ID: 1172636800

View in Genome Browser
Species Human (GRCh38)
Location 20:36415602-36415624
Sequence CAGTGTCCTCAAAGGGTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 266}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172636800_1172636811 9 Left 1172636800 20:36415602-36415624 CCAACAACCCTTTGAGGACACTG 0: 1
1: 0
2: 1
3: 26
4: 266
Right 1172636811 20:36415634-36415656 GAGGTTAGGTAAGTGGCTCAAGG 0: 1
1: 1
2: 27
3: 190
4: 1097
1172636800_1172636808 -10 Left 1172636800 20:36415602-36415624 CCAACAACCCTTTGAGGACACTG 0: 1
1: 0
2: 1
3: 26
4: 266
Right 1172636808 20:36415615-36415637 GAGGACACTGGGGCTCAGGGAGG 0: 1
1: 5
2: 139
3: 1064
4: 6186
1172636800_1172636810 2 Left 1172636800 20:36415602-36415624 CCAACAACCCTTTGAGGACACTG 0: 1
1: 0
2: 1
3: 26
4: 266
Right 1172636810 20:36415627-36415649 GCTCAGGGAGGTTAGGTAAGTGG 0: 1
1: 0
2: 4
3: 55
4: 392
1172636800_1172636809 -5 Left 1172636800 20:36415602-36415624 CCAACAACCCTTTGAGGACACTG 0: 1
1: 0
2: 1
3: 26
4: 266
Right 1172636809 20:36415620-36415642 CACTGGGGCTCAGGGAGGTTAGG 0: 1
1: 1
2: 18
3: 172
4: 815

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172636800 Original CRISPR CAGTGTCCTCAAAGGGTTGT TGG (reversed) Intronic
900426621 1:2583230-2583252 CTGTGTCCTCACAGGGTGGAAGG - Intergenic
900664966 1:3809038-3809060 CTGTGTCCTCACAGGGTGGAAGG + Intergenic
900791461 1:4683733-4683755 GAGTGCCCTCAAATGGCTGTGGG - Intronic
901213967 1:7543614-7543636 CATTGTTCTCAAACAGTTGTTGG + Intronic
902049298 1:13549273-13549295 CAGTGTCCTCACAGGGTAGAGGG + Intergenic
902164902 1:14562109-14562131 GTGTGTCCTCAAAGGGGTGGAGG - Intergenic
903547896 1:24138259-24138281 CACTTTCATCACAGGGTTGTTGG - Intronic
903657483 1:24958195-24958217 CACTGACCTCAAAGGGTGGTTGG - Intronic
904718895 1:32491367-32491389 CAGTGCCCTCCAAGGGTCTTAGG + Exonic
906461079 1:46035424-46035446 CAGCCTCCTCAATGGCTTGTGGG - Exonic
907397507 1:54201420-54201442 CAGTGTCCTTACAAGGTAGTGGG + Intronic
907426701 1:54384220-54384242 AAGTGTCCTCAGAGGTGTGTGGG - Intronic
907556609 1:55349742-55349764 CAGTCTCCTCAAGGGGTTCTGGG - Intergenic
908267361 1:62392585-62392607 CTGTGTCCTCAAATGGTGGAAGG - Intergenic
908809608 1:67966553-67966575 CAGTGTCCTCACAGGGTGGAAGG - Intergenic
909038194 1:70619266-70619288 CATTGTCCTCAGAGAGTTCTAGG - Intergenic
909278593 1:73720646-73720668 CCCTGTACTCAAAGGGTTCTGGG - Intergenic
909465341 1:75967552-75967574 AAGTGACCTCAGAGGGGTGTGGG - Intergenic
910464174 1:87478776-87478798 CCATGACCTCACAGGGTTGTTGG - Intergenic
912032350 1:105264856-105264878 CAGTTTCTTCATAGTGTTGTTGG + Intergenic
912551015 1:110485310-110485332 CATCTTCCTCAAAGGGCTGTTGG - Intergenic
912894660 1:113574272-113574294 CAGTTTCTTCATAGGGTTGTTGG + Intronic
913991138 1:143612957-143612979 CAGTGTCCTCATAGTGTCATTGG - Intergenic
914358994 1:146913881-146913903 CTATGACCTCACAGGGTTGTTGG - Intergenic
914494751 1:148185995-148186017 CTATGACCTCACAGGGTTGTTGG + Intergenic
915856637 1:159395653-159395675 AAGTGTGCTCAAAGAGTAGTGGG + Intergenic
916884842 1:169057214-169057236 GAGAGTCAGCAAAGGGTTGTGGG + Intergenic
918262695 1:182810081-182810103 CAGAGTCCTCCAGGGGTTCTTGG - Intronic
923516055 1:234698797-234698819 CAGTGTCAGCAAAGTGCTGTGGG - Intergenic
923865804 1:237938330-237938352 CAGTGTTCTCAAAGTGCTGTTGG + Intergenic
1063155031 10:3371573-3371595 CAGTCTCCTCAAAGGCTTGAAGG + Intergenic
1064218102 10:13417312-13417334 CCGTGTCCTCACAGGGTGGAAGG - Intergenic
1065907854 10:30274172-30274194 CAGTTTCTTCATAGTGTTGTTGG - Intergenic
1068510387 10:57958224-57958246 CTGTGTCCTCAAAAGGTGGAAGG - Intergenic
1068697678 10:59985612-59985634 CATTTTCCTCACAGTGTTGTTGG - Intergenic
1069737799 10:70669011-70669033 CAGTGTCCACAGAGGGCTGCTGG + Intergenic
1070332644 10:75429403-75429425 CTGTGTCCTCAAATGGTAGGAGG - Intergenic
1070585222 10:77760374-77760396 CATTGTTCTCAAAGAGCTGTTGG - Intergenic
1071787459 10:88917925-88917947 CTGTGTCCTCACAGGGTGGAAGG + Intronic
1073072225 10:100801949-100801971 TAGTTCCCTCACAGGGTTGTCGG + Intronic
1074480446 10:113815503-113815525 CTGTGTCCTCAAATGGTGGAAGG - Intergenic
1074532865 10:114309006-114309028 CAGTCTGCTCACAGGGGTGTTGG + Intronic
1075846133 10:125546153-125546175 CAGTGTCCTCTACAGCTTGTGGG + Intergenic
1075983696 10:126765126-126765148 CAGTTTCCTCATAGTGTTGGTGG + Intergenic
1076002562 10:126923860-126923882 CTGTGTCCTCACAGGGTAGAAGG - Intronic
1078909978 11:15722052-15722074 CAGTGTCCTCACAGGATGGAAGG + Intergenic
1079461107 11:20678708-20678730 CTGTGTCCTCAAATGGTGGAAGG + Intronic
1079806236 11:24933808-24933830 GAGAGTCATCAAAGGGTGGTGGG + Intronic
1079911105 11:26311253-26311275 CACTGGCCTCATAGAGTTGTTGG - Intronic
1080676514 11:34432934-34432956 CACTGACCTCCAAGGGTAGTTGG - Intergenic
1080942372 11:36933966-36933988 CTGTGTCCTCACATGGTTGAAGG + Intergenic
1081062670 11:38500018-38500040 CTGTGTCCTCAAATGGTGGAAGG - Intergenic
1081348302 11:42017669-42017691 CTGTGTCCTCACATGGTGGTAGG + Intergenic
1082114312 11:48311586-48311608 CTGTGTCCTCACATGGTGGTAGG + Intergenic
1083142248 11:60731713-60731735 CATTGTTCTCAAACAGTTGTTGG + Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1086581640 11:88406726-88406748 AACTGTTCTCAAAGGCTTGTAGG - Intergenic
1086732614 11:90269142-90269164 CAGTTTCCTCATAGCGTTGATGG + Intergenic
1086737201 11:90321255-90321277 CAATCACCTCAAAGGCTTGTAGG - Intergenic
1088011391 11:105005562-105005584 CAGTGTACTCAAAGTATTCTGGG + Intronic
1088252922 11:107877225-107877247 CTGTGTCCTCACAGGGTGGAAGG + Intronic
1090616917 11:128522843-128522865 CCGTGTCCTCAAAGGGCTTTAGG + Intronic
1091626305 12:2123468-2123490 AAGTGACCTCAGAGGGTTCTAGG + Intronic
1093604560 12:21074119-21074141 CAGTTTCTTCAAAGGGTTTGTGG + Intronic
1096239630 12:49952826-49952848 CAGTGTCCTCAAAGGACACTTGG - Intronic
1097898584 12:64851602-64851624 CAGTTTCTTCATAGTGTTGTTGG + Intronic
1099391414 12:82084479-82084501 CATTGTTCTCAAACAGTTGTTGG + Intergenic
1100134049 12:91533161-91533183 CTGTGTCCTCATAGGGTGGAAGG - Intergenic
1100900990 12:99239980-99240002 CAGTTTCCTCATAGCGTTGATGG - Intronic
1101007403 12:100414525-100414547 CAGCAACCTCATAGGGTTGTTGG + Intronic
1101662266 12:106776026-106776048 CACTCTCCTCCCAGGGTTGTTGG - Intronic
1103072161 12:117953837-117953859 CCTTGTCCTCAAAGCGGTGTTGG - Intronic
1103485391 12:121279388-121279410 CAGTGTCCTGAACGGTTTGGGGG + Intronic
1104312147 12:127663217-127663239 CAGTGCCCTCAGAGGGATGATGG - Intergenic
1104815553 12:131643684-131643706 CAGGGTCCTCATGGAGTTGTGGG - Intergenic
1106196342 13:27497465-27497487 CAGTGTCCTCAACGTGCTGAGGG - Intergenic
1106405074 13:29466135-29466157 CAGAGTCCTCAAAAGGTGGGAGG - Intronic
1106770932 13:32959958-32959980 CAGTGTCCTCCCAGGGCTGGGGG - Intergenic
1107239794 13:38218740-38218762 CTGTGTCCTCACAGGGCAGTAGG + Intergenic
1108099888 13:46943820-46943842 CATTGTTCTCAAAGAGTTGTTGG + Intergenic
1108367833 13:49734649-49734671 CAGTGACCTGAAAGGGTCTTTGG - Intronic
1108727418 13:53198421-53198443 CAGTATCCTCAATGGCATGTTGG - Intergenic
1109907461 13:68864102-68864124 CAGGGTCCTCCAAGGGTTAAGGG + Intergenic
1111020453 13:82441488-82441510 CTATGTCCTCATTGGGTTGTTGG + Intergenic
1113508428 13:110832395-110832417 GAGTGTCCTCCCAGGGCTGTGGG + Intergenic
1113673453 13:112191186-112191208 CACTGTTCTTAAACGGTTGTTGG + Intergenic
1115199508 14:30837803-30837825 CATTGTTCTCAAACAGTTGTTGG + Intergenic
1118661041 14:68012690-68012712 CAGTATCCTTATAGGGTTATTGG + Intronic
1121303550 14:92890520-92890542 CAGTGTCCTCACATGGTGGAAGG - Intergenic
1121387873 14:93545848-93545870 CAGTCTCATCAAAGGCTTGTAGG + Intronic
1121464499 14:94106113-94106135 CTGTGTCCTCACATGGTAGTGGG + Intronic
1121627831 14:95399674-95399696 CTGTGTCCTCACATGGTTGAAGG + Intergenic
1121779593 14:96613817-96613839 AAGTGTCCTCATAGGGTGGATGG - Intergenic
1121862247 14:97329447-97329469 CTGTGTCCTCACAGGGTGGAGGG + Intergenic
1126117911 15:45225739-45225761 CTGTGTCCTCAAAGGGCAGAGGG + Intergenic
1126917108 15:53477949-53477971 CCCAGTCCTCAAAGGGTTGGAGG + Intergenic
1128120241 15:65140676-65140698 CTGTTTCCTCATAGGGTTCTGGG - Intergenic
1128372058 15:67047666-67047688 CATTGTTCCCAAAGGGTTATAGG + Intergenic
1129380568 15:75162838-75162860 CACTCATCTCAAAGGGTTGTTGG - Intergenic
1130894405 15:88159071-88159093 CAGGGTCCCCAAAGGCTGGTGGG + Intronic
1132119408 15:99163766-99163788 CTGTGTCCTCACAGGGTGGAAGG - Intronic
1136533458 16:30885184-30885206 CAGTGTCATCACAGGGTCCTTGG + Intronic
1137382131 16:48009344-48009366 CCCTGTCCTCAAAGGGCTGAAGG + Intergenic
1141184249 16:81775811-81775833 AAGTGACCTCAAAGGGTAGAGGG - Intronic
1142352370 16:89586152-89586174 CACTGTCCTGATGGGGTTGTGGG + Intronic
1142373828 16:89696891-89696913 GAGTGTCCTCAAGGGCCTGTTGG - Exonic
1142887546 17:2922192-2922214 CAGTGTCCTCACAGGGAGGAAGG + Intronic
1143250915 17:5522396-5522418 CTGTGTCCTCACAGGGTGGAAGG - Intronic
1144701134 17:17341340-17341362 CAGTTTCCTCACAGTGTTGCTGG - Intronic
1150860743 17:68797701-68797723 GAGTGTCAGCAAAGGGTGGTGGG + Intergenic
1155938346 18:31777472-31777494 GAGTGTACTCAAAGTGTGGTTGG - Intergenic
1157049336 18:44142753-44142775 CAGTCTCCACAAAGGAATGTAGG + Intergenic
1158425125 18:57333014-57333036 CAATATCTTCAAAGTGTTGTAGG + Intergenic
1158638182 18:59179607-59179629 CTGTGTCCTCACAGGGTAGAAGG + Intergenic
1159775637 18:72600738-72600760 CAGTCTCCCCAAAGGCTTGGAGG + Intronic
1160257608 18:77260385-77260407 CTGTGTCCTCATAGGGTGGGAGG + Intronic
1161710909 19:5847506-5847528 GAGAGTCATCAAAGGGTAGTGGG - Intronic
1162846754 19:13398690-13398712 CAGTTTCCTCATAGGGAGGTTGG + Intronic
1163362651 19:16857210-16857232 CATTGTTCTCAAACAGTTGTTGG + Intronic
1165292677 19:34900939-34900961 CAGTGGCTTCCAAGGGTTGAAGG + Intergenic
1167800147 19:51735382-51735404 CTGTGTCCTCACATGGTGGTGGG + Intergenic
1168476259 19:56677569-56677591 CTGTGTCCTCACAGGGTGGAAGG + Intergenic
1168498572 19:56874640-56874662 CAATCTCATCAAAGGCTTGTAGG - Intergenic
1168543385 19:57231165-57231187 CAGGGTCCTGAAAGGGGTGGGGG - Exonic
925584495 2:5450741-5450763 CTGTGTCCTCATAGGGTAGAAGG + Intergenic
925728895 2:6902900-6902922 CAGTTTCTTCATAGTGTTGTTGG + Intergenic
928214868 2:29352777-29352799 CAGAGTCCAGAAAGGGTTGAGGG + Intronic
930440104 2:51393554-51393576 CAGTTTCTTCATAGGGTTGATGG - Intergenic
930570991 2:53087008-53087030 CATTGGCCTCAAAGGGCTGTTGG - Intergenic
931561962 2:63571569-63571591 CAGTGCCTTCAGAGAGTTGTGGG + Intronic
934992917 2:98933965-98933987 CAGTGTCCTCACATGGTGGAAGG + Intronic
935170361 2:100606835-100606857 CACTGTCCTCCAAGGGTTTATGG - Intergenic
936632627 2:114220323-114220345 CAGTTTCCTCCAATGGTGGTAGG + Intergenic
937023761 2:118680863-118680885 CAGTGTCCTGGCAGGGTGGTGGG - Intergenic
937143364 2:119620655-119620677 CAGTTTCCTCATAGTGTTGATGG - Intronic
937631858 2:124110528-124110550 CAGTGTCTTCAAAGAGTTATAGG + Intronic
938786246 2:134632621-134632643 CTGTGTCCTCAAAGGGTGGAAGG + Intronic
939162159 2:138603622-138603644 CTGTGTTCTCACAGGGTTGAAGG + Intergenic
940002836 2:148983984-148984006 CAGTGTCTTCAAATGTTGGTTGG + Intronic
940285564 2:152029787-152029809 CTGTGTCCTCAAATGGTAGAAGG - Intronic
941449677 2:165644987-165645009 CTGTGTCCTCATATGGTTGAAGG + Intronic
942567688 2:177282892-177282914 CAGTGTCCTGAAAAGTTTGGTGG - Intronic
942650689 2:178164341-178164363 CTGTGTTCTCAAATGGTTGAAGG + Intergenic
943408558 2:187518219-187518241 CAGTTTCTTCAGAGTGTTGTTGG + Intronic
943630086 2:190241541-190241563 CAGTTTCTTCATAGTGTTGTTGG + Intronic
943650676 2:190454561-190454583 CAGTGTCCTCATATGGTAGAGGG - Intronic
945481354 2:210349627-210349649 CAGTTTCTTCATAGTGTTGTTGG + Intergenic
946142389 2:217702769-217702791 TAGTGTCCTCAAAGAGTTTAGGG - Intronic
946685528 2:222265715-222265737 CAGTGTCCTGAAAAGGTTAGAGG - Intronic
946823744 2:223655697-223655719 CTGTGTCCTCAAATGGCTGAAGG - Intergenic
948987926 2:241536787-241536809 TATTGTCCTCAAACAGTTGTTGG + Intergenic
1169023218 20:2346070-2346092 TACTTTCCTCAAAGGATTGTTGG - Intergenic
1170612556 20:17926438-17926460 CAGTGATCTCAAGGGGCTGTAGG - Intergenic
1170839832 20:19915498-19915520 CGGTGACTTCCAAGGGTTGTGGG + Intronic
1171199344 20:23228460-23228482 CAGTGTCCTCACATGGTGTTGGG - Intergenic
1171902873 20:30873143-30873165 CTGTGTCCTCAAATGGTGGAAGG - Intergenic
1172636800 20:36415602-36415624 CAGTGTCCTCAAAGGGTTGTTGG - Intronic
1173398459 20:42702678-42702700 CAGTGTTCTCAAAGTTCTGTAGG - Intronic
1173428131 20:42960349-42960371 CTGTGTCCTCACAGGGTGGAAGG + Intronic
1175162324 20:57018166-57018188 TAGTGTCCACAAAGTTTTGTTGG - Intergenic
1176219652 20:63963926-63963948 CAGGGGCCTCGAAGGCTTGTGGG + Intronic
1179131496 21:38641290-38641312 CTGTGTCCTCAAATGGTAGAAGG - Intronic
1180833685 22:18919283-18919305 CCGTGCCCCCAAGGGGTTGTTGG - Intronic
1181066144 22:20306971-20306993 CCGTGCCCCCAAGGGGTTGTTGG + Intergenic
1182763310 22:32740393-32740415 CAGTTCCCTCAAAGGGTTTCAGG - Intronic
1183007562 22:34916188-34916210 CTGTGTCCTCACAGGGTGGAAGG - Intergenic
1203283771 22_KI270734v1_random:144581-144603 CCGTGCCCCCAAGGGGTTGTTGG - Intergenic
950339156 3:12226854-12226876 CAGTGTCTTCAATAGGTTCTTGG - Intergenic
950842427 3:15980251-15980273 CAGTGTCCTCACATGGTCGAAGG + Intergenic
951324249 3:21283817-21283839 CAGTTTCCTCACAGTGTTGATGG + Intergenic
951620131 3:24592384-24592406 GATTGTCCTCAAAGGTTTGAAGG - Intergenic
952299384 3:32090610-32090632 CATTGTTCTCAAAGAGTTGTTGG - Intergenic
952732423 3:36653012-36653034 CAGTTCCTTCAAAGGGTTATGGG - Intergenic
952777707 3:37061935-37061957 CAGTGTGGTTGAAGGGTTGTTGG - Intronic
955300464 3:57773306-57773328 CAGTGTCATCAATAGGTTCTTGG + Intronic
956640662 3:71412553-71412575 CATTTTCTTCAAAGGGTAGTTGG - Intronic
956659834 3:71586037-71586059 CAGTGATGTCAAAGAGTTGTTGG - Intergenic
957034719 3:75283154-75283176 CAGTGACCTCAAAGGGATTCTGG - Intergenic
958501847 3:94921002-94921024 CTGTGTCCTCAAATGGTGGAAGG - Intergenic
959617850 3:108368271-108368293 CAGTTTCCTCATAGTGTTGTTGG - Intronic
962064597 3:131965287-131965309 CAGTTTCTTCATAGTGTTGTTGG - Intronic
962236375 3:133710850-133710872 CAGAGTGATCAAAGTGTTGTTGG + Intergenic
962325341 3:134427706-134427728 AAGTGGCCTCAAAGGGTTGCTGG + Intergenic
962814902 3:138988832-138988854 CTGTGTCCTCACAGGGTGGAAGG + Intergenic
965530226 3:169764281-169764303 CAGTCCCCTCAACGGGGTGTGGG - Intergenic
965880676 3:173384214-173384236 CAGTTTCCTCATAGTGTTGATGG - Intergenic
966120487 3:176514178-176514200 TAGTTTCCTTAAAGGGATGTGGG + Intergenic
966554264 3:181241476-181241498 CACTTGCCTCAGAGGGTTGTTGG + Intergenic
968951625 4:3697886-3697908 GAGTGACCTCAGAGGGTTCTTGG + Intergenic
969299007 4:6286359-6286381 CTGTGTCCTCACAGGGTGGAAGG - Intronic
970551205 4:17182914-17182936 CAGTGTCCCCGAAGGCATGTTGG - Intergenic
972607395 4:40626459-40626481 CACTGCCCTCAAAGGATTGCAGG - Intronic
973803909 4:54506156-54506178 CAGTGTTCTTAAAGTTTTGTTGG - Intergenic
974450335 4:62048079-62048101 CAGTCTCCTCCCAGGGCTGTTGG + Intronic
976631348 4:87240063-87240085 AAGTGTTCTCAAAGTGCTGTGGG - Intronic
978278117 4:106976817-106976839 CAGTTTCTTCAAAGGGTCGATGG + Intronic
979264646 4:118687094-118687116 CAGTGTTTGCACAGGGTTGTGGG - Intronic
980336088 4:131475270-131475292 CAGTTTCTTCATAGTGTTGTGGG - Intergenic
980819426 4:137994387-137994409 CAGTCTCCCCAAAGGCTTGGAGG + Intergenic
981133768 4:141187925-141187947 CAGTTTCTTCATAGTGTTGTTGG + Intronic
981463796 4:145042010-145042032 CAGTCTCCCCAAAGGTTTATTGG - Intronic
982019932 4:151192699-151192721 CAGCGTTCACAAAGGCTTGTAGG - Intronic
982345624 4:154354599-154354621 CAGTGTCCTAGATGGATTGTAGG - Intronic
982380076 4:154740636-154740658 CAGTGTCCCCGCAGGGTGGTCGG - Intronic
982393836 4:154894024-154894046 CAGTTTCTTCACAGTGTTGTTGG - Intergenic
982727995 4:158925932-158925954 CTGTGTCCTCACAGGGTGGAAGG + Intronic
984649714 4:182257399-182257421 CAGCGTCCTCTAAGGTTTGGAGG - Intronic
985442446 4:189992893-189992915 CTGTGTTCTCATGGGGTTGTCGG + Intergenic
986055480 5:4132617-4132639 TCGTGTCCTCAAAGGGCTGGGGG - Intergenic
987757114 5:22110520-22110542 CAGTGCAATCATAGGGTTGTGGG + Intronic
989550000 5:42723479-42723501 CAGTCTACTCAGAGGGATGTAGG - Intergenic
989608384 5:43268338-43268360 CAATCTCATCAAAGGCTTGTTGG + Intronic
990559259 5:56967160-56967182 CTGTGTCCTCAAATGGTAGAAGG - Intronic
993545777 5:89211354-89211376 CTGTGTCCTCACATGGTTGAAGG - Intergenic
995410596 5:111852928-111852950 AAGCTTCCTCAAAGGGTTGTTGG + Intronic
995678494 5:114690679-114690701 CAGTGGCCTCAAAGTGTTCAAGG - Intergenic
997383782 5:133456565-133456587 CAGTGACCACCAAGGGCTGTTGG - Intronic
997444377 5:133930646-133930668 CTGTCACCTTAAAGGGTTGTGGG + Intergenic
999100758 5:149024026-149024048 CAGTGTTCTCAAAGGGCTGTTGG + Intronic
999826553 5:155278920-155278942 ATGTGTCCTCACAGGGTTGTAGG + Intergenic
999958490 5:156728026-156728048 TAGTGACCTCACAGGATTGTGGG - Intronic
1000017800 5:157293807-157293829 CAGTCTCCCCAAAGGCTTGGAGG + Intronic
1003011749 6:2433489-2433511 CAGTGTCCACATAGGGCTATGGG - Intergenic
1003294334 6:4810750-4810772 CAGTGTCCTCACATGGTGGAAGG + Intronic
1004963258 6:20816992-20817014 CAATGTCCTCAAAGAATTTTGGG - Intronic
1005231234 6:23703919-23703941 CAGTGTCATCAATAGGTTGTTGG - Intergenic
1009496825 6:64359703-64359725 CTGTGTCCTCAAATGGTTGAAGG + Intronic
1010729914 6:79380197-79380219 CAATTTCCTCAAAGGCTTGGAGG - Intergenic
1010751568 6:79621401-79621423 CTGTGTCCTCACAGGGTAGAAGG - Intergenic
1011248365 6:85343743-85343765 CAGTGACCTCAAAGAGTTCTGGG + Intergenic
1012514274 6:100040384-100040406 CAGTTTCCTCATAGTGTTGATGG - Intergenic
1013976511 6:116084960-116084982 CAGTGGCCTCTAAGGATTGTTGG + Intergenic
1014266954 6:119289985-119290007 GAGTGTCCACTAAGGGTTGTTGG - Intronic
1017878354 6:158542405-158542427 CATTTTCCTCTGAGGGTTGTCGG - Intronic
1018131577 6:160736931-160736953 AAATGTCCTGGAAGGGTTGTAGG + Exonic
1019630060 7:2044235-2044257 GCGTGTCCTCACAGTGTTGTTGG - Intronic
1020965806 7:14866413-14866435 TAGTGTTTGCAAAGGGTTGTGGG - Intronic
1022871148 7:34481196-34481218 TAGTGACCTCATAGAGTTGTTGG - Intergenic
1023894510 7:44420912-44420934 CAGTTTCTTCATAGTGTTGTTGG - Intronic
1025738183 7:64173570-64173592 CTGTGTCCTCAAAGCAATGTTGG - Intronic
1027246122 7:76368870-76368892 CAGCTTCCTCAAAGTGTTGGGGG - Intergenic
1029014691 7:97303555-97303577 CAGTTTCCTCATAGGAATGTTGG + Intergenic
1030427194 7:109393488-109393510 CTGTGTCCTCACAGGGTGGAAGG + Intergenic
1030490781 7:110231372-110231394 CTGTGTCCTCACAGGGCTGAAGG - Intergenic
1035998092 8:4572195-4572217 CAGTTTCTTCATAGTGTTGTTGG + Intronic
1036786264 8:11689724-11689746 CAGTGCCCTGCAAGGGGTGTGGG + Intronic
1037370740 8:18174898-18174920 CACAGTCCTCAAAGGGTTTACGG + Intronic
1038895316 8:31776181-31776203 CAAAGCCCTCAGAGGGTTGTAGG + Intronic
1038907548 8:31922971-31922993 CAGAGTCCTGGAAGGGTTCTGGG + Intronic
1039848386 8:41342314-41342336 GAGTGGCTTCAAAGGGTTGAGGG - Intergenic
1040855900 8:51947783-51947805 CAGTCTCCCCAAAGGCTTGGAGG + Intergenic
1041756611 8:61320677-61320699 CTGTGTCCTCACATGGTAGTAGG + Intronic
1042632733 8:70837762-70837784 CAGTGTCCTCAAAGGATAACTGG + Intergenic
1042671106 8:71264146-71264168 CAGTGTCCTCACTGGGTTGCAGG - Intronic
1046312092 8:112450527-112450549 CAGTATCTTCTAAGGGTGGTTGG + Intronic
1046470145 8:114661940-114661962 CTGTCTCCTCAAGGGGTTCTGGG - Intergenic
1046734268 8:117759693-117759715 CAGTGCCCCCAAATGGTAGTAGG + Intergenic
1046921166 8:119730573-119730595 CAGTATCTTCAAAGGTATGTAGG - Intergenic
1047767864 8:128003989-128004011 CTGTGTCCTTACATGGTTGTAGG + Intergenic
1047974368 8:130114557-130114579 CACATTCCTCAAATGGTTGTGGG - Intronic
1049797354 8:144502879-144502901 GGGTGTCCTCACAGGGCTGTGGG + Intergenic
1050424865 9:5502383-5502405 CATTGTCATCAGAGTGTTGTTGG + Intergenic
1051349636 9:16186752-16186774 CTGTCTCCTCAAAGGCCTGTTGG - Intergenic
1051480086 9:17550230-17550252 CAATGTCCTCACAGGGTGGAAGG + Intergenic
1051891024 9:21943139-21943161 CAGTGTTCTCAAAGGAGAGTTGG + Intronic
1056735841 9:89209137-89209159 CTGTGTCCTCACATGGTTGAAGG + Intergenic
1056853069 9:90100578-90100600 CAGTATCCTTAAAGTTTTGTTGG - Intergenic
1057892226 9:98877886-98877908 CAGTTTCCTCACAGATTTGTTGG + Intergenic
1058188428 9:101883903-101883925 CTGTGTCCTCAAATGGTAGAAGG - Intergenic
1058541263 9:106014874-106014896 CAGTGTCCTCACATGGTAGAAGG + Intergenic
1058636301 9:107041688-107041710 CTGTGTCCTCACATGGTGGTGGG + Intergenic
1061664618 9:132153267-132153289 CAGAGTGCTCAGAGGGGTGTAGG - Intergenic
1186788205 X:12973010-12973032 CACCGACCTCACAGGGTTGTTGG - Intergenic
1186837104 X:13449081-13449103 CAGTGACCTCAAAGCACTGTGGG - Intergenic
1188741477 X:33788019-33788041 CATTGTTCTCAAAGAGTTGTTGG - Intergenic
1189978214 X:46484146-46484168 CAGTTTCTTCATAGGGTTGGTGG + Intronic
1190738432 X:53271144-53271166 CAGTGTCCGCAAAGGCCTGGAGG - Intronic
1190943742 X:55071112-55071134 CAGTTTCTTCATAGCGTTGTTGG + Intergenic
1191947964 X:66555931-66555953 CAGTTTCTTCACAGTGTTGTTGG - Intergenic
1192406625 X:70892313-70892335 CAGTTTCTTCATAGTGTTGTTGG - Intronic
1192729571 X:73789646-73789668 CAGTTTCTTCATAGTGTTGTTGG + Intergenic
1193075389 X:77349552-77349574 CAGTTTCCTCATAGCGTTGATGG - Intergenic
1194901187 X:99514075-99514097 CAGTTTCTTCATAGTGTTGTTGG + Intergenic
1195987617 X:110647312-110647334 CTGTGTCCTCAAATGGTGGAAGG - Intergenic
1197155495 X:123265824-123265846 CAGGGTCCTGAAAGGGTTCAGGG - Intronic
1197847252 X:130815810-130815832 CAGTGTCTTCATAGTGTTGATGG - Intronic
1199942897 X:152641909-152641931 TGGTGTACTCAAATGGTTGTTGG - Intronic
1200005498 X:153082034-153082056 CTGTGTCCTCACATGGTCGTGGG + Intergenic
1201800554 Y:17950380-17950402 CAGTTTCTTCATAGTGTTGTTGG + Intergenic
1201800999 Y:17955576-17955598 CAGTTTCTTCATAGTGTTGTTGG - Intergenic
1201859549 Y:18581646-18581668 CAGTGTCCTCTAATGGTGGAAGG + Intronic
1201873772 Y:18738735-18738757 CAGTGTCCTCTAATGGTGGAAGG - Intronic
1202360886 Y:24109182-24109204 CAGTTTCTTCATAGTGTTGTTGG - Intergenic
1202509892 Y:25560936-25560958 CAGTTTCTTCATAGTGTTGTTGG + Intergenic