ID: 1172639262

View in Genome Browser
Species Human (GRCh38)
Location 20:36431224-36431246
Sequence CAGAGCTAGGAGATGTGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 326}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172639250_1172639262 18 Left 1172639250 20:36431183-36431205 CCATCCTGGGGTTCCGGGATGAC 0: 1
1: 0
2: 0
3: 15
4: 123
Right 1172639262 20:36431224-36431246 CAGAGCTAGGAGATGTGGGCTGG 0: 1
1: 0
2: 1
3: 41
4: 326
1172639251_1172639262 14 Left 1172639251 20:36431187-36431209 CCTGGGGTTCCGGGATGACTGTT No data
Right 1172639262 20:36431224-36431246 CAGAGCTAGGAGATGTGGGCTGG 0: 1
1: 0
2: 1
3: 41
4: 326
1172639256_1172639262 5 Left 1172639256 20:36431196-36431218 CCGGGATGACTGTTTGGGGGCCT 0: 1
1: 0
2: 0
3: 12
4: 97
Right 1172639262 20:36431224-36431246 CAGAGCTAGGAGATGTGGGCTGG 0: 1
1: 0
2: 1
3: 41
4: 326
1172639247_1172639262 27 Left 1172639247 20:36431174-36431196 CCACAGGGACCATCCTGGGGTTC 0: 1
1: 0
2: 1
3: 43
4: 222
Right 1172639262 20:36431224-36431246 CAGAGCTAGGAGATGTGGGCTGG 0: 1
1: 0
2: 1
3: 41
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172639262 Original CRISPR CAGAGCTAGGAGATGTGGGC TGG Intronic
900238001 1:1601541-1601563 CAGAGGTGGGAGCTGGGGGCAGG - Intergenic
901661989 1:10804381-10804403 CAGATCTGGGAGAGGTGGGAGGG - Intergenic
902410611 1:16209745-16209767 CAGAGCAAGGACCTGTGGGCTGG - Intronic
902823390 1:18956734-18956756 CAGAGGGAGGAGGGGTGGGCGGG - Intergenic
903191243 1:21657599-21657621 TGGAGGTAGGAGATGGGGGCTGG - Intronic
903797646 1:25941911-25941933 CAGAAGTAGAAGATTTGGGCCGG - Intergenic
903807026 1:26012882-26012904 CAGAGGTGGGAGCTGAGGGCAGG - Intergenic
903810172 1:26030957-26030979 CAGAGGTGGGAGATGGTGGCAGG - Intronic
904036569 1:27562166-27562188 CAGAGCTGGGATGTGTGGGCAGG + Intronic
904443089 1:30544781-30544803 CAGGGCCACCAGATGTGGGCTGG - Intergenic
905631743 1:39522768-39522790 CAGCTCTGGGAGGTGTGGGCAGG + Intronic
907650342 1:56288785-56288807 CAGAGCCAGGTTATGTGGGGAGG + Intergenic
908943057 1:69459751-69459773 CAGTGCTGGGACATGTGGGCAGG - Intergenic
909054520 1:70806224-70806246 CAGGGCTAGGAGCCATGGGCTGG - Intergenic
909144468 1:71912306-71912328 CAGAGTTATGAGATGTGGGAAGG - Intronic
912755938 1:112325003-112325025 CAGAGCTTGGACATGCGGGCTGG - Intergenic
913158217 1:116121107-116121129 CAGAGCCAGGACACTTGGGCAGG + Intronic
914682303 1:149947175-149947197 CAGAACAAGGAGATCTGGGATGG - Intronic
915345969 1:155197100-155197122 CAGACCCACGAAATGTGGGCTGG - Exonic
916511588 1:165476572-165476594 CAGGGTTAGGAGCTCTGGGCAGG - Intergenic
918055980 1:181022569-181022591 AAGACCTAGGAGGTGCGGGCAGG + Intronic
919813060 1:201421036-201421058 CAGAGCCAGGAGCTCTGAGCAGG + Intronic
920867893 1:209768541-209768563 CAGAGAGATGAGCTGTGGGCTGG + Intronic
921620403 1:217320065-217320087 TAGAGCTAGGATACATGGGCAGG + Intergenic
921810846 1:219511918-219511940 CAGAGGTAGGAGATGTGGAGAGG + Intergenic
922556295 1:226534977-226534999 GAGAGCTGAGAGATGGGGGCGGG + Intergenic
923688668 1:236172486-236172508 CTGAGCTAGCAGATGTGGGAGGG - Intronic
924201434 1:241663380-241663402 AAGAGCTTAGACATGTGGGCCGG - Intronic
924323776 1:242875144-242875166 CATAGCTAGGAAATGAGGCCGGG + Intergenic
924657337 1:245984899-245984921 CAGAGCAAGGAGAAGTCGGATGG - Intronic
1065022417 10:21510819-21510841 CAGATCTAGGAGGTGGGGGAGGG - Intergenic
1068317556 10:55366018-55366040 CAAAGCTAGGAGATATGGAAGGG + Intronic
1068944602 10:62717179-62717201 CAGAGGTAGAAGCTGCGGGCTGG + Intergenic
1069510368 10:69037658-69037680 CAGAGCCCGGAGATGCAGGCAGG + Intergenic
1069898072 10:71691128-71691150 CTGAGCTGGGAGCTGGGGGCAGG - Intronic
1069937081 10:71925068-71925090 CAGAGGACAGAGATGTGGGCAGG + Intergenic
1071471111 10:85984539-85984561 TGGAGCTGGGAGAGGTGGGCAGG + Intronic
1072751034 10:97979004-97979026 CTGAGTGAGGAGATGGGGGCAGG + Intronic
1073318238 10:102597793-102597815 CAGGGTTAGGGGCTGTGGGCAGG + Intronic
1073447611 10:103590780-103590802 CTGAGCCAGGACATGTGGCCTGG + Exonic
1074432270 10:113404166-113404188 CAGAGCTGGGAGCTGGGAGCTGG + Intergenic
1074666482 10:115731823-115731845 CAGGGCTAGGAGATGGGTGTGGG - Intronic
1074921067 10:118012925-118012947 CAGACATAGAAGATGTGGACTGG + Intronic
1075825223 10:125350720-125350742 CAGAGATAAGATATTTGGGCTGG - Intergenic
1076031183 10:127160011-127160033 CAGAGCTTGGATATGTGGCCGGG - Intronic
1076168887 10:128303913-128303935 CAGAGCATGGGGATGTGGTCAGG - Intergenic
1077238999 11:1500906-1500928 CAGAGCGAGGGGAAGTGGGGAGG - Intronic
1077241439 11:1512731-1512753 CAGCGCTAGGAGGTGGGGCCTGG + Intergenic
1078879254 11:15431937-15431959 CAGAGGTAGGAGTCCTGGGCTGG - Intergenic
1079006307 11:16793704-16793726 AAGAAATAGGAGATGTGGTCAGG - Intronic
1080898320 11:36463975-36463997 GAGAGAGGGGAGATGTGGGCAGG + Exonic
1083717512 11:64586362-64586384 CAGGGCTAGGGGATTAGGGCAGG - Intergenic
1083843082 11:65315523-65315545 CAGAGCTTGGAGACTAGGGCAGG + Intronic
1083990820 11:66244666-66244688 CAGAGAGAGGAGATGGGGGTGGG + Exonic
1084357209 11:68647878-68647900 CTGGTCTAGGAGATTTGGGCAGG + Intergenic
1084421196 11:69061529-69061551 CAGAGAGAGGAGGTGGGGGCAGG + Intronic
1084429057 11:69101348-69101370 TAGACCTAGCAGATGAGGGCAGG + Intergenic
1084578448 11:70006443-70006465 CAGAGGTAGGGGAGGTGGGTGGG - Intergenic
1084889621 11:72230284-72230306 CAGACCTGGGAGGGGTGGGCAGG + Intronic
1085409850 11:76284474-76284496 CATAGCTGGTAGAGGTGGGCAGG - Intergenic
1085413228 11:76303932-76303954 CACAGTAAGAAGATGTGGGCTGG + Intergenic
1085743814 11:79098222-79098244 CTGAGCTGGGAGATGGGGGGGGG - Intronic
1088510084 11:110565192-110565214 GAGAGGGAGGAGATGAGGGCAGG + Intergenic
1088630774 11:111772019-111772041 CAGAGGTAGGAGATGGAGGAGGG - Intergenic
1088925013 11:114293215-114293237 CAGACCTAGGAGATGTAGAATGG - Intronic
1088981697 11:114870423-114870445 CAGAGATAGGAAATGTAGTCAGG + Intergenic
1089151987 11:116371491-116371513 CAGAGGCAGGGGATGGGGGCAGG + Intergenic
1089555937 11:119316056-119316078 CAGAGCTAGAAGAGCAGGGCAGG + Intronic
1089827928 11:121295750-121295772 CAGAGCTAGCAGATTTGGGTAGG - Intronic
1091306744 11:134541271-134541293 CAGACCGAGGAGCTGTGGGCTGG - Intergenic
1091344879 11:134845940-134845962 CAGTGCTGGGAGATTGGGGCAGG - Intergenic
1093284985 12:17247812-17247834 CTGAGCAAGGTGATGTGAGCTGG + Intergenic
1096252917 12:50044796-50044818 TAGAGGTAGGAGATGGAGGCCGG - Intergenic
1096559668 12:52426523-52426545 GGGAGGTAGGAGATGTGGCCAGG + Intronic
1098566625 12:71944583-71944605 CAGAGCTAGAGGATGTGCCCTGG + Exonic
1098721961 12:73911756-73911778 CAGAGCTAGGAGGGGTGGGGTGG - Intergenic
1102310440 12:111840900-111840922 ATGAGGTTGGAGATGTGGGCAGG - Intergenic
1102904450 12:116663332-116663354 CAGAGCAGGGAGAGGTGGGGAGG - Intergenic
1103038494 12:117675557-117675579 GAAAGCTGGGAGAGGTGGGCTGG - Intronic
1103271460 12:119677194-119677216 CAGAGCTAGGCGGACTGGGCAGG - Intronic
1104390981 12:128390414-128390436 CAGAGCTGGCAGCTGTGGGTGGG + Intronic
1104502434 12:129299141-129299163 CAGAGCCATGAGATGTTGGCTGG + Intronic
1104774843 12:131384973-131384995 CAGAGATGAGAGATGTGGGGAGG + Intergenic
1104894975 12:132159579-132159601 CAGGGCATGGAGATGTGGGCGGG + Intergenic
1104917882 12:132275354-132275376 CAGAGCCAGGAGAGGTTGGCTGG + Intronic
1105438220 13:20395163-20395185 CAGAGCTAGGCTATGTGCCCAGG + Intergenic
1105658657 13:22469006-22469028 CACAGCAAGAAGATGTGGTCTGG + Intergenic
1106917703 13:34532765-34532787 TAGAGATAAGAGATTTGGGCTGG - Intergenic
1107900160 13:45004476-45004498 CAGAGCTAGTATAAGTTGGCTGG + Intronic
1110405067 13:75141838-75141860 CAGAGCTCTGAGAAGTAGGCAGG + Intergenic
1112492169 13:99876990-99877012 CAGGGCTGGGGGATGAGGGCAGG - Intronic
1117542241 14:56759498-56759520 CACAGCTTGGAGATGAGGGCTGG + Intergenic
1118615558 14:67572384-67572406 TAGAGCTGGGGGATGGGGGCAGG + Intronic
1118821353 14:69348108-69348130 CAGAGCGAGGATCTGTGGGGAGG + Intronic
1119199344 14:72741434-72741456 CAGAGCAAGGATATTTGGACAGG + Intronic
1120720235 14:87882584-87882606 GAGTGGTAGGAGAAGTGGGCAGG - Intronic
1120977383 14:90261088-90261110 CTGAGGTCGGAGAGGTGGGCTGG - Intronic
1121078439 14:91088611-91088633 CAGAGATAGGGGTTGTGGTCAGG + Intronic
1121909109 14:97772959-97772981 CTGAGGCAGGAGAGGTGGGCAGG + Intergenic
1124507621 15:30291964-30291986 CTGAGCTAGTAGTGGTGGGCAGG - Intergenic
1124735935 15:32246694-32246716 CTGAGCTAGTAGTGGTGGGCAGG + Intergenic
1125737541 15:41937821-41937843 CAGAGCTAGGAAATGGGGCCTGG - Intronic
1127882923 15:63174060-63174082 CAGCGCTTGGACATATGGGCTGG - Intergenic
1127915578 15:63452272-63452294 CAGATTTAGGAGATGGGTGCTGG + Intergenic
1128034661 15:64514108-64514130 CAGAGATAGGAGATTTGAACTGG - Intronic
1128513156 15:68326058-68326080 CAGAGTTCAGAGATGTGAGCAGG - Intronic
1128688025 15:69701358-69701380 CAGAGCTTGGAGAACTGGGATGG + Intergenic
1129314410 15:74732513-74732535 CAGATCTGGGAGATGAGGGGAGG + Intergenic
1129385555 15:75194251-75194273 CAGAGCAGAGAGATGTGGCCAGG + Intergenic
1129797255 15:78387227-78387249 CAGACCTAGGAGAAGTGGGAAGG + Intergenic
1129852125 15:78799310-78799332 CAGAGCTGGGAGAGTGGGGCTGG + Intronic
1130250878 15:82299777-82299799 CAGAGCTGGGAGAGTGGGGCTGG - Intergenic
1130879270 15:88041197-88041219 CAGAGCTATTTTATGTGGGCTGG - Intronic
1131294925 15:91139452-91139474 CAGAGCTGGGAAATGGAGGCAGG + Intronic
1131399743 15:92114850-92114872 CAGAGCTGGGAGGTGAGGGAGGG - Intronic
1131669022 15:94599735-94599757 CAGAGCTAGGAGGGAGGGGCAGG + Intergenic
1132048132 15:98582789-98582811 CAGAGCTAGGGGCCGTGGGGTGG - Intergenic
1133371462 16:5248691-5248713 CAGAGTTAGGACAAGAGGGCCGG + Intergenic
1133588601 16:7220273-7220295 CAGAGCCAGGAAAAATGGGCAGG - Intronic
1136421317 16:30135317-30135339 CAGAGCTGGAGGCTGTGGGCTGG + Intergenic
1136580918 16:31150232-31150254 CAGAGACATGAGATGTGCGCAGG - Intergenic
1136777230 16:32878522-32878544 CAGAACCTGGAGAGGTGGGCAGG + Intergenic
1136893393 16:33982991-33983013 CAGAGCCTGGAGAGGTGGGCAGG - Intergenic
1137839210 16:51624519-51624541 CAGAGCGAGGACATCTGGACGGG + Intergenic
1138194193 16:55040486-55040508 CAAAGCTAGGAAAGGTGGGAGGG - Intergenic
1138497888 16:57419327-57419349 CAGTGCCAAGAGCTGTGGGCTGG + Intergenic
1139256336 16:65546533-65546555 CAGAATTAAGAGATGGGGGCAGG - Intergenic
1139975342 16:70805508-70805530 CCGATCTAGGAGATTTGGGTGGG - Intergenic
1140126123 16:72120308-72120330 CAGAGCTGGCAGAGTTGGGCAGG - Intronic
1140229500 16:73105938-73105960 CAGAGGTAGGAGATGGGGCGGGG - Intergenic
1140508710 16:75491992-75492014 CAGAGTTGGCAGATGTGGCCAGG - Intronic
1141665712 16:85464123-85464145 CAGAGAGAGGAGGGGTGGGCGGG - Intergenic
1142122942 16:88396278-88396300 CAGAGCCAGGAGATGAAGACAGG - Intergenic
1142236951 16:88926916-88926938 CAGAGAAAGGAGATGAGGGCAGG - Intronic
1203079644 16_KI270728v1_random:1140631-1140653 CAGAGCCTGGAGAGGTGGGCAGG + Intergenic
1142472985 17:173358-173380 CAGAGCTTGGAGATGATGGTGGG + Intronic
1142505028 17:357831-357853 AAGAGCTAGGGGAACTGGGCAGG - Intronic
1143554103 17:7650327-7650349 CAGAGCCAGGTGGTGTGGACAGG + Intronic
1143732500 17:8888983-8889005 CAGTGCTAGGAGTCCTGGGCTGG - Intronic
1145994234 17:29096427-29096449 CAGAGCTGGGGGCTGAGGGCAGG + Intronic
1146652726 17:34616479-34616501 CAGAGCAAGGACATGTAGCCGGG - Intronic
1147581948 17:41631984-41632006 CCGAGCAAGGAGATGGGGGCTGG - Intergenic
1147924166 17:43936347-43936369 AAGAGCTTGGGGATGGGGGCTGG + Intergenic
1148052912 17:44777917-44777939 CAGGGCCAGGAGAGGTGAGCAGG - Intronic
1148110119 17:45139550-45139572 CAGAGCTAGGAGTTGAGGAGAGG - Intronic
1148392069 17:47279918-47279940 AAGGGGTAGGAGAGGTGGGCAGG + Intronic
1148646127 17:49220388-49220410 CAGATCCAAGAGAGGTGGGCTGG - Intronic
1149788220 17:59454453-59454475 CAGTGTTAGGTGATGTTGGCTGG - Intergenic
1151380748 17:73724214-73724236 CAGTGCTAGGAGAGGGAGGCTGG + Intergenic
1151542842 17:74773543-74773565 CAGGGCTAGGGGAAGTGGGGGGG + Intronic
1152103802 17:78317625-78317647 CAGAGCTGGGAGAGTTGGGGTGG + Intergenic
1152427416 17:80225748-80225770 CAGCCCTAGGGGAGGTGGGCGGG + Intronic
1152878122 17:82800010-82800032 CAGAGCAGGGGGATGGGGGCTGG - Intronic
1156453086 18:37277584-37277606 AAGAGCTGGGAGAAGAGGGCTGG + Intronic
1159355909 18:67337357-67337379 CAGGGCCAGGAGCTGTGGGCTGG - Intergenic
1160014575 18:75130710-75130732 CTGAGCAATGAGATGTGTGCAGG - Intergenic
1160196100 18:76756897-76756919 CAGAGCTGCGAGATGGGGCCTGG + Intergenic
1160892712 19:1387707-1387729 CAGAGCTAGGCTGTGCGGGCAGG + Intronic
1160942460 19:1626853-1626875 GAGAGCTAGGAGCTGACGGCGGG + Intronic
1161300023 19:3538025-3538047 CAGAGTGAGGAGAGGAGGGCAGG + Intronic
1161767215 19:6214396-6214418 CAGTGCTGGGAGAAGAGGGCAGG - Intronic
1163673340 19:18642222-18642244 AAGAGGAAGGAGACGTGGGCAGG - Intronic
1165096177 19:33411088-33411110 CACGACAAGGAGATGTGGGCAGG - Intronic
1165492805 19:36134900-36134922 CAGGGCGAAGAGATGAGGGCAGG + Intergenic
1165789508 19:38483151-38483173 CTGAGGCAGGAGATGTGGGGAGG + Intronic
1166343750 19:42152866-42152888 CAGAGCTCTGGGAGGTGGGCAGG + Intronic
1166699120 19:44871945-44871967 GAGAGCCAGGAGATCCGGGCAGG - Exonic
1167143759 19:47670347-47670369 CAGAGCTATGGGATGTAGGTGGG - Intronic
1167200416 19:48061487-48061509 CAGAGCTGGGATATGAAGGCAGG + Intronic
1167292051 19:48629831-48629853 CTGAGCTAGGGGGTGTGGCCTGG + Exonic
1167595885 19:50427931-50427953 CAGATCCAGGAGATGGAGGCCGG + Intronic
1167679214 19:50909222-50909244 CAGAGGTAGGGGGAGTGGGCAGG - Intronic
1168578310 19:57532439-57532461 GAGAGCAAGGACCTGTGGGCAGG + Intronic
925405403 2:3602749-3602771 CAGTGCGGGGAGAGGTGGGCTGG - Intronic
925725451 2:6866261-6866283 CAGAGCTAGGAGTTGAGGTCGGG - Intronic
926731731 2:16040692-16040714 GAGACCCAGGAGAGGTGGGCAGG + Intergenic
928653464 2:33425624-33425646 CATGGTCAGGAGATGTGGGCTGG + Intergenic
929033268 2:37668504-37668526 CAGAACTAGGACATGTGCCCAGG + Intronic
929760749 2:44804342-44804364 CAGAGCGAGGAGATTTAGGCTGG - Intergenic
931732388 2:65164830-65164852 GAGAGCTGGGGGAAGTGGGCAGG + Intergenic
932412265 2:71554520-71554542 CAGTGCAAGGAGATGGGGGGTGG + Intronic
932738900 2:74276755-74276777 CAGAGGTAGGAGGTATGGGGAGG - Intronic
933124459 2:78586725-78586747 GAGAACTAGGACATGTGGGAAGG + Intergenic
934922833 2:98359733-98359755 CAGAGCCTGGAGATGTGGCCAGG - Intronic
935786028 2:106549679-106549701 CAGGGCAAGGAGAGGTGGGAGGG + Intergenic
936934021 2:117820471-117820493 CAGAGCTAGGAGCAGTCTGCTGG + Intronic
938226905 2:129624415-129624437 CAGACCTAGGAAAACTGGGCTGG - Intergenic
940052730 2:149480873-149480895 CTGAGGTAGGTGATGGGGGCTGG - Intergenic
942126252 2:172828514-172828536 CACAGCTAGGAGCTGTGAGATGG - Intronic
942672407 2:178390378-178390400 CAGAGCTTAGATGTGTGGGCTGG - Intronic
943636030 2:190307932-190307954 CAGAGTTATGAGAAGTGGACAGG - Intronic
946169713 2:217887602-217887624 AAGAACTAGGGGATGTTGGCTGG - Intronic
946192708 2:218015909-218015931 CAGACCTAGGAGCTGGGCGCTGG + Intergenic
946385992 2:219384864-219384886 CAGAGATTGGAGAAGGGGGCTGG + Intronic
947148004 2:227086283-227086305 CAGAGAGAGGAGATGTAGGGAGG + Intronic
947551727 2:231051310-231051332 CAGAGCAAGGGGCTGGGGGCGGG - Intergenic
947738572 2:232473938-232473960 CAGAGCTAGGAGGTTTAGGATGG + Intergenic
948009684 2:234641555-234641577 CAGAGCTAAAAGATCTGGGCTGG - Intergenic
948090392 2:235288734-235288756 CAGAATTAGGAGATTGGGGCCGG - Intergenic
948217102 2:236239970-236239992 CACAGCAAAGGGATGTGGGCTGG - Intronic
948977738 2:241473767-241473789 GAGAGCCAGGGGATGGGGGCAGG + Intronic
1168897512 20:1333946-1333968 CAGGGGTAGCAGATGTGGCCTGG + Intronic
1171238553 20:23547193-23547215 CTGATCTGGGAGATGTGGACAGG + Intergenic
1171243081 20:23587079-23587101 CTGATCTGGGAGATGTGGACAGG - Intergenic
1171374608 20:24683878-24683900 CAGGGTTAGAGGATGTGGGCTGG + Intergenic
1172124766 20:32618957-32618979 CACAGCTAGGAAATGGTGGCTGG + Intergenic
1172639262 20:36431224-36431246 CAGAGCTAGGAGATGTGGGCTGG + Intronic
1172979395 20:38929438-38929460 CAGACCTAGGGTATGGGGGCTGG + Intronic
1173823334 20:46032083-46032105 CCGGGCCAGGAGATGAGGGCAGG - Intronic
1174292879 20:49521444-49521466 CAGGGCCAGGAGAGCTGGGCAGG - Intronic
1175525637 20:59631526-59631548 CAGAGGCAGGAGGGGTGGGCAGG + Intronic
1175999409 20:62825276-62825298 CAGAGCTGGGTGATTTAGGCAGG + Intronic
1176430143 21:6570247-6570269 CAGGGGCAGGAAATGTGGGCGGG + Intergenic
1177013331 21:15754303-15754325 CAGAGCCTGCAGATGTGAGCTGG - Intronic
1177087100 21:16719201-16719223 GAGAGCTAGGACATGGAGGCAGG + Intergenic
1177782854 21:25639383-25639405 CAGGGCGAGGAGCTGGGGGCGGG - Exonic
1178376393 21:32071021-32071043 CAGAGGCAGGAGGTGAGGGCAGG - Intergenic
1178740065 21:35191189-35191211 CTGAGCAAGGAGATGTGTGGAGG - Intronic
1178817279 21:35943195-35943217 CAGACCCAGGAGAGGTGGGGAGG - Intronic
1179705537 21:43177709-43177731 CAGGGGCAGGAAATGTGGGCGGG + Intergenic
1181562630 22:23714705-23714727 CAGACATAGGAGATATGGGGAGG + Intergenic
1183428047 22:37750236-37750258 CAGGGCTGGGAGATTGGGGCAGG - Intronic
1184550859 22:45203470-45203492 CTAAGCAAGCAGATGTGGGCAGG - Intronic
1184680074 22:46067194-46067216 CTGGGCAAGGAAATGTGGGCAGG - Intronic
1185050689 22:48552610-48552632 CAGGGCTCGGAGTTGCGGGCAGG + Intronic
951817272 3:26768209-26768231 CAGAGTGAGGAGATGTTGGCTGG + Intergenic
952738864 3:36716575-36716597 CAGAGCTTGGACATGTTGCCTGG - Intronic
953061731 3:39433573-39433595 CAGGGCTAGGGCAAGTGGGCTGG - Intergenic
954277052 3:49549181-49549203 CTGGGGTAGGACATGTGGGCTGG + Intergenic
954295026 3:49669614-49669636 GTGAGCCAGGAGATCTGGGCTGG + Exonic
954750330 3:52810024-52810046 CAGAGGCAGAGGATGTGGGCAGG - Intergenic
955774212 3:62416118-62416140 GAGAGCTTGGAGTTGAGGGCAGG + Intronic
956742565 3:72286716-72286738 CCGAGGGAGAAGATGTGGGCAGG - Intergenic
956787180 3:72652395-72652417 GTCAGCTAGGAGGTGTGGGCAGG + Intergenic
958952993 3:100436491-100436513 CAGAGGGAGGAGATGAGGGAGGG - Intronic
959586824 3:108032853-108032875 CTCATCTAGCAGATGTGGGCAGG - Intergenic
960306575 3:116069239-116069261 CAGAACTAGGACATGTGGAAAGG - Intronic
960544763 3:118901626-118901648 CCGAGCTAGGTTGTGTGGGCAGG - Exonic
961007149 3:123412705-123412727 CAGAGATAGGAAATGAGGGATGG - Intronic
961216822 3:125166138-125166160 CAGATCTCGGAGGTGTGGTCAGG - Intronic
961406291 3:126682134-126682156 CAGGGCTGGGAGCTGGGGGCAGG + Intergenic
961430533 3:126879284-126879306 TAGAGTTAGGACATGTGGGTTGG + Intronic
961508181 3:127385392-127385414 CAGCTCTAGGGGATGAGGGCTGG - Intergenic
961622721 3:128237598-128237620 CAGAGCTGGGAGAGGGGAGCAGG - Intronic
961771711 3:129254832-129254854 CTGAGCCAGGTGATGTGGGGTGG + Intronic
961884054 3:130084119-130084141 CTGAGGTAGGAACTGTGGGCAGG + Intronic
962865119 3:139442135-139442157 CACAGCTGGGAAATGTGGACAGG + Intergenic
964330334 3:155595014-155595036 CAGAGCTTGGAGAAGTGGAGAGG + Intronic
964780367 3:160330623-160330645 CTGATTTAGTAGATGTGGGCTGG + Intronic
965465123 3:169019998-169020020 TAGAGATAGGAGATGTGGGTTGG - Intergenic
965940026 3:174168711-174168733 CAGCCCTAGGTGGTGTGGGCAGG + Intronic
966734271 3:183176606-183176628 CAGAGCTGGGAAGGGTGGGCTGG - Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
966898895 3:184466266-184466288 CAGAGGTGGGAGCTGAGGGCAGG + Intronic
968503305 4:961008-961030 GAGAGCCAGGGGAGGTGGGCCGG - Intronic
968651260 4:1761152-1761174 CAGTGACAGGAGATGGGGGCGGG - Intergenic
969317813 4:6392653-6392675 CAGAGCTCAGAGAGGTGGGCTGG + Intronic
969798051 4:9541222-9541244 CAGAGTTAGGACAAGAGGGCTGG + Intergenic
971307495 4:25496406-25496428 CTGAGCCATGAGATTTGGGCAGG - Intergenic
971380008 4:26087959-26087981 CAGAGACAGGGGATGTGGGATGG + Intergenic
974157892 4:58098045-58098067 CAGAAATAGGAGCTGTTGGCAGG - Intergenic
976267185 4:83195446-83195468 AAGAGCAAGGAGAAGAGGGCGGG - Intergenic
978390423 4:108219425-108219447 CACACCTAGGATATGTGGGATGG + Intergenic
979804467 4:124953725-124953747 CAGAGCTAGGAGATTTGCTCAGG - Intergenic
979862473 4:125710924-125710946 CAGATCTGGGAGATAAGGGCAGG - Intergenic
980432932 4:132727546-132727568 CAGAGCTAGGAGATTTGTGGTGG + Intergenic
981342611 4:143639347-143639369 CTGAGTGAGGAGATCTGGGCTGG + Intronic
981752078 4:148102443-148102465 CAGGGCCAGGAGATCTGGGAGGG - Intronic
982591355 4:157316161-157316183 CAGAGCTAACAGATGTCAGCAGG + Intronic
984586438 4:181569952-181569974 TAGAGTTAGGAGGTGTGTGCAGG + Intergenic
986436813 5:7742251-7742273 CATAGCTCTGAGATGTGGGCTGG + Intronic
988331986 5:29853438-29853460 CAGAGCTGTGAGATGTGTGATGG + Intergenic
988979890 5:36556745-36556767 CAGATCTAGGAGCTGTTGGGTGG - Intergenic
994107046 5:95960603-95960625 CAGAGCCAGAAGGTGTGGGGAGG - Intronic
994412198 5:99420624-99420646 CAGAGCTAGGAGGTGAAGGAGGG + Intergenic
994481622 5:100344629-100344651 CAGAGCTAGGAGGTGAAGGAGGG - Intergenic
995884462 5:116878164-116878186 CAAAGGTAGGAGCTCTGGGCAGG - Intergenic
996200102 5:120661951-120661973 AAGAGCTTGGAAATGTGGGCTGG + Intronic
996383121 5:122882534-122882556 CAGAACAAAGAGATGAGGGCAGG - Intronic
996857441 5:128024835-128024857 CAGCGCTAGGTGATGAAGGCTGG + Intergenic
997529581 5:134573581-134573603 CAGAGCTGGGAGGTCTGGGGTGG + Intronic
998157135 5:139793443-139793465 CACAGCTAGGAAGTGTGGGTTGG + Intergenic
1000370145 5:160527447-160527469 CAGAGCTAGGTGATGAGGGTAGG + Intergenic
1001294776 5:170491434-170491456 GAGGGGTGGGAGATGTGGGCGGG - Intronic
1001333873 5:170782341-170782363 CAGAGCTGGGAGGTGGGGGTGGG - Intronic
1001416245 5:171546394-171546416 CAGAGCTCCAGGATGTGGGCCGG - Intergenic
1002721296 5:181262621-181262643 CAGAGGATGGAGATGGGGGCTGG + Intergenic
1005220277 6:23578798-23578820 GAGAGATAGGAGATGGGGTCAGG + Intergenic
1005902735 6:30232017-30232039 GAGGGCTAGGAAATGTGGTCCGG - Intergenic
1009552587 6:65118245-65118267 ATGATGTAGGAGATGTGGGCTGG + Intronic
1010027878 6:71240402-71240424 CAGAGCTAAGGGTTCTGGGCTGG - Intergenic
1010322700 6:74531145-74531167 CAGATCTAGGAGCTTTGGGGTGG - Intergenic
1014796585 6:125731860-125731882 CAGAGCTCGGAGATGAAAGCTGG + Intergenic
1016451020 6:144182369-144182391 CTGAGCCAAGAGAGGTGGGCAGG + Intronic
1017248058 6:152248952-152248974 CAGAACTAGGAAATGTGAGCTGG - Intronic
1017820899 6:158048423-158048445 GAGAGATAGGAGAGGTGAGCAGG + Intronic
1018210963 6:161481248-161481270 CAGAGGTAGGATATGTTGGGTGG - Intronic
1018349333 6:162940406-162940428 GAGAGATAGGAGAAATGGGCAGG - Intronic
1018465244 6:164038120-164038142 CAGGCCTGGGAGAGGTGGGCAGG + Intergenic
1018765895 6:166932440-166932462 CAGAGCTGGGGGCTGGGGGCTGG - Intronic
1018879323 6:167860966-167860988 CAGAGCATGGTGATGTAGGCAGG + Intronic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1020365742 7:7378927-7378949 CAGAGCTTGGAAATGAGGACTGG - Intronic
1020853338 7:13385257-13385279 CAGAGCAAGGAAATGAGGGAAGG + Intergenic
1022140204 7:27487055-27487077 CAGAGCAGGTAGATGTGGGAGGG - Intergenic
1022510907 7:30934281-30934303 CAGAGCAAGGACAGGTGAGCTGG - Intergenic
1023792389 7:43763208-43763230 CAGAGCTGGGAGGAGGGGGCTGG + Intronic
1024228309 7:47345195-47345217 CATGGCTAGGAGAGGCGGGCTGG - Intronic
1024719328 7:52117598-52117620 TAGAGCTAGGAGATATTTGCAGG - Intergenic
1024830847 7:53454311-53454333 CAGAGATAGGTAATTTGGGCCGG + Intergenic
1028638078 7:93013527-93013549 CAGAGCCAGGTCTTGTGGGCTGG - Intergenic
1029245024 7:99193037-99193059 CAAGGCTAGGAGATGTGGGATGG + Exonic
1029991651 7:104967804-104967826 CATTGCTAGGAGCTGTGGTCTGG - Intergenic
1030106746 7:105993885-105993907 CAGATCAAGGAGATCTGGGCAGG + Intronic
1030206242 7:106954992-106955014 CACAGCAAGGCAATGTGGGCAGG - Intergenic
1030924720 7:115437749-115437771 GAGAGAGAGAAGATGTGGGCCGG - Intergenic
1032253765 7:130280780-130280802 AAGAGCTAGGAGAAGCAGGCTGG - Intronic
1032545070 7:132734912-132734934 CAGAGGTGGGTAATGTGGGCTGG - Intergenic
1032696040 7:134337198-134337220 CAGAGTGAGGGAATGTGGGCAGG + Intergenic
1035003900 7:155640977-155640999 CAGGGCTGGGAGAGGTGGGGAGG - Intronic
1035027598 7:155836118-155836140 CAGAGCAAGCAGTTGTGGGGCGG - Intergenic
1035260054 7:157655364-157655386 CAGAGCTTGGAGATCAAGGCTGG - Intronic
1036190765 8:6668790-6668812 AAGAGTTAGGAGCCGTGGGCAGG + Intergenic
1036675205 8:10825946-10825968 CAGATCTAGGAGATCTGAGATGG - Intronic
1038539997 8:28384421-28384443 CAGAGAAGGGAGTTGTGGGCAGG - Intronic
1039055410 8:33532481-33532503 AAGAGCTACCTGATGTGGGCAGG + Intergenic
1040011085 8:42661671-42661693 CAGAGCAAGAGCATGTGGGCAGG + Intergenic
1040546061 8:48398721-48398743 CACAGCTGGGAGGTGTGGGTGGG - Intergenic
1042877431 8:73452032-73452054 CAGAGCAAGGAGCTGGGTGCAGG + Intronic
1044461182 8:92446228-92446250 CAGAGATAGGAGGTGAGCGCCGG - Intergenic
1044525898 8:93250797-93250819 CAGAACTTGGATATGTGAGCAGG + Intergenic
1045109532 8:98927030-98927052 CAGAGCCAGGAGTTCTAGGCAGG + Intronic
1047270384 8:123352158-123352180 CAGAGCAAGGAGGTGAGGGGAGG - Intronic
1047285441 8:123483766-123483788 CAGAGTTAGGAGCTGTGGGCCGG + Intergenic
1047900736 8:129419405-129419427 TAGAGCTAGCAGTCGTGGGCTGG - Intergenic
1048560927 8:135536662-135536684 CAGATTTAAGAGATGTTGGCCGG + Intronic
1049272174 8:141701586-141701608 CACACCTGGGAGGTGTGGGCAGG - Intergenic
1049280663 8:141742518-141742540 CAGAGCTGGGTGCAGTGGGCTGG + Intergenic
1049587559 8:143439058-143439080 CAGAGCCAGTGGAGGTGGGCAGG - Intronic
1051395195 9:16612890-16612912 CTGAGCTAGGAGATATGTGTGGG - Intronic
1053164285 9:35833697-35833719 CACAGCTAGTAGGTGGGGGCCGG - Intronic
1054355839 9:64061908-64061930 CAGAGCTGGGAAAACTGGGCGGG - Intergenic
1055574161 9:77646205-77646227 AAGTGCTTGGAAATGTGGGCTGG - Intronic
1055835648 9:80437983-80438005 CAGAGCTGGGTGATGTGGTGGGG - Intergenic
1056403266 9:86248774-86248796 CAGAGTCATGAAATGTGGGCAGG + Intronic
1056834294 9:89942226-89942248 CAGACCTAGGGGTTCTGGGCAGG + Intergenic
1057486356 9:95487568-95487590 CACTTCTAGGGGATGTGGGCTGG - Intronic
1057857445 9:98612250-98612272 CAGAACTAGGATATGGGGGCTGG + Intronic
1058552404 9:106128948-106128970 CAGAGCTACGAGATGGAGGAGGG + Intergenic
1060370308 9:123063083-123063105 TAGAGATATGAGATTTGGGCTGG - Intronic
1060566406 9:124596401-124596423 CAGAGCTAAGAGTTGTTTGCAGG + Intronic
1060736205 9:126067960-126067982 CAGAGCAAGGAGAGGGGAGCAGG + Intergenic
1062000588 9:134213926-134213948 CAGACCTAGGAGATGAGGGTGGG - Intergenic
1062658452 9:137615837-137615859 CAGGCCTTGGAGACGTGGGCAGG - Exonic
1186809933 X:13178346-13178368 AAGACCCAGGAGATTTGGGCAGG + Intergenic
1187276505 X:17820634-17820656 CAGAACCAGGATATGTGTGCAGG - Intronic
1187551119 X:20306839-20306861 CAGAGCTTGGACACGTAGGCAGG - Intergenic
1189272093 X:39759056-39759078 CAGAGCTGCGAGCTGTTGGCTGG + Intergenic
1189320265 X:40083414-40083436 CAAAACTTGGAGGTGTGGGCGGG - Intronic
1189757882 X:44290127-44290149 CAGAGCAATGAGATGATGGCAGG - Intronic
1190217976 X:48492799-48492821 CAGAGTTTGGAGCTGGGGGCGGG + Intergenic
1190742864 X:53301627-53301649 CAGGGCTTGGAGGTGTTGGCTGG + Intronic
1192344433 X:70289714-70289736 CACATCTAGGAAATGTGGGGCGG - Intronic
1192775370 X:74239224-74239246 CAGAGTTAGGAGATCTTGGATGG - Intergenic
1192849705 X:74942231-74942253 CAGAGGTAGGACCTGTAGGCTGG + Intergenic
1193167997 X:78303283-78303305 CACTGCTAGGAGATGTGGGAGGG + Intronic
1195285887 X:103383303-103383325 CAGAACTGGGAGAAGTGGGTGGG - Intergenic
1200102630 X:153695526-153695548 CAGAGCCTGGAGAGGTGGGCAGG - Exonic
1201433981 Y:13936887-13936909 CAAATCAAGGAGATATGGGCAGG - Intergenic