTCTAGAGCGGCTAGAGGG - Intergenic
970873395 4:20842372-20842394 TTTACTCTGCTCCAGCCAGAAGG - Intronic
971216752 4:24669143-24669165 TCTTCTTTCAAGCTGCCAGATGG - Intergenic
971572210 4:28227875-28227897 TCTGCTCTTAAGCAGCCAGGAGG + Intergenic
974168686 4:58238107-58238129 TCTTCTATGCAGAAGCTGGAAGG - Intergenic
974826781 4:67141391-67141413 TCTTGTCTGCAGGAGCAAAAAGG - Intergenic
975024642 4:69533063-69533085 TTTTCTCTGCTGCTGGCAGATGG - Intergenic
975293860 4:72709335-72709357 ACTTTTCTCCAGCAGCCAGGAGG - Intergenic
975516242 4:75251455-75251477 TCTTCACTGCGGCACACAGATGG - Intergenic
975580290 4:75901156-75901178 TCTTCTCTTAAGCAGCCATATGG - Intronic
976361581 4:84185049-84185071 TCTTCTCTGATGGAGGCAGAAGG + Intergenic
976442899 4:85096664-85096686 TCTTCTTTTCAGCAACCAAAGGG - Intergenic
976661499 4:87545042-87545064 TCATATCTCCAGCAGCCAGCTGG - Intergenic
977258464 4:94767067-94767089 TCTTCTAGCCAGAAGCCAGATGG + Intronic
978964800 4:114727428-114727450 TATTCTCTGAAACAGCTAGAAGG - Intergenic
979320341 4:119315945-119315967 TTTTCTACACAGCAGCCAGAAGG - Intergenic
979888965 4:126065593-126065615 TCTTCTCTTCAGTAGACAAAGGG - Intergenic
982177703 4:152721841-152721863 TTTTCTATCCAGCAGCAAGATGG - Intronic
983955929 4:173698743-173698765 TCTTCTCTGCGGAACCCAGTGGG - Intergenic
985134468 4:186771764-186771786 TCTCCTCTGCAGCCTCCAGAAGG + Intergenic
985238492 4:187902868-187902890 TCTTCTCTCCAGCAGCGGGCAGG + Intergenic
985639478 5:1056998-1057020 GCCTCACTGCAGCAGGCAGATGG - Intronic
985704572 5:1392931-1392953 TGCTGACTGCAGCAGCCAGAAGG + Exonic
985728265 5:1526855-1526877 CCTTCTCTGCTGCAGCTGGAAGG + Intergenic
986519501 5:8598935-8598957 TCTCCTCTGCAGCTTTCAGAAGG + Intergenic
987316435 5:16728941-16728963 TCTTTTAAGCAGCAGCAAGAAGG + Intronic
988250826 5:28755674-28755696 AATTCTCTGCAGCACCCAGATGG - Intergenic
988268765 5:28986797-28986819 TCTTCTCTCCTGTAGCCACAGGG - Intergenic
988327631 5:29790443-29790465 TTTTCTTTGCAGAAACCAGATGG + Intergenic
990167522 5:53011044-53011066 TCTTCTCTGGAGCCTGCAGAGGG + Intronic
992212183 5:74491762-74491784 TCATCTTTCCAGCTGCCAGATGG + Intergenic
993878347 5:93335624-93335646 TCTCCTCTGCAGCCTCTAGAAGG - Intergenic
995181773 5:109236455-109236477 CCTTCACAGCAGCACCCAGATGG - Intergenic
995538573 5:113162075-113162097 TGTTCTCTGAAGCAGTCAGCAGG - Intronic
995859021 5:116622577-116622599 TCATTTCTGCTGCAGACAGATGG - Intergenic
996210747 5:120806359-120806381 TATTTTAAGCAGCAGCCAGATGG - Intergenic
996599768 5:125249159-125249181 GCTTCTCTGCAGCATACTGACGG - Intergenic
996831498 5:127745137-127745159 TCCTGTCTGCAGAAGACAGATGG - Intergenic
997120571 5:131168617-131168639 TCTTCCCTAGAGCATCCAGAAGG - Intronic
997422908 5:133783293-133783315 CCTGCTCTTCAGAAGCCAGAAGG + Intergenic
997640430 5:135445337-135445359 TCTGCGCTGCCCCAGCCAGAGGG + Exonic
998525744 5:142841729-142841751 TCTACTTTGCTCCAGCCAGAGGG - Intronic
999210652 5:149885798-149885820 TCTCCTCTGGAGCTTCCAGAAGG - Intronic
999386161 5:151155898-151155920 TCCGCACTGCAGCATCCAGAGGG - Intronic
1000145236 5:158447293-158447315 TCTAGTCTGCAGCTCCCAGAAGG - Intergenic
1001236514 5:170034384-170034406 TGGTCTCTGCCGCAGCCTGATGG + Exonic
1001597449 5:172907194-172907216 TCTTCCTTGCAGCAGCCAGAGGG + Intronic
1002578852 5:180195047-180195069 TGTTCTCTGCAGCAGGCACTGGG - Intronic
1002617204 5:180463389-180463411 TCTCCTCTGGAGCCTCCAGAGGG + Intergenic
1002953452 6:1839191-1839213 TTTGCTCCGCAACAGCCAGAGGG + Intronic
1004054360 6:12120587-12120609 TCTTCTGAGCAGCAGACATATGG - Exonic
1004158092 6:13188694-13188716 TCTTCTGTTCATCAGCCAGGTGG + Intronic
1004436023 6:15595034-15595056 TCTTCACAGCAGCAGACAGACGG - Intronic
1004442926 6:15671121-15671143 TCTTCACTGCAGCCTCCAGGTGG - Intergenic
1005123970 6:22424356-22424378 TCTTTTCTGCAGCAGCCTCCGGG + Intergenic
1005700042 6:28391562-28391584 TCTTCTCTGGAGCAAGCAGAGGG + Exonic
1005714690 6:28535517-28535539 TCTTCTCATCATCAACCAGACGG - Intergenic
1006010674 6:31040447-31040469 TCTTCTCTAGAGCCTCCAGAAGG + Intergenic
1006499934 6:34451799-34451821 TCTTCCCTGGAGCTGTCAGAAGG - Intergenic
1007336344 6:41157613-41157635 TCTTAAATGCAGAAGCCAGAAGG - Intergenic
1007717705 6:43866791-43866813 TCTTCTCTGTAGCAGCTGGAAGG - Intergenic
1008076337 6:47149745-47149767 TCTTATCTGCAGCCCCAAGATGG - Intergenic
1008132437 6:47734083-47734105 TCTTCCCTGGAGCATCCAGAAGG + Intergenic
1011494286 6:87923243-87923265 TCTGCTCTGAGGCATCCAGATGG - Intergenic
1011753315 6:90474922-90474944 TCTCCTCTGGAGCCTCCAGAAGG - Intergenic
1012582142 6:100881753-100881775 TATACTCTCTAGCAGCCAGAGGG - Intergenic
1013855024 6:114562392-114562414 TCTTCTCTGAAGTACACAGAGGG + Intergenic
1016469949 6:144364750-144364772 TCTCCTCTGGAGCTTCCAGAAGG - Intronic
1018508221 6:164494292-164494314 TCTCCCCTGCAGCCTCCAGAAGG + Intergenic
1019503471 7:1377495-1377517 TCCTCCCTGCAGCCTCCAGAAGG - Intergenic
1020023392 7:4882744-4882766 TCTCCTCTCCAGCAGCTAGCAGG - Intronic
1020253755 7:6489797-6489819 TCTTCTTATTAGCAGCCAGAAGG + Intergenic
1021154790 7:17196532-17196554 TGTTCCCTGCTTCAGCCAGAGGG + Intergenic
1021452697 7:20797727-20797749 TTGTCTGTGCAGCAGTCAGAGGG + Intergenic
1021852053 7:24817942-24817964 TCCTCAGTGCAGCAGCCAGATGG - Intronic
1022368482 7:29748396-29748418 TGTTATATACAGCAGCCAGAAGG + Intergenic
1022828238 7:34038395-34038417 TCTTCTCTAGAGCCTCCAGAAGG + Intronic
1023321306 7:39000777-39000799 TCTTCTCTGCCCCATGCAGAGGG + Intronic
1023981236 7:45071652-45071674 TCTTCTCTGGAGCCTCCAGAAGG - Intronic
1024136529 7:46414630-46414652 TATTCTTTTCAGCAGCCTGAAGG + Intergenic
1024292114 7:47812263-47812285 TCTTCCCTGCAGCAGCCCAGGGG + Intronic
1024461826 7:49667330-49667352 TCTTCTCTGGAGCCTCCAGAAGG + Intergenic
1024983497 7:55177118-55177140 TCATGTCTGCTGCAGTCAGAGGG + Intronic
1026593970 7:71718757-71718779 TCTTGTCTTCAGCCTCCAGAGGG - Intergenic
1026890287 7:73977672-73977694 TCAGGTCTGCAGCAGCCAGGTGG - Intergenic
1027356169 7:77357762-77357784 TCTTCCCTGGAGCCTCCAGAAGG + Intronic
1028214800 7:88118335-88118357 CCTTCTCTCCTGCTGCCAGAGGG + Intronic
1028837405 7:95390068-95390090 TGTCCTCTGGAGCTGCCAGATGG - Intronic
1029202668 7:98849457-98849479 TCTTCTCTGCAGAATTCAGGGGG + Intronic
1029344382 7:99967751-99967773 CCTTCTCTCCACCACCCAGATGG + Intronic
1029347107 7:99986729-99986751 CCTTCTCTCCACCACCCAGATGG - Intergenic
1031313521 7:120229793-120229815 ACTTATCTTCTGCAGCCAGAGGG + Intergenic
1031941538 7:127794584-127794606 TTTTCTCTGTAACAGACAGAAGG - Intronic
1031987585 7:128173125-128173147 ACTTCTCAGCAGTAACCAGAGGG + Intergenic
1032152701 7:129443795-129443817 TCTCTGCTGCAGCAGCCAGCTGG + Intronic
1032171442 7:129587860-129587882 TCTTCCCTGGAGTAGTCAGAAGG - Intergenic
1032322096 7:130894869-130894891 CATTCTCTGCACCAGCCAGCGGG - Intergenic
1032401931 7:131629790-131629812 TCTGCTCTGCAGCATACAGTAGG - Intergenic
1033671789 7:143500148-143500170 TTTCCTCTGAAGCTGCCAGAAGG + Intergenic
1034030993 7:147763482-147763504 TCTTCTTTGCAACTGTCAGAAGG - Intronic
1034201595 7:149286036-149286058 TCCCCTCAGCAGCAGCCAGAAGG - Intronic
1034551004 7:151820616-151820638 TGTGCCCTGCAGTAGCCAGAGGG - Intronic
1035373395 7:158393038-158393060 CCTTCTCTGCAGCAGGCACAGGG - Intronic
1035708633 8:1695960-1695982 TCTTCTCTGCAGCCACACGAGGG - Intronic
1036796481 8:11759820-11759842 TATTCTCTGCTACAGCCAGTAGG - Exonic
1037258382 8:16980223-16980245 TCTGGTCTGCAGCATCCAGTGGG - Intergenic
1038201880 8:25420549-25420571 ACTTATCTGCAGCAATCAGAAGG - Intronic
1040756944 8:50788004-50788026 TTTTTTCTGCAGCAGCCTTAGGG - Intronic
1041814419 8:61952053-61952075 TCTTCTCTGCAGCTTACTGAAGG - Intergenic
1041862620 8:62531636-62531658 TCTACTCTGCACCAGACAGTCGG - Intronic
1043674450 8:82933593-82933615 TCCACTCTGAAGCAGACAGAAGG + Intergenic
1044237839 8:89852416-89852438 TCTTCCCTGGAGCCTCCAGAAGG - Intergenic
1044421284 8:91998594-91998616 CCTTCCCTCCAGCAGCGAGAAGG + Intronic
1045346430 8:101297861-101297883 TCTTCACTGGAGCCTCCAGAAGG + Intergenic
1045382752 8:101643605-101643627 TCTCATCTGCTGCGGCCAGAGGG + Intronic
1046311919 8:112448577-112448599 TCTTCTCTACAGCCTTCAGAGGG + Intronic
1047054762 8:121151727-121151749 TCTTCCCTGGAGCCTCCAGAAGG - Intergenic
1047306193 8:123654915-123654937 TCTTCTCTGGAGCAGCCCCTGGG + Intergenic
1047387576 8:124424337-124424359 TCTCCTCTGAAGCATTCAGAAGG - Intergenic
1047407168 8:124595401-124595423 TCTCCCCTGCAGCCTCCAGAAGG - Intronic
1047577475 8:126173219-126173241 TGTTCTCTGAAGCATTCAGAGGG + Intergenic
1047794429 8:128239691-128239713 TATTCTCAGCAGCAGCCATCAGG + Intergenic
1048340700 8:133536566-133536588 ATGTCTCTGCTGCAGCCAGACGG + Intronic
1048700296 8:137080679-137080701 TCTTAGCAGCAGCAGCCAGCAGG - Intergenic
1048846011 8:138604291-138604313 TCTTCTACCCAGCAGACAGAGGG - Intronic
1048902089 8:139048639-139048661 TCTTCTCTAGAGCCTCCAGAAGG + Intergenic
1049085464 8:140474963-140474985 TCTCCTCTGCAGCATCCACCAGG + Intergenic
1049129848 8:140828699-140828721 TCCTCACTGCAGCACCCAGCAGG + Intronic
1049775447 8:144401789-144401811 CCCTCTCTGCAGCAGGGAGAAGG + Intronic
1050073082 9:1836929-1836951 TTTACTCTGAAACAGCCAGAGGG - Intergenic
1050161872 9:2727537-2727559 TATTCTCTACTGGAGCCAGAGGG + Intronic
1050333092 9:4564794-4564816 TCTTATCTAAAGCAACCAGAGGG + Intronic
1051305545 9:15704927-15704949 TTTTCTCTGTAGCTACCAGAAGG + Intronic
1051848858 9:21485743-21485765 TCATGTTTCCAGCAGCCAGAGGG - Intergenic
1052764527 9:32627154-32627176 TCTCCTCTGGAGCCTCCAGAAGG - Intergenic
1053446579 9:38157824-38157846 TCTCCTCTGCAGCATCCTGAGGG - Intergenic
1053458671 9:38251453-38251475 TCTTCCCTAAAGCAGACAGATGG - Intergenic
1056498999 9:87189720-87189742 ACTTTTATGCAGCACCCAGATGG - Intergenic
1056798930 9:89677995-89678017 TGTTCTCTGGAGCAGGCAGCAGG + Intergenic
1056817494 9:89812151-89812173 TGTGCGCTGCAGGAGCCAGACGG + Intergenic
1056824051 9:89864559-89864581 CCTTCCCTGAAGAAGCCAGAGGG - Intergenic
1057179781 9:93023465-93023487 TCTGCTCTGCAGAGGCCAGGTGG - Intronic
1057372887 9:94490070-94490092 TCCTCTCTGGAGCCTCCAGAAGG + Intergenic
1058801228 9:108546106-108546128 TCTTCTCTCTAGTAACCAGAAGG - Intergenic
1059155914 9:111988171-111988193 CCTTCTCTTCAGAAGCTAGAAGG - Intergenic
1059482937 9:114606146-114606168 TCTTCTCCACAGCCGCTAGAGGG + Intergenic
1059663702 9:116425964-116425986 TCTTTTCTGCCGCAGCGAGGAGG - Exonic
1059678962 9:116567597-116567619 TCTTCCATGCTACAGCCAGAAGG - Intronic
1059871563 9:118584027-118584049 GCTTATCTCCAGCAGGCAGATGG - Intergenic
1060279375 9:122205776-122205798 TATTCTCTGCAGCAACCCTACGG + Intronic
1060497487 9:124129303-124129325 CCTGCTCTGCAGCAGAAAGAGGG + Intergenic
1061117740 9:128625358-128625380 GCATCTCTGCAGCAGCCTGCTGG + Intronic
1062514622 9:136926381-136926403 CCTTCTCTCCAGGGGCCAGAGGG - Exonic
1062647077 9:137553487-137553509 TCATCACTGCAGCACCCACACGG - Intergenic
1062678471 9:137762724-137762746 GCCTCTCTGCAGCTGCCGGATGG + Exonic
1203521857 Un_GL000213v1:53050-53072 TCGGCCCCGCAGCAGCCAGAGGG + Intergenic
1185463249 X:341882-341904 TCTTCTCAGGAGCAGTCACACGG - Exonic
1185513104 X:677692-677714 TCTTGTCTGCACCAGAAAGATGG + Intergenic
1185889552 X:3812189-3812211 TCCTCTACGTAGCAGCCAGATGG - Intergenic
1186365814 X:8892173-8892195 TCTCCTCTGGAGCATCCAGAAGG + Intergenic
1189120893 X:38393839-38393861 TCTCCTCTGGAGCCTCCAGAAGG - Intronic
1189203399 X:39217105-39217127 TCTCCTCTGGAGCCACCAGAGGG + Intergenic
1189264320 X:39702072-39702094 TCTTCTGTGGAGCTTCCAGAAGG + Intergenic
1190234628 X:48606149-48606171 TGTCCCCTTCAGCAGCCAGAGGG - Exonic
1190339191 X:49282877-49282899 TTTTCCAAGCAGCAGCCAGAGGG - Intronic
1190783005 X:53616446-53616468 TCTTAACTGGAGCAGCCAGAGGG - Intronic
1192142668 X:68658999-68659021 TCTTCTCTCCAGCTCCCAGAAGG - Intronic
1192617555 X:72643521-72643543 TCTTCCCTGGAGCCTCCAGAAGG - Intronic
1193039295 X:76987641-76987663 TCTCCCCTGCTGGAGCCAGAGGG + Intergenic
1194973338 X:100368332-100368354 TCTTTCCTGCAGCAGCCTGTAGG + Intronic
1195068733 X:101260097-101260119 TCCTCTCCACAGCAGTCAGAAGG + Exonic
1195687425 X:107599496-107599518 TCCTCTCTCCAGCAGCCACGTGG - Intronic
1197742462 X:129905836-129905858 TCGTCACTGCAGAATCCAGAAGG - Intergenic
1198522768 X:137469665-137469687 TCTTCTCTGCTACAGCCACAGGG - Intergenic
1199182566 X:144876015-144876037 TCTCCTCTGCAAGAGCCAGAAGG + Intergenic
1199241593 X:145553960-145553982 TGTTCCCTGCAGGGGCCAGAGGG - Intergenic
1199671995 X:150155369-150155391 TCTTCTTTGCAGCAGCATGCAGG + Intergenic
1199808223 X:151323350-151323372 TCTTCAGTGCAGGAGCAAGAAGG - Intergenic
1199843042 X:151670203-151670225 TCTTCTGCACAGCTGCCAGAAGG + Intronic
1199862709 X:151816225-151816247 TCTGCTCAGCAGCAGGCAGGTGG - Intergenic
1201239005 Y:11940155-11940177 TCTTCCCTTCAGCAACCACATGG + Intergenic
1201239463 Y:11944719-11944741 TCTTTTCTGCATCCTCCAGAAGG - Intergenic