ID: 1172639448

View in Genome Browser
Species Human (GRCh38)
Location 20:36432079-36432101
Sequence CTCGCCACGGGGAAATTGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 40}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172639448_1172639462 20 Left 1172639448 20:36432079-36432101 CCCTCCAATTTCCCCGTGGCGAG 0: 1
1: 0
2: 0
3: 6
4: 40
Right 1172639462 20:36432122-36432144 CCCTGGCCGCATCCGCCACCTGG 0: 1
1: 1
2: 2
3: 16
4: 153
1172639448_1172639456 -9 Left 1172639448 20:36432079-36432101 CCCTCCAATTTCCCCGTGGCGAG 0: 1
1: 0
2: 0
3: 6
4: 40
Right 1172639456 20:36432093-36432115 CGTGGCGAGGCCAAGGCCCGTGG 0: 1
1: 0
2: 2
3: 35
4: 2110
1172639448_1172639458 3 Left 1172639448 20:36432079-36432101 CCCTCCAATTTCCCCGTGGCGAG 0: 1
1: 0
2: 0
3: 6
4: 40
Right 1172639458 20:36432105-36432127 AAGGCCCGTGGTGAGAGCCCTGG 0: 1
1: 0
2: 0
3: 17
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172639448 Original CRISPR CTCGCCACGGGGAAATTGGA GGG (reversed) Exonic
910339668 1:86171599-86171621 CTCCCCACTGGGTAATTGTAAGG - Intergenic
1066235180 10:33478990-33479012 CTCCCCACAGAGAAATTGCAGGG - Intergenic
1067346954 10:45443981-45444003 CTGGCCGCGGGGAAAGAGGATGG + Intronic
1069023747 10:63518819-63518841 CCCTCCAAGGGGAAACTGGAAGG - Intergenic
1071465749 10:85938148-85938170 CTTGCCAGGGGGAATCTGGATGG + Intronic
1075856962 10:125637946-125637968 ATCACCAAGGGGAAGTTGGAGGG - Intronic
1080117053 11:28632931-28632953 CTCTCCAAGAGGAAACTGGAGGG - Intergenic
1083648559 11:64186716-64186738 TTAGCCACGAGGAACTTGGACGG + Intronic
1084890646 11:72235353-72235375 CTCGCCACGGTGGGATAGGAAGG - Exonic
1085518115 11:77123007-77123029 CCCCCCACGGGGAAATGGGAGGG - Intronic
1102295594 12:111734044-111734066 CTCAGCACGGGAAAACTGGATGG - Exonic
1102300454 12:111767291-111767313 CAAGTCACGGGGAAATGGGACGG - Intronic
1102467435 12:113138058-113138080 CTCCCCACGGGGAAATACCAAGG + Intergenic
1105472650 13:20706125-20706147 CTGCCCACGGGGAAGTTGGGTGG + Intronic
1106300350 13:28458744-28458766 CCAGCTACGTGGAAATTGGATGG - Intronic
1107206500 13:37796471-37796493 CTAGCCACTGGGAAACTGAATGG - Intronic
1122469406 14:101956060-101956082 TTCGGCACGGGGAAAATGGAAGG + Intergenic
1127493284 15:59485026-59485048 CTCACCCTGGGGAAAGTGGAGGG + Intronic
1127921014 15:63494034-63494056 CACGCACAGGGGAAATTGGAAGG + Intergenic
1131444471 15:92485819-92485841 CTCCCCTCTGGGAAACTGGAAGG + Intronic
1137855991 16:51795226-51795248 CTCGCCAGTGGGAAAAAGGAAGG + Intergenic
1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG + Intronic
1151906157 17:77050694-77050716 CTCTCCACTGGCAAAGTGGAAGG - Intergenic
1152064353 17:78102262-78102284 GTCACCACGGGGAAGTGGGAAGG + Intronic
1160422509 18:78756736-78756758 CTCGCCAGGGGTAAATGGGAAGG - Intergenic
928948617 2:36794051-36794073 CTAGGGACAGGGAAATTGGATGG - Intronic
944414227 2:199467320-199467342 TTCGCCACGCGGAAACTGGCCGG - Intronic
945924255 2:215787753-215787775 CTGGCCACGGAGAAGATGGACGG + Intergenic
1172639448 20:36432079-36432101 CTCGCCACGGGGAAATTGGAGGG - Exonic
1174407584 20:50312192-50312214 CCGGCCATGGGGAGATTGGAAGG - Intergenic
949187153 3:1205827-1205849 CTTACCATGGGTAAATTGGATGG + Intronic
949896285 3:8769264-8769286 CTCCCCCCGGGGAAGTTGCACGG + Exonic
952820553 3:37482283-37482305 CTCGCCAAGGGGCACTTGGAAGG + Intronic
953414504 3:42707991-42708013 CTCGCCATGGTGAACTTGGAGGG - Intronic
958744699 3:98118757-98118779 CTCACCATGGAGAAACTGGAAGG - Intergenic
977624993 4:99180378-99180400 CTCTCCACTGGGAAAGTGTACGG - Intergenic
985177032 4:187213271-187213293 CTCGCCACGAACAAATTGAAAGG + Intergenic
989629785 5:43469858-43469880 ATCGCCAGGGTGAAATTGGGTGG - Intronic
990620161 5:57550442-57550464 CTCTCCCCGGGGAACTTGGCAGG + Intergenic
997510702 5:134451890-134451912 CTGGCCACAGGGAAATAGAAGGG - Intergenic
1011481544 6:87798834-87798856 CTTGCCACGGGGTATGTGGATGG + Intergenic
1017723464 6:157260708-157260730 CTCATCACGGGGAGGTTGGATGG + Intergenic
1020069604 7:5217680-5217702 CTCGCCACGGGAATGTTTGAAGG + Intronic
1038017976 8:23530553-23530575 CTCCCCACTGGGACACTGGAGGG - Intronic
1039911985 8:41833309-41833331 ATCACCACGGGGCACTTGGAAGG - Intronic
1054906007 9:70413995-70414017 CTCCCCACTGGCCAATTGGAGGG - Exonic
1060823362 9:126673805-126673827 ATCCCCACGGGGAGATTGGATGG + Intronic