ID: 1172628512

View in Genome Browser
Species Human (GRCh38)
Location 20:36362704-36362726
Sequence GACACTTTAGTGAGAGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172628505_1172628512 30 Left 1172628505 20:36362651-36362673 CCAGGTACAGCGTGTGGCAATGA 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1172628512 20:36362704-36362726 GACACTTTAGTGAGAGGAGCAGG 0: 1
1: 0
2: 2
3: 11
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172628512 Original CRISPR GACACTTTAGTGAGAGGAGC AGG Intronic
902816039 1:18917322-18917344 CACAGTTTGGGGAGAGGAGCAGG + Intronic
903346067 1:22685139-22685161 GACACTTGGGTGAGATAAGCAGG - Intergenic
905127893 1:35728646-35728668 GGCAGGTTAGTGAGAGGTGCAGG - Intronic
905478605 1:38246090-38246112 GACACTTTGCTGAATGGAGCTGG + Intergenic
906111277 1:43323646-43323668 GACACGTTAGTGATGGAAGCTGG - Intergenic
910581641 1:88833385-88833407 GATACTTTCGGAAGAGGAGCAGG + Exonic
911790239 1:102005777-102005799 GACACTATAGTAAGATGATCTGG + Intergenic
919871452 1:201824866-201824888 GAAACTCTAATGAGAGGACCCGG + Exonic
922239458 1:223746093-223746115 GTCACTTTAATGGAAGGAGCCGG - Intronic
1062792462 10:317434-317456 GACACTTTAGAGAGAGGGCGTGG + Intronic
1063586219 10:7355219-7355241 GACACTTTAGAAAGAGTAGGAGG - Intronic
1063594861 10:7425120-7425142 AACACTTGAGTGAGAGGCGAGGG + Intergenic
1064249155 10:13693633-13693655 GACACTTAAGTGTGACCAGCAGG + Intronic
1067234784 10:44438358-44438380 GTCACTTTGGTGAGAGGATGAGG + Intergenic
1067324965 10:45258909-45258931 GACAATGAGGTGAGAGGAGCAGG - Intergenic
1071883944 10:89929366-89929388 GACACTTTTGAGAGTGGAACAGG + Intergenic
1072890445 10:99318976-99318998 GACAGTTTAGGGAGAGGAAAAGG - Intergenic
1073302858 10:102481463-102481485 GACACCTTAGTGATAGGTGAAGG - Intronic
1075371147 10:121936124-121936146 GAAACTATAGGGAAAGGAGCAGG - Intergenic
1075410284 10:122222688-122222710 GACACTTTAGTGAGGCGAGCTGG + Intronic
1076257996 10:129043984-129044006 AACTCCTTAGGGAGAGGAGCCGG + Intergenic
1077906020 11:6534091-6534113 GACGCTCTAGGGAGACGAGCTGG - Exonic
1079647791 11:22888992-22889014 TACAGTTTAATGAGTGGAGCAGG - Intergenic
1082943410 11:58732733-58732755 GACACTCTAATCAGAGGAGCAGG + Intergenic
1085696513 11:78709427-78709449 GACAGTCTAGTGAATGGAGCAGG - Intronic
1087594375 11:100235343-100235365 GAAACTATAGGGAAAGGAGCAGG + Intronic
1087594581 11:100236765-100236787 GAAACTATAGGGAAAGGAGCAGG - Intronic
1087990441 11:104741728-104741750 AACACTGTAGGGAGAGGTGCTGG + Intergenic
1089482404 11:118817261-118817283 GACACTTTAAATATAGGAGCTGG + Intergenic
1090492848 11:127180372-127180394 GACACTATAGTAAGGGGAGGGGG - Intergenic
1092319692 12:7459395-7459417 GACACGTTGGTCAGAGGAACAGG + Intronic
1095172023 12:39047407-39047429 GATACTTTAGCGAGAGCAGCTGG + Intergenic
1096620048 12:52858785-52858807 GCCAGTTCAGTGAGGGGAGCGGG - Intergenic
1100041559 12:90325421-90325443 GACACGTTAATGAGATGAGTGGG - Intergenic
1103452086 12:121036304-121036326 GAAAATCTAGTGAGCGGAGCTGG - Intronic
1103891450 12:124241968-124241990 GGCACTTCGGTGAGAGCAGCAGG + Intronic
1108428222 13:50326649-50326671 AGCACTGTAGGGAGAGGAGCGGG + Intronic
1109129421 13:58562865-58562887 GACACTTTAGTGAAAGTATGGGG + Intergenic
1109157339 13:58927174-58927196 GACACTCCAGTGAGAGAAGAGGG - Intergenic
1112557245 13:100479906-100479928 GCCACTTTTGTTAGAGGAGAAGG + Intronic
1115243211 14:31269880-31269902 TACACTGTAGTGATAGCAGCAGG + Intergenic
1117276532 14:54199799-54199821 AACACATAAGTGAGTGGAGCAGG - Intergenic
1117448620 14:55828975-55828997 GACACTGAACTGAGAGGAGGCGG + Intergenic
1122485481 14:102076794-102076816 GACAATTTCGTGAAAGGAGAAGG + Intergenic
1123173428 14:106396136-106396158 CACACTTTAGTGTCAGGAGAAGG + Intergenic
1126196895 15:45941736-45941758 GACTCTTTGGAGAGAGCAGCAGG + Intergenic
1129371996 15:75103095-75103117 GCTACTTTAGTGGGAGGATCAGG - Intronic
1132378526 15:101348912-101348934 GCGACTTGAGTGAGAGGAGCAGG - Intronic
1138356296 16:56383688-56383710 GACACTTTTGTAAGATGAGCTGG - Intronic
1139862934 16:70040309-70040331 GACACTGTAGAGATCGGAGCAGG + Intergenic
1141194721 16:81851902-81851924 GACAATTAAGTTAGAGGAGAGGG - Intronic
1141830614 16:86508322-86508344 GGCACGTCGGTGAGAGGAGCTGG - Intergenic
1142215385 16:88827204-88827226 GCCCCTTAAGTCAGAGGAGCAGG + Intronic
1143031588 17:3971016-3971038 CAAATTTTAGGGAGAGGAGCCGG - Intergenic
1143386502 17:6534273-6534295 GCCACCTTAGCCAGAGGAGCTGG + Intronic
1147369507 17:39981701-39981723 GACACTTCAGTTAGAGAAGTAGG - Intronic
1153092076 18:1358474-1358496 TGCTCTTTAGTGAGAGAAGCTGG + Intergenic
1155899897 18:31376285-31376307 GACATTTTAAAGAGAGAAGCAGG + Intergenic
1156040367 18:32814078-32814100 GATATATTGGTGAGAGGAGCTGG + Intergenic
1158160741 18:54480515-54480537 GACATTCAAGTGAGAGGACCTGG - Intergenic
1166496813 19:43309063-43309085 AACAATTTTGTGAGAGTAGCAGG + Intergenic
1168150463 19:54444757-54444779 GACACTTGAGTGAGTGGACGGGG + Intergenic
931720539 2:65064388-65064410 CACCCTTTAGTGAGAGGTGTGGG + Intronic
934747410 2:96768636-96768658 GACAGTTTAGTGAGGGCAGAGGG + Intronic
935553416 2:104481710-104481732 GACACTGTAGTGAGAGATGATGG + Intergenic
936037103 2:109121849-109121871 GACACATAAGTTAGAGGTGCTGG - Intergenic
937632451 2:124118698-124118720 GACACGTAAGGGAGAGGAGGAGG + Intronic
942620793 2:177843433-177843455 GAGACTTTAGTCACAGGAACAGG + Intronic
946471529 2:219965189-219965211 GAAACTTTAGTTAGAGCATCAGG + Intergenic
947690295 2:232129180-232129202 GACACTGCAGTGAGAGGACTGGG - Intronic
947835001 2:233169032-233169054 GTCACTTTAGAGAGAGATGCCGG + Intronic
1169701573 20:8453215-8453237 GACACTTTGGTGATATGAGGAGG - Intronic
1170528876 20:17269036-17269058 GACAAGATGGTGAGAGGAGCAGG + Intronic
1172385281 20:34529870-34529892 GACACTGTGGAGACAGGAGCAGG + Intronic
1172628512 20:36362704-36362726 GACACTTTAGTGAGAGGAGCAGG + Intronic
1174308595 20:49632648-49632670 GACACTTGAGTGAGGGGACTTGG - Intergenic
1180819508 22:18816312-18816334 GAGACTAGAGAGAGAGGAGCAGG - Intergenic
1181205734 22:21250757-21250779 GAGACTAGAGAGAGAGGAGCAGG - Intergenic
1181508626 22:23378844-23378866 CACACTTTAGTGAGAATTGCTGG + Intergenic
1181516777 22:23418686-23418708 GGCACATGGGTGAGAGGAGCTGG - Intergenic
1183122634 22:35742081-35742103 AATATTTTAGTTAGAGGAGCGGG - Intronic
1203221187 22_KI270731v1_random:44656-44678 GAGACTAGAGAGAGAGGAGCAGG + Intergenic
1203269638 22_KI270734v1_random:42165-42187 GAGACTAGAGAGAGAGGAGCAGG - Intergenic
950421383 3:12901681-12901703 TGCACTGTAGTGAGAGGAGGCGG - Intronic
951104367 3:18725800-18725822 GACACTTAAAAGAGAGCAGCTGG - Intergenic
952181615 3:30922377-30922399 GACACATGAGTGAGACCAGCAGG - Intergenic
952564491 3:34638538-34638560 GACAAGTGAATGAGAGGAGCAGG - Intergenic
954438305 3:50507740-50507762 GGCACATTAGGGAGAGGAGGAGG + Intergenic
954735004 3:52699991-52700013 GACACTCTAGTGACTAGAGCAGG + Intronic
954899031 3:54003317-54003339 GACACCCAAGTAAGAGGAGCTGG - Intergenic
957546792 3:81649120-81649142 GAAAATTTAGTGAGTGTAGCTGG - Intronic
961094501 3:124142856-124142878 GGCACTTTTGTGGGAGGAGGAGG - Intronic
963934463 3:151037980-151038002 GGAACTTTATGGAGAGGAGCAGG - Intergenic
965562931 3:170078856-170078878 GAAACTGTAGGGAAAGGAGCAGG + Intronic
969188846 4:5500820-5500842 GTCACAGTAGGGAGAGGAGCAGG - Exonic
970167388 4:13253510-13253532 GACTCTTTATTGAGATGTGCTGG + Intergenic
971143941 4:23956221-23956243 TACATTAAAGTGAGAGGAGCAGG - Intergenic
972061780 4:34883263-34883285 GACACACTAGTGTGAGGAGTGGG + Intergenic
974287020 4:59881981-59882003 GAAACTATAGGGAAAGGAGCAGG - Intergenic
975220818 4:71810328-71810350 GAAACTATAGGGAAAGGAGCAGG - Intergenic
977130420 4:93228837-93228859 AACACTTTAGTGAGAGGATCAGG + Intronic
977924418 4:102683969-102683991 GACACTTGAGAGAGAGGAAAGGG - Intronic
978045862 4:104126385-104126407 AACATTTTAGAGAGAGAAGCTGG + Intergenic
978553221 4:109950239-109950261 GACACTAGAGGGAGAGGAGCTGG - Intronic
980181540 4:129407347-129407369 GAGACTTTCTGGAGAGGAGCAGG + Intergenic
982087929 4:151855125-151855147 GACAGTTTAGTGAGAGGCGATGG + Intergenic
984717897 4:182943182-182943204 GACTGTTTAGAGAGAGGATCGGG - Intergenic
986407049 5:7436802-7436824 GACACTTTTGTGATGGGAGTGGG + Intronic
986888228 5:12266640-12266662 GACACTTTAGTCACAAAAGCTGG - Intergenic
987126724 5:14819799-14819821 GAGGCTATAGTGAGAGGAGATGG + Intronic
989724665 5:44574178-44574200 GACACTTTAGGGAGAGGTGAAGG + Intergenic
990889564 5:60633268-60633290 CACACTTTAACAAGAGGAGCTGG + Intronic
991213829 5:64137866-64137888 GTCACTTTAGCTAGAGGAGGAGG - Intergenic
993908872 5:93655980-93656002 TACATTTTAGTCAGAGGAGAGGG - Intronic
996835574 5:127788124-127788146 GACACTTTTGTGAGAATAGTTGG - Intergenic
998178680 5:139919361-139919383 GATACTCTAGAGAGAGGAGGTGG + Intronic
998616286 5:143744211-143744233 CACATTCTAGAGAGAGGAGCTGG + Intergenic
999023872 5:148202799-148202821 GAAACTTTAGAAAGAAGAGCCGG + Intronic
999327760 5:150653666-150653688 CACAGTTTAGGGAGAGGAGCTGG - Exonic
999682125 5:154070248-154070270 GAAACTATAGGGAAAGGAGCAGG - Intronic
999691684 5:154151832-154151854 GACCCTGTAGTGAGAGGACAGGG + Intronic
1001127950 5:169037498-169037520 GACACTTTAATTAGTGGAGGTGG - Intronic
1001775241 5:174323998-174324020 CACACCTGAGTCAGAGGAGCTGG + Intergenic
1003011389 6:2430667-2430689 GACACTTGAATGAGAGGAGTTGG + Intergenic
1004159729 6:13202807-13202829 GACCCTTCAGTAAGATGAGCTGG + Intronic
1004560352 6:16743762-16743784 GACAGTGCAGAGAGAGGAGCTGG + Intronic
1004990871 6:21137024-21137046 GACACTTTAGTAAGGGGTGGGGG - Intronic
1008157248 6:48031430-48031452 GACACTATTGTGATAGGTGCAGG - Intronic
1008420299 6:51291579-51291601 GACACCTGAGTGAGTGGAGTTGG + Intergenic
1010908253 6:81520136-81520158 GACAACATAGTGAGAGGGGCGGG - Intronic
1012577752 6:100824227-100824249 AACACTGTAGTCAGAGAAGCAGG - Intronic
1012798890 6:103800305-103800327 TGCTCTTTAGTGAGAGGAGAGGG - Intergenic
1015477744 6:133672349-133672371 AACACTTCAGTCAGAGGATCTGG + Intergenic
1016051431 6:139534477-139534499 AACCCTTGACTGAGAGGAGCAGG - Intergenic
1018378468 6:163235415-163235437 GTCACTTGACTGAGAGGAGGTGG + Intronic
1020694247 7:11394426-11394448 GAAACTATAGGGAAAGGAGCAGG + Intronic
1023242139 7:38160014-38160036 GAAACTATAGGGAAAGGAGCAGG + Intergenic
1033763862 7:144466021-144466043 GATGCCTTTGTGAGAGGAGCGGG - Intronic
1039177012 8:34820144-34820166 GACACTTTGGAGAGGGGAGGAGG + Intergenic
1039688149 8:39830875-39830897 GATACTTTAGAGAGATGATCAGG + Intronic
1042153488 8:65815396-65815418 TACACTTTAGAGACAGGATCTGG + Intronic
1042213276 8:66403025-66403047 AATACTGTAGTCAGAGGAGCAGG + Intergenic
1043038975 8:75235590-75235612 CAAACTTTGGTGAGAGTAGCTGG - Intergenic
1044901209 8:96946832-96946854 GAGACTTGAGTGATAAGAGCTGG - Intronic
1047034548 8:120922848-120922870 GAGGCTTTAGGGAGAGAAGCAGG + Intergenic
1049001962 8:139831969-139831991 GACACTTCACGGAGAGGAGAAGG - Intronic
1049050298 8:140189366-140189388 AACACTTTGGCAAGAGGAGCTGG - Intronic
1050120833 9:2305382-2305404 CACACTTTTGTGAGAAGAGGTGG + Intergenic
1050246332 9:3693821-3693843 GACATTTTAAAGAAAGGAGCAGG + Intergenic
1050761670 9:9079709-9079731 AACACTTTAGGGAGGGGATCAGG + Intronic
1053592078 9:39524836-39524858 GTTACTGTAGTGAGAGGGGCTGG + Intergenic
1054574225 9:66840453-66840475 GTTACTGTAGTGAGAGGGGCTGG - Intergenic
1055325292 9:75122084-75122106 GACACTTTATTAAAAGGAGCTGG - Intronic
1055557863 9:77493554-77493576 GACACTATTGTGAGGGGAGTGGG - Intronic
1056778378 9:89531210-89531232 GAAACTATAGGGAAAGGAGCAGG - Intergenic
1059571158 9:115437700-115437722 GCCACTTTGGTGAGGGGAGAAGG - Intergenic
1059989182 9:119848560-119848582 GAGAATTAAGTGAGAGGAGCTGG - Intergenic
1060373000 9:123092273-123092295 GACACAGTAGTGAGAGAACCAGG + Intronic
1060801387 9:126547818-126547840 GCCACCTTGGTGAGGGGAGCAGG - Intergenic
1061037179 9:128120380-128120402 GAGAGTTCAGTGATAGGAGCAGG - Intergenic
1061040139 9:128136830-128136852 AACAGCTCAGTGAGAGGAGCTGG - Intergenic
1061422974 9:130482107-130482129 GGCACTTTAGTGGCAGGACCAGG + Intronic
1062125999 9:134863457-134863479 GGCACTTTGGTGAGAAGAGAAGG + Intergenic
1187075727 X:15932495-15932517 GACACTGAACAGAGAGGAGCTGG + Intergenic
1187282540 X:17868924-17868946 GACACTTTAGTGAATTGGGCTGG - Intergenic
1189172235 X:38920285-38920307 GACAATTTAAAGAGAAGAGCGGG + Intergenic