ID: 1172638211

View in Genome Browser
Species Human (GRCh38)
Location 20:36424160-36424182
Sequence CTGTGACAGGTGAAGGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 335}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172638206_1172638211 0 Left 1172638206 20:36424137-36424159 CCTGGGAAATCAGTTCGGAACAT 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1172638211 20:36424160-36424182 CTGTGACAGGTGAAGGGGACAGG 0: 1
1: 0
2: 1
3: 27
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172638211 Original CRISPR CTGTGACAGGTGAAGGGGAC AGG Intronic
900742337 1:4338351-4338373 ATAGGACAGGTGAAAGGGACAGG + Intergenic
901559629 1:10059720-10059742 CTGTGACACGTGGAGGTGAGAGG - Intronic
901971861 1:12914536-12914558 CTGTGAGTGGAGAAGGGGTCAGG + Intronic
902013307 1:13287204-13287226 CTGTGAGTGGAGAAGGGGTCAGG - Intergenic
902822217 1:18950339-18950361 CTTTGCCAGGGGAAGGGGGCTGG + Intronic
904454213 1:30637380-30637402 CTGTGACAGGGAAGGAGGACAGG - Intergenic
905850852 1:41273623-41273645 CTGTGACAGGTGCACTGGCCTGG - Intergenic
906209281 1:44003147-44003169 CTGCAGCAGGTGGAGGGGACTGG - Intronic
906239434 1:44233356-44233378 TTGTGACAGGAGGAGAGGACTGG - Intronic
907630978 1:56081463-56081485 CTGTGACAGCTGATGGAAACCGG + Intergenic
907975509 1:59427623-59427645 CTGTGACAGGTACAGAGGAAAGG - Intronic
908500976 1:64744364-64744386 GAGGGACAGGTGAAGGGCACAGG + Intergenic
910725658 1:90336129-90336151 CTTTGACAGATGAGGGGGTCAGG + Intergenic
912459787 1:109822944-109822966 CTGTGAGAGGAGAATGGGAAAGG + Intergenic
912695278 1:111836876-111836898 CAGGGACAAGTGAAGGGTACCGG - Intronic
913027192 1:114855176-114855198 ATGGGACAGGAGAAGGGAACGGG + Intronic
913236199 1:116785365-116785387 CTGTGACTGCTGTAGGGGATGGG - Intergenic
913547221 1:119881011-119881033 CAGTGACACAGGAAGGGGACTGG + Intergenic
913556985 1:119977326-119977348 CAGTGACACAGGAAGGGGACTGG - Intronic
915911040 1:159915689-159915711 CTGTTCCAGGTAAAGGGGATAGG + Intergenic
916306142 1:163335253-163335275 CTATGCCAGGTGTAAGGGACTGG + Intronic
916473146 1:165143182-165143204 CTGTTACTGGAGAAGAGGACAGG + Intergenic
916600717 1:166290719-166290741 ATGTGAAAGGGGAAGGGGTCTGG + Intergenic
917749411 1:178040715-178040737 CGAGGACAGGGGAAGGGGACTGG - Intergenic
920398183 1:205661274-205661296 CTGCCACAGGGGAAGGGGAAGGG + Intronic
923043939 1:230340957-230340979 ATGTCACAGGAGAAGGGGACAGG + Intronic
923124437 1:231022939-231022961 CTGTGCCAGGTGAAGGACGCTGG - Intronic
923220659 1:231889610-231889632 CCCTGAGAGGTGAAGGGGCCTGG + Intronic
924633254 1:245762235-245762257 CTGTGTGAGGTCAATGGGACAGG - Intronic
1063564215 10:7158121-7158143 TGGTGACAGAGGAAGGGGACAGG + Intergenic
1065334588 10:24643637-24643659 CTTTGAAAGGTTAAGGGGAAAGG - Intronic
1065405999 10:25365673-25365695 CTTTGACAGGTGAAGGAGAAAGG + Intronic
1066415502 10:35217589-35217611 CTGTGACAGCTGGAGGACACAGG + Intergenic
1066680225 10:37930977-37930999 CTGTGACAGCTGATGGAGAAGGG - Intergenic
1067427863 10:46223103-46223125 TGGAGACAGGTGAAGGGGACTGG - Intergenic
1068677397 10:59782192-59782214 CTGTTACAGGTGGACTGGACTGG - Intergenic
1069555473 10:69394927-69394949 CTGAGACAGGAGGAGGGGCCTGG - Intronic
1069907045 10:71738211-71738233 CTGTCAGAGGTGGTGGGGACAGG - Intronic
1071491463 10:86139387-86139409 CAGAGGGAGGTGAAGGGGACTGG - Intronic
1073361952 10:102906726-102906748 TTGTGTCAGGTGAAGTGGCCTGG + Intergenic
1074615140 10:115060144-115060166 TTGTGTCAGGTTGAGGGGACAGG + Intergenic
1075252620 10:120894341-120894363 CTGTGGCAGATGAAGAGGAAAGG - Intronic
1075794613 10:125110164-125110186 GTGTGACAGGTGAGAGAGACAGG + Intronic
1076188041 10:128464135-128464157 CTCTGACAGGGGAAGGGACCAGG - Intergenic
1076304454 10:129454718-129454740 CTGTGAGAGATGGATGGGACTGG - Intergenic
1076319462 10:129567215-129567237 CTGTGAGAGGTGGAGGGGACGGG - Intronic
1076411552 10:130255092-130255114 CTGTGGCTGTTGAAGGGGCCTGG + Intergenic
1076601471 10:131659377-131659399 CTGTGTCTGGAGAAGGGGCCAGG + Intergenic
1077067256 11:647679-647701 CTGATACAGGTGAGGGCGACGGG + Intronic
1077817045 11:5696144-5696166 CTGAGAATGTTGAAGGGGACAGG - Intronic
1077902096 11:6497836-6497858 CTAGGCCAGGTGAGGGGGACAGG + Exonic
1078038023 11:7828282-7828304 CTGTGACTGCAGAAGGGCACAGG + Intergenic
1078271410 11:9798404-9798426 CTGGGACAGAAGAAGGGGACAGG + Intronic
1079027593 11:16961198-16961220 CTGGGACTGGGGATGGGGACAGG - Intronic
1079312360 11:19378163-19378185 CTGTGACAGCAGAAGCGGATGGG - Intronic
1079428745 11:20368251-20368273 ATGTTTCAGGTGAAGGGGTCTGG - Intronic
1081562458 11:44230315-44230337 CTGTGACATGTGAAGGAGTTCGG + Intronic
1081707237 11:45189808-45189830 CTATGACATGTGGTGGGGACAGG + Intronic
1081749121 11:45495205-45495227 GGGTGAGATGTGAAGGGGACTGG - Intergenic
1082002826 11:47403103-47403125 CTGAGACAAGAGAAGGGGAATGG + Intergenic
1084681116 11:70666982-70667004 CTGTGGAAGGTGAAGGGGGTGGG + Intronic
1086775306 11:90823795-90823817 CAGTAAAAGGTGAAGGAGACAGG + Intergenic
1087174419 11:95082930-95082952 CTGGGCAAGGTGAGGGGGACGGG + Intergenic
1088237941 11:107744915-107744937 CTCTGACACCTGATGGGGACTGG + Intergenic
1088683045 11:112260765-112260787 CGGTGACAGGTAATGGTGACTGG - Exonic
1088700587 11:112407818-112407840 CTGTGTCAGGTGAAATAGACAGG - Intergenic
1089108585 11:116036110-116036132 CTTTGAGGGGTGAAGGGGATGGG + Intergenic
1089755758 11:120685431-120685453 CTCTGGCAGGTGAGGGGTACGGG - Intronic
1090004180 11:122985083-122985105 CTGTGGCAGGGAACGGGGACAGG + Intergenic
1090770081 11:129912202-129912224 CTGTGACTGGTGAGGGGAAGTGG + Exonic
1091331899 11:134737031-134737053 CTGTGCCAGGTGGAGGGGCCTGG - Intergenic
1091391586 12:129435-129457 TTGTGACAGGTGCTGGGGAAGGG - Intronic
1091730882 12:2879245-2879267 CTGTGAAAGGTGAAGGTGGGAGG - Intronic
1092103542 12:5904746-5904768 CTGAGACAGGTGTATGGGTCTGG - Intronic
1092588208 12:9922186-9922208 CTGTGGCATGTTCAGGGGACTGG - Exonic
1095330611 12:40957337-40957359 CTGGGAGAGGTGAAGGTTACTGG + Intronic
1096914648 12:55018078-55018100 CTCTGACAGATGTAAGGGACTGG - Intergenic
1097124980 12:56766805-56766827 CTGGGAGGGGTGAAGGGGAAGGG + Intronic
1097248043 12:57617350-57617372 TGGTGAAAGGAGAAGGGGACAGG + Intronic
1098139030 12:67432688-67432710 ATGTGGCAGGTGAAGGAGAAGGG - Intergenic
1101915057 12:108889555-108889577 TTGTCACAGGCAAAGGGGACTGG + Intronic
1102258161 12:111428186-111428208 CTGTGCCAGGTGAGGGGCGCTGG - Intronic
1103037816 12:117670753-117670775 CTGTAATAGATGAAGGAGACAGG + Intronic
1103175725 12:118861650-118861672 CTGAGACGGGGGAAGGGGAAAGG - Intergenic
1103459128 12:121089878-121089900 CTGTGACAGGAGCTGGGGACGGG - Intergenic
1103558778 12:121781243-121781265 CTCTGACGGGTGAAGGGGAAGGG + Exonic
1104637664 12:130448203-130448225 CTGTGACTGGTGATGGCCACGGG + Intronic
1109040780 13:57333589-57333611 CTGAAACAGGAGAAGGGGATAGG + Intergenic
1109337497 13:61010551-61010573 CTGTCACAGGTGAAATGGAATGG + Intergenic
1109945284 13:69424081-69424103 CTGTGACTGCTGTAGGGGAGGGG - Intergenic
1113798746 13:113075576-113075598 CTCTGAGAGGTGAAGGTGAGAGG - Intronic
1115242167 14:31260537-31260559 CTGTCACATGGGAAGGAGACAGG - Intergenic
1115437234 14:33388484-33388506 CTGTGGCAGGTGAATGGGGGCGG + Intronic
1116797661 14:49409248-49409270 CTGAGACAGGTGAATGGGGGTGG - Intergenic
1121392862 14:93590752-93590774 CTGGGAAAGGCGAATGGGACTGG + Intronic
1121397294 14:93637325-93637347 CTGTAAAAGCTGAAGGAGACTGG + Intronic
1122211836 14:100178559-100178581 CTGTGGCTGGGGAAGGGGAGTGG + Intergenic
1123128612 14:105967974-105967996 CTGTGCCAGGTGGAGGGAGCAGG - Intergenic
1123409145 15:20044139-20044161 CTGTGCCAGGTGGAGGGAGCAGG - Intergenic
1123518476 15:21050847-21050869 CTGTGCCAGGTGGAGGGAGCAGG - Intergenic
1123785117 15:23663661-23663683 TGGTGAAAGGTGAAGGGGAGTGG + Intergenic
1124404614 15:29382451-29382473 CTGTGATGAGTGAAGGGGAGGGG - Intronic
1124425481 15:29559294-29559316 CTGTGTGAGGTGAGGGGAACAGG - Intronic
1126312731 15:47335872-47335894 CTGTGGAAGGTCAAGTGGACCGG + Intronic
1127537903 15:59907710-59907732 CTGTTACAGAAAAAGGGGACTGG - Intergenic
1128892267 15:71342036-71342058 CTGTAACAGGAGATGGGGAGGGG + Intronic
1129254846 15:74328416-74328438 CTCAGAAAGGTGAAGGGGCCTGG + Intronic
1129946804 15:79545641-79545663 CTGGGACAGGTGAAGGAGGGGGG - Intergenic
1132104105 15:99050559-99050581 CTGTTTCAGATGCAGGGGACAGG - Intergenic
1132671150 16:1102779-1102801 CTGTGGGAGGTGAGGGGGGCTGG - Intergenic
1136871659 16:33812896-33812918 CTGTGCCAGGTGGAGGGAGCAGG + Intergenic
1137245164 16:46696896-46696918 CTTTGGGAGGTGAAGGGGGCGGG - Intronic
1137725885 16:50656319-50656341 CAGTGGAAGGTGAAGGGGAGCGG - Intergenic
1138175144 16:54890566-54890588 CTGTGACAAGTGAAATGGCCTGG - Intergenic
1138543380 16:57701866-57701888 CTGTGACCGGTGGGGAGGACAGG + Intronic
1138819255 16:60238784-60238806 ATGGGACAGGTAAAGGGGACAGG - Intergenic
1139154092 16:64420057-64420079 CTGTGACTTGTGAAGTGGATTGG - Intergenic
1139244130 16:65424389-65424411 TTGAGATTGGTGAAGGGGACTGG - Intergenic
1141659727 16:85435470-85435492 CTGTGACAGATCTAGGGCACAGG - Intergenic
1141685103 16:85565697-85565719 CAGGGTCAGGTGAAGGGGTCAGG - Intergenic
1141764410 16:86049093-86049115 CAGTGACAGGTGGTGAGGACAGG - Intergenic
1203100513 16_KI270728v1_random:1303162-1303184 CTGTGCCAGGTGGAGGGAGCAGG - Intergenic
1142640687 17:1284160-1284182 GAGTGACAGCTGAAGGGGACAGG - Intronic
1143038404 17:4014755-4014777 CTGTGAAGAGTGAAGAGGACAGG + Intronic
1143269167 17:5663008-5663030 ATGTCACATGGGAAGGGGACAGG - Intergenic
1144847818 17:18229203-18229225 CTGTGAAAGGGGCAGGGGAGCGG + Intronic
1145805537 17:27725891-27725913 CTGTGAGAGGTGAAGCTGGCTGG + Intergenic
1146052072 17:29562286-29562308 CAGTGACAGGTGACAGTGACTGG + Exonic
1146994750 17:37309806-37309828 CTTTGAGAGGTGAAGGCGAGAGG + Intronic
1147112962 17:38277457-38277479 CTGTGACAGAGGAAGGAGAATGG - Intergenic
1147495312 17:40909857-40909879 CTCTGACAATTGAAGGGGGCAGG - Intergenic
1148020490 17:44549969-44549991 CTGTGACGGGGGAAGGTGAAAGG + Intergenic
1148245167 17:46025583-46025605 CTGTGACGGGAGGAGGAGACAGG - Exonic
1148416659 17:47511768-47511790 CTGTGACAGAGGAAGGAGAATGG + Intergenic
1150072527 17:62163960-62163982 CTGTGGTAGGTGAAGGGGCAAGG - Intergenic
1151106520 17:71622399-71622421 CTGTGACAGGAGATGGAAACTGG - Intergenic
1151454299 17:74216827-74216849 CTTTGACAGATGAGGGGGATTGG + Intronic
1151901354 17:77017536-77017558 CTGTGGCAGGGAGAGGGGACTGG + Intergenic
1152546944 17:81004820-81004842 GGGTGACAGCTGAAGGGTACAGG - Intronic
1203169576 17_GL000205v2_random:135556-135578 CTGTGACGGGTGAGCTGGACGGG + Intergenic
1153666314 18:7370198-7370220 CTGTGACAGGGGAAGAGGAGAGG - Intergenic
1155032526 18:21996931-21996953 CTGTGACAGGTGATTGGGAAAGG + Intergenic
1160045446 18:75382472-75382494 AAGTGACAAGTGAAAGGGACGGG + Intergenic
1160488899 18:79320316-79320338 CTCTGCCAGGGGAAGGGGAGGGG + Intronic
1160583888 18:79902270-79902292 CAGTGACAGGTCGAGGGGGCTGG + Intergenic
1160751822 19:737971-737993 CGGTGCCAGGTGGAGGGGACAGG + Intronic
1160839484 19:1139345-1139367 GAGTGACAGCTGACGGGGACAGG + Intronic
1160928816 19:1560133-1560155 CTGTGAAAGGGGAAGGTAACAGG + Intronic
1160955975 19:1691888-1691910 CTGGGACAAGTGAGGGGCACAGG - Intergenic
1161079403 19:2303108-2303130 GAGTGACTGCTGAAGGGGACGGG - Intronic
1161407404 19:4098283-4098305 GAGTGACAGCTGATGGGGACAGG + Intronic
1162063133 19:8108938-8108960 CTGTGTCATGTGCTGGGGACTGG - Intronic
1162526887 19:11211390-11211412 CCAGGACAGGTGAGGGGGACAGG - Intronic
1164889939 19:31814696-31814718 CTGTGAAATGTGAATAGGACAGG - Intergenic
1165434014 19:35787096-35787118 CAGTGACAGCTGGCGGGGACAGG - Intronic
1165476830 19:36035487-36035509 CTGTGGCAGGTGCAGGGTCCTGG + Exonic
1165936170 19:39390309-39390331 CAGTGATAGGTGGAGAGGACGGG + Intronic
1166702327 19:44889240-44889262 CTGTGGGATGTGAAGGGGATGGG + Intergenic
1166714869 19:44960564-44960586 CTCTTGCTGGTGAAGGGGACAGG + Intronic
1166759113 19:45213433-45213455 CTGGGATAGGTGAGGGGGTCAGG - Intronic
1166762125 19:45231670-45231692 GAGTGAAAGGTGGAGGGGACAGG + Intronic
1166981580 19:46634843-46634865 GAGGGACAGATGAAGGGGACAGG + Intergenic
1167608856 19:50496623-50496645 CTCTGCCTGGGGAAGGGGACAGG - Intergenic
925181922 2:1823015-1823037 CTTTCACAGGTGTAGGGGCCAGG - Intronic
926426646 2:12744371-12744393 CTGGGGCAGGTCAAGGGGCCTGG + Intergenic
929918415 2:46155073-46155095 CTGTGGAAGGTGAACAGGACTGG + Intronic
932487493 2:72093471-72093493 TGGTGACAGGAGAATGGGACTGG - Intergenic
932892992 2:75612047-75612069 ATGTTACAGGTGAGGGAGACCGG + Intergenic
935065180 2:99641166-99641188 CTCTGACAGGGGAAGGAGAAGGG - Intronic
935146269 2:100397660-100397682 CTGTGACAGGTGAGGAGAGCTGG + Intronic
936949717 2:117965756-117965778 CAGTGTCAGGTGTAGGGGGCAGG - Intronic
937417923 2:121731745-121731767 GTGAGCCAGGTGAAGGGGACAGG - Intronic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
937926324 2:127170454-127170476 GTGAGCCAGGTGAAGGGGACAGG + Intergenic
938589711 2:132724585-132724607 CTGTGATAGATGAAGGGGAAGGG - Intronic
939128054 2:138202115-138202137 ACGTGAAAGGTGAAGGGAACTGG + Intergenic
939950725 2:148469242-148469264 ATGTCACTGGAGAAGGGGACAGG - Exonic
940004031 2:148995124-148995146 CTCTGGCAGGTGAAATGGACCGG - Intronic
940911703 2:159215280-159215302 CTGTGACATGTGAAGAGGTGAGG + Intronic
940985699 2:160049953-160049975 CTGTGGCAGGGGCAGGGGAAGGG + Intronic
944661284 2:201923837-201923859 CTGGCACAGGAGCAGGGGACTGG + Intergenic
945006862 2:205417741-205417763 CAGTGAAAGGTTAAGGGGGCTGG - Intronic
946400319 2:219465139-219465161 CTGTGACGTGTGAAGAGGCCTGG + Intronic
946447127 2:219749545-219749567 TTGTTGCAGGTGAAGGGGAGAGG - Intergenic
946758761 2:222972628-222972650 CTGGGGCAGGTGAAGGGGCAGGG + Intergenic
947538197 2:230954221-230954243 CTGTGTCAGGGGAAGGGGCAAGG - Intronic
947901693 2:233726568-233726590 CTCTTACAAGTGAAGGAGACAGG - Intronic
948257625 2:236579290-236579312 CTGGGACAGGTGAGGGGGAAGGG + Intronic
1170592662 20:17782765-17782787 CTCTGCCAAGTGCAGGGGACAGG + Intergenic
1171256642 20:23693589-23693611 CTGTGACAGGAGGAGAGGGCAGG - Intergenic
1171279533 20:23884063-23884085 CTGTGACAGGAGGAGAGGGCAGG - Intergenic
1172638211 20:36424160-36424182 CTGTGACAGGTGAAGGGGACAGG + Intronic
1173571730 20:44081531-44081553 CCCTGACAGGAGGAGGGGACTGG + Intergenic
1174251962 20:49226527-49226549 CTGGGACAGGTGAAAAGGATAGG + Exonic
1174408411 20:50317964-50317986 AGCTCACAGGTGAAGGGGACAGG + Intergenic
1176008894 20:62881231-62881253 CTGAGACCGGTGAGGGGGAGGGG - Exonic
1176402179 21:6323593-6323615 CTGTGACGGGTGAGCTGGACGGG - Intergenic
1176434978 21:6665511-6665533 CTGTGACGGGTGAGCTGGACGGG + Intergenic
1176459240 21:6992581-6992603 CTGTGACGGGTGAGCTGGACGGG + Intergenic
1177752786 21:25306618-25306640 AAATGACAGATGAAGGGGACAGG + Intergenic
1178411204 21:32365068-32365090 CTGTGAGAGGAGGAGGAGACAGG + Intronic
1179707656 21:43191599-43191621 GTGTGATGTGTGAAGGGGACAGG + Intergenic
1181085308 22:20436984-20437006 CTATGACAGGCACAGGGGACCGG - Intronic
1181690612 22:24557308-24557330 GTGTGTCAGGGGAGGGGGACTGG - Intronic
1182028862 22:27141622-27141644 CTCTGACAGGTGAAGTAGCCTGG - Intergenic
1183072877 22:35408555-35408577 CTGCGACAGGTGAGGCAGACGGG + Exonic
1183107674 22:35626774-35626796 CTCTGGCAGGTGAGGGGGCCAGG - Intronic
1183166070 22:36148337-36148359 CAGTGGCAGGTAAAGGGGATGGG + Intronic
1183269166 22:36850017-36850039 CTGTGGCAGGCCAAGGAGACAGG + Intergenic
1183662485 22:39229846-39229868 GTGGCACAGGTGAAGGGTACTGG + Intronic
1183683609 22:39349672-39349694 CTGCGACCGGGGCAGGGGACCGG + Intergenic
1183770142 22:39917378-39917400 ATCTGGCAGGTGAAGGGGAGAGG - Intronic
1184270422 22:43378365-43378387 CTGTGTGAGGTGCAAGGGACAGG + Intergenic
1184557605 22:45241406-45241428 CTGTGCCAGGTGCAGAGGAGGGG - Intergenic
1185159148 22:49212488-49212510 CTGTGGCAGCTGTAGGGGAGAGG - Intergenic
1185427581 22:50781998-50782020 GTGTGTCAGGTGGAGGGGGCAGG - Intronic
950160615 3:10757982-10758004 CTGTGAGAGCTGAAGGGCTCAGG + Intergenic
950263559 3:11559300-11559322 CTGTGACAGGTGAGGAGGCCCGG + Intronic
954151351 3:48658873-48658895 CTGTCACAGGTGAGGGGCAGGGG - Exonic
955207673 3:56911209-56911231 CTGTGAGAGGTAAAGGAGAGAGG + Intronic
956601176 3:71024244-71024266 CAGTGACAGTTGAAGGAGAAAGG - Intronic
956659680 3:71584557-71584579 CAGTGACAGTTGAAGGAGAGCGG + Intergenic
959518897 3:107303421-107303443 GTTTGAAAGGTGATGGGGACAGG - Intergenic
959587248 3:108036066-108036088 CTCTCCCAGGTGAAGGGGATGGG - Intergenic
960399463 3:117178600-117178622 CTGCCTAAGGTGAAGGGGACAGG + Intergenic
960436750 3:117635498-117635520 CTGTGGCAGGTGAAGAGTTCTGG + Intergenic
961087832 3:124084315-124084337 CTGTGACAGGTCATGGTGGCTGG + Intronic
961249452 3:125488052-125488074 CTGTGACAGGTCAATGGGGAGGG + Intronic
963945816 3:151144767-151144789 CTGGGACAGGTGGTGGGGAAGGG - Intronic
964708483 3:159646551-159646573 CTGTGAAAGGTTAAGGGGAGAGG - Intronic
965520798 3:169666657-169666679 CTGGGACAGGTGGAAGTGACAGG - Intergenic
966148352 3:176838217-176838239 CAGTGGCAGGTGGAGGGGAATGG - Intergenic
967595444 3:191322615-191322637 CTATAATAGCTGAAGGGGACTGG + Intronic
967741726 3:193010441-193010463 CTGTCAAGGCTGAAGGGGACAGG + Intergenic
967772053 3:193344666-193344688 GAGTGACATGTGAAGGGGAGAGG + Intronic
968252247 3:197230396-197230418 ATGTGACAGGTGAAGGAGTTTGG - Intronic
968272652 3:197416453-197416475 CTGGGACAGGGTAAGGGGAGAGG - Intergenic
968651260 4:1761152-1761174 CAGTGACAGGAGATGGGGGCGGG - Intergenic
968772202 4:2514587-2514609 CTGTGCCAGGTGAAGGACGCTGG - Exonic
968836005 4:2964326-2964348 CTGGGCCAGGAGATGGGGACTGG - Intronic
968884275 4:3318882-3318904 TTGTGACAGGTGATGGGGGTGGG + Intronic
969238792 4:5886703-5886725 CTGAGGCAGGTGATGGGGTCGGG - Intronic
969295642 4:6269538-6269560 CTGTTACAGGAGAAGGCGAGCGG + Intergenic
970597966 4:17617128-17617150 CTTAGCCAGGTGAAGGGGAGTGG + Intronic
973122968 4:46545619-46545641 CTGTGACAGTAGAAGAGGCCAGG - Intergenic
975613162 4:76221154-76221176 TTGTGGCAGGGGAAGGGGACAGG + Intronic
976359436 4:84160309-84160331 CTTTGACAGGTGATGGGTGCTGG - Intergenic
978378975 4:108106391-108106413 GTGTGCCGGGTGAAGGGGAAAGG + Intronic
980289882 4:130832991-130833013 CTCTGACTGGTGATGGGGAAAGG - Intergenic
980500706 4:133649278-133649300 CTGTGTAAGGTGAAAGGTACGGG + Intergenic
981170349 4:141615797-141615819 CTGTGAGAGGTGAAGCCGGCTGG + Intergenic
982046939 4:151457565-151457587 ATGTGACAGGTGGAGGGAAAAGG - Intronic
984282209 4:177683986-177684008 CTGTGACTGGAGAAGAGCACAGG - Intergenic
985708459 5:1414895-1414917 CTGTGTCTGGGGAAGGGGGCGGG + Intronic
986703032 5:10430170-10430192 TTGTGACATGTGAAGGAGAGTGG + Intronic
989724668 5:44574185-44574207 TAGGGAGAGGTGAAGGGGACTGG + Intergenic
992610659 5:78505453-78505475 GTGTGTCAGGGGAAGGGGAGGGG + Intronic
992660948 5:78960044-78960066 CTGTGACAGTTGATGAGAACAGG - Intronic
993469470 5:88289048-88289070 CTGCTACACGTGAAGGGGATGGG - Intergenic
996416326 5:123214566-123214588 CTGTGGGAGGTGAAGGAGAGGGG - Intergenic
997295017 5:132763678-132763700 CTGTGACAGCAGGTGGGGACAGG + Intronic
997622766 5:135309642-135309664 CTGTGAAATGTGAGAGGGACAGG + Intronic
998152156 5:139763665-139763687 CTGTGCCAGGCCGAGGGGACTGG - Intergenic
998656517 5:144186914-144186936 CTGTGCCAGGTGCTGGGGATGGG + Intronic
1001084697 5:168692115-168692137 CTGTTGCAGGGGAAGGGGGCAGG - Intronic
1001247896 5:170118786-170118808 CTGTCACAGGTGAGGGGGCAAGG + Intergenic
1001519632 5:172381840-172381862 GTTTGACAGGTGAAGGAAACTGG - Intronic
1001527026 5:172436393-172436415 CTGTGGCCGGTGAAGGAGCCCGG - Intronic
1001714347 5:173802775-173802797 CTGAGATATGAGAAGGGGACAGG - Intergenic
1002789132 6:424849-424871 CTGGGACAGAGGAAGGGGCCAGG + Intergenic
1002953551 6:1840110-1840132 CTGTGACATTTGAAGTGCACTGG - Intronic
1003338363 6:5196195-5196217 CTGCGCCAGATGATGGGGACTGG - Intronic
1005215370 6:23521285-23521307 CTGAGAGAGGTGAAGGGGCAGGG - Intergenic
1005947754 6:30606688-30606710 CTGTCAGAGGTGAAGCAGACTGG + Intronic
1006362646 6:33595353-33595375 CAGTGGCAGGTGGAGTGGACAGG + Intergenic
1006365783 6:33614373-33614395 CTGGGGCCGGGGAAGGGGACTGG - Intergenic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006429904 6:33989038-33989060 GTGTCACAGGGGACGGGGACTGG - Intergenic
1006713100 6:36092855-36092877 CTGTGGAAGGTGCTGGGGACAGG + Intronic
1007120741 6:39378659-39378681 ATGTGTCAGGTGAGAGGGACAGG - Intronic
1007174294 6:39885623-39885645 CTCAGAGAGGTGAGGGGGACAGG - Intronic
1007966537 6:46008549-46008571 CTGTGAAAGCTGAAGGGGGCTGG - Intronic
1010678790 6:78775258-78775280 CTGTGAAAGACAAAGGGGACAGG + Intergenic
1010987393 6:82440482-82440504 GTGTGACAGATGAAGGTTACTGG + Intergenic
1011419409 6:87155751-87155773 CTGTGCCAGGTGAGGGCGCCCGG + Exonic
1013016345 6:106163917-106163939 CTGTCACAGTAGGAGGGGACGGG - Intergenic
1014206102 6:118657021-118657043 CTGTGAAAGATGAAAGGCACAGG - Intronic
1014456593 6:121642063-121642085 ATATGGCAGCTGAAGGGGACTGG + Intergenic
1015217685 6:130768723-130768745 ATGTGAAAGATGAAGGGGAATGG - Intergenic
1016801582 6:148174341-148174363 CTGTGACATGAGAGGGGGATGGG - Intergenic
1018174781 6:161169068-161169090 CTGTGACCACTGAAGGGGAGAGG + Intronic
1018219838 6:161566780-161566802 GTGTGACTGGTGGAGGGGAGGGG - Intronic
1019175867 6:170159287-170159309 CAGTGGCAGGTGAAGGGGCTGGG - Intergenic
1019221339 6:170475172-170475194 CTGTGACTGGTGCAGGGGGCCGG + Intergenic
1019479567 7:1260273-1260295 CAGGGACAAGTGGAGGGGACGGG - Intergenic
1020127629 7:5541782-5541804 CCGTGCCAGGTGCTGGGGACAGG + Intronic
1021006124 7:15397066-15397088 CAGTGACAGGTGAAGCCAACTGG - Intronic
1021955870 7:25823813-25823835 CTATGATAGATGAAGGGGCCAGG - Intergenic
1026252734 7:68685112-68685134 CTTTGACAGGTGCCGGGGAAGGG - Intergenic
1027263052 7:76478707-76478729 CTGAAAGAGGTCAAGGGGACTGG - Intronic
1027314435 7:76976812-76976834 CTGAAAGAGGTCAAGGGGACTGG - Intergenic
1029154788 7:98508718-98508740 ATGTGGCAGATGAATGGGACAGG + Intergenic
1029217215 7:98959238-98959260 CTGAGACAGGTGTAAGGGCCAGG + Intronic
1030796793 7:113798714-113798736 CTGTGAAAGATAAAGGGGAAAGG + Intergenic
1031846006 7:126806672-126806694 CAGTGACAGGTGAAGCCGGCTGG - Intronic
1031895758 7:127346823-127346845 CTGTGAAAGGAGAGGGGAACTGG + Intronic
1032416769 7:131741550-131741572 CCGTGACAGGAGTAGGGGATTGG - Intergenic
1032938419 7:136760858-136760880 CAGTGGAAGGTGAAGGGGAGTGG - Intergenic
1033049202 7:137988848-137988870 CTTTGAGAGGTGGAGGGGGCAGG + Intronic
1033311634 7:140265992-140266014 CTTTGAGAGGTGAAGGCGAGTGG - Intergenic
1033439174 7:141363188-141363210 TTGTGACTTGTGAATGGGACTGG + Intronic
1033560321 7:142524730-142524752 ATGTGACAGGTAAAGTGTACAGG - Intergenic
1034422712 7:150997810-150997832 CAGTGACAGGGGCAGGGGAGTGG - Intronic
1034697800 7:153069475-153069497 CTGTGAGTTGTGAAGGGAACAGG + Intergenic
1034923467 7:155102295-155102317 ATGTTACAGGTGAAGGGGAATGG - Intergenic
1035578350 8:723486-723508 ATATGACAGGTGAAGGAGGCAGG - Intronic
1036543389 8:9741436-9741458 CTGTGAAAGGTGAAGGCTAATGG - Intronic
1039290148 8:36085888-36085910 GTGTGGCAGGGGAAGGGAACAGG + Intergenic
1040638808 8:49306613-49306635 CAGTGAGAGGTGAAGCCGACTGG + Intergenic
1042555802 8:70033065-70033087 CTGCGCCAGGTGGAGGGGAAGGG + Intergenic
1043850135 8:85206448-85206470 GTGTGGAAGGGGAAGGGGACAGG + Intronic
1044803010 8:95976365-95976387 CTGAGACAGGTGAAAGGGGCTGG - Intergenic
1045412432 8:101932190-101932212 CTGTGGCAGGGGAGGGGGCCTGG - Intronic
1047451032 8:124965144-124965166 CACTGACAGGAGATGGGGACGGG - Intergenic
1047694607 8:127391098-127391120 GTGTGTCAGGGGAAAGGGACCGG + Intergenic
1049568401 8:143355720-143355742 CTCTGACAGGTGCAGAGGTCCGG - Intronic
1049655638 8:143795730-143795752 CTGTGAGCTGTGATGGGGACCGG - Intronic
1049738193 8:144221256-144221278 ATGTGACAGGTGGAGGCTACGGG - Intronic
1050351699 9:4746018-4746040 CAGTTAAAGGTGGAGGGGACAGG - Intergenic
1050929653 9:11307512-11307534 CTGTGACATGTGCAGATGACTGG - Intergenic
1052399274 9:27980006-27980028 TATTGACATGTGAAGGGGACAGG + Intronic
1053177975 9:35943124-35943146 GTGTGACATGTGCAGGGGGCAGG + Intergenic
1057097713 9:92326978-92327000 CTGTGACTGGTTAAAGGGAGAGG + Intronic
1057410189 9:94811018-94811040 ATGTGACAGGGGTAGGGGGCAGG - Intronic
1057453077 9:95182879-95182901 CTGGGACAGGGGAAGGTGACTGG + Intronic
1059305332 9:113349543-113349565 CTGCGACAGGTGGAGCGCACGGG + Exonic
1060158638 9:121338935-121338957 GTGGGCCAGGGGAAGGGGACAGG - Intergenic
1060408215 9:123383072-123383094 CTGGGCCAGGAGAAAGGGACTGG - Intronic
1061026350 9:128052162-128052184 CTGTCCCAGGTCCAGGGGACAGG + Intergenic
1061412563 9:130429440-130429462 CTGAAACTGGAGAAGGGGACAGG + Intronic
1061453742 9:130682472-130682494 ATGTCACAGCTGAAGGGGAGGGG - Exonic
1203436558 Un_GL000195v1:143136-143158 CTGTGACGGGTGAGCTGGACGGG - Intergenic
1185859996 X:3569006-3569028 GTGTGATGGGTGCAGGGGACAGG - Intergenic
1187694726 X:21907872-21907894 CTGAGACAGGTGAATGTGACAGG + Intergenic
1189289982 X:39878129-39878151 CTGGGAGAGGTGGGGGGGACGGG - Intergenic
1189401623 X:40674736-40674758 CTCAGACATGTGAAGGTGACAGG + Intronic
1190056858 X:47186180-47186202 CTGGGCCAGGTGAGGGGGTCTGG + Intronic
1190335215 X:49257989-49258011 ATGTGACAAGAGAAGAGGACTGG - Intronic
1190551868 X:51591228-51591250 CTTTGACATGGGAATGGGACTGG - Intergenic
1190735994 X:53256329-53256351 CTGTGAGGGGTGAGGAGGACTGG - Intronic
1192321859 X:70096263-70096285 ATGTGCCAGGTGAAGGAGACTGG - Intergenic
1192442995 X:71188797-71188819 CTGTGAGAGGTCAAGGTGAATGG + Intergenic
1194464698 X:94219144-94219166 CAGTGAAAGGTGAGGGGGATAGG - Intergenic
1194703381 X:97143986-97144008 CTGGGAAAGGTGAAGGGTAGGGG + Intronic
1195615940 X:106911886-106911908 CTATGACAGGTGCATGGGCCAGG + Intronic
1196739275 X:119010179-119010201 ATGTGAGAGGTGAAGGGGAGGGG + Intronic
1197941788 X:131797817-131797839 CTGTACCAGGAGAAGGGAACTGG - Intergenic
1198279415 X:135126907-135126929 GTCTGTCAGGGGAAGGGGACAGG + Intergenic
1198291541 X:135245607-135245629 GTCTGTCAGGGGAAGGGGACAGG - Intergenic
1198494401 X:137176914-137176936 CTGTATCAGGTGCTGGGGACAGG + Intergenic
1199265728 X:145823428-145823450 CTGGGACAGGTGAGAGGCACAGG - Exonic
1199460753 X:148082155-148082177 ATGTGCCAGGTGCAGGGCACTGG - Intergenic
1200805101 Y:7425313-7425335 GTGTGATGGGTGCAGGGGACAGG + Intergenic
1201595137 Y:15659881-15659903 AGTAGACAGGTGAAGGGGACAGG - Intergenic