ID: 1172641711

View in Genome Browser
Species Human (GRCh38)
Location 20:36444099-36444121
Sequence ACTTCAGGCTGCAGTTTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 218}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172641697_1172641711 25 Left 1172641697 20:36444051-36444073 CCCAAAGCAAGACCCCATGCCCC 0: 1
1: 0
2: 0
3: 13
4: 189
Right 1172641711 20:36444099-36444121 ACTTCAGGCTGCAGTTTTGGAGG 0: 1
1: 0
2: 0
3: 20
4: 218
1172641707_1172641711 4 Left 1172641707 20:36444072-36444094 CCCGGCAGTCACAAGGGTCTCTT 0: 1
1: 0
2: 0
3: 13
4: 148
Right 1172641711 20:36444099-36444121 ACTTCAGGCTGCAGTTTTGGAGG 0: 1
1: 0
2: 0
3: 20
4: 218
1172641708_1172641711 3 Left 1172641708 20:36444073-36444095 CCGGCAGTCACAAGGGTCTCTTC 0: 1
1: 0
2: 2
3: 22
4: 160
Right 1172641711 20:36444099-36444121 ACTTCAGGCTGCAGTTTTGGAGG 0: 1
1: 0
2: 0
3: 20
4: 218
1172641701_1172641711 12 Left 1172641701 20:36444064-36444086 CCCATGCCCCCGGCAGTCACAAG 0: 1
1: 0
2: 1
3: 11
4: 123
Right 1172641711 20:36444099-36444121 ACTTCAGGCTGCAGTTTTGGAGG 0: 1
1: 0
2: 0
3: 20
4: 218
1172641706_1172641711 5 Left 1172641706 20:36444071-36444093 CCCCGGCAGTCACAAGGGTCTCT 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1172641711 20:36444099-36444121 ACTTCAGGCTGCAGTTTTGGAGG 0: 1
1: 0
2: 0
3: 20
4: 218
1172641705_1172641711 6 Left 1172641705 20:36444070-36444092 CCCCCGGCAGTCACAAGGGTCTC 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1172641711 20:36444099-36444121 ACTTCAGGCTGCAGTTTTGGAGG 0: 1
1: 0
2: 0
3: 20
4: 218
1172641698_1172641711 24 Left 1172641698 20:36444052-36444074 CCAAAGCAAGACCCCATGCCCCC 0: 1
1: 0
2: 3
3: 29
4: 207
Right 1172641711 20:36444099-36444121 ACTTCAGGCTGCAGTTTTGGAGG 0: 1
1: 0
2: 0
3: 20
4: 218
1172641700_1172641711 13 Left 1172641700 20:36444063-36444085 CCCCATGCCCCCGGCAGTCACAA 0: 1
1: 0
2: 0
3: 11
4: 148
Right 1172641711 20:36444099-36444121 ACTTCAGGCTGCAGTTTTGGAGG 0: 1
1: 0
2: 0
3: 20
4: 218
1172641702_1172641711 11 Left 1172641702 20:36444065-36444087 CCATGCCCCCGGCAGTCACAAGG 0: 1
1: 1
2: 3
3: 13
4: 155
Right 1172641711 20:36444099-36444121 ACTTCAGGCTGCAGTTTTGGAGG 0: 1
1: 0
2: 0
3: 20
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172641711 Original CRISPR ACTTCAGGCTGCAGTTTTGG AGG Intronic
900243283 1:1626793-1626815 ACAGCAGGCTGCAGGTGTGGGGG - Intronic
900725024 1:4210537-4210559 ATTTCAGCCTGCCTTTTTGGCGG + Intergenic
901582133 1:10253208-10253230 GATTCAGGATGCAATTTTGGAGG - Intronic
901768616 1:11519358-11519380 TCTTCCGGCTGCAATTCTGGTGG - Exonic
903878449 1:26492308-26492330 ACCTCAGTCTGCAGTTGTTGGGG - Intergenic
905232397 1:36522323-36522345 ATATCTGGCTGCAGATTTGGAGG + Intergenic
906583374 1:46954833-46954855 CTCTCAGGCTGCAGTTATGGCGG - Intergenic
907037205 1:51227041-51227063 CTCTCAGGCTGCAGTTATGGTGG - Intergenic
907037326 1:51228136-51228158 CTCTCAGGCTGCAGTTATGGCGG - Intergenic
908675343 1:66597205-66597227 ACTTCAGGGTGGAGGTTGGGAGG - Intronic
910086909 1:83413928-83413950 ACTTCAGGCTGCAGTGTGCGTGG + Intergenic
910336405 1:86136816-86136838 ACTTCAGGTACCAATTTTGGTGG - Intronic
910376570 1:86578450-86578472 ACTTGAGGGTGGAGTTTGGGAGG - Intronic
912155695 1:106916153-106916175 ACTTGAGGCTGGAGATTGGGAGG + Intergenic
915248321 1:154571318-154571340 ACTTCATGGTGCAGTTCTGCTGG - Exonic
915473475 1:156139082-156139104 ACATGATGCTGCAGTTCTGGGGG - Exonic
915719207 1:157971755-157971777 AGCTCAGGCTGCTGCTTTGGAGG - Intergenic
917426181 1:174916935-174916957 ATTTATGTCTGCAGTTTTGGAGG + Intronic
917648133 1:177048650-177048672 CCTTCAGCCTCCAGCTTTGGAGG - Intronic
918493123 1:185104333-185104355 ACTACATGCTGGAGTTTTGAAGG + Intergenic
920551860 1:206868492-206868514 ACCTCAGGCAGCAGTTGTGAAGG + Exonic
920823185 1:209400598-209400620 ACTTCTGGCTGCAAATTTGGGGG + Intergenic
921765746 1:218971261-218971283 ATTTCAGCCTGAACTTTTGGGGG - Intergenic
922092748 1:222412774-222412796 CCTTCAGGCTGCAGGTCTGTGGG - Intergenic
922268279 1:224008897-224008919 ACTTAGGACTGCAGGTTTGGAGG - Intergenic
924028196 1:239859990-239860012 ACTGCAGTCTGCATTGTTGGAGG - Intronic
1064152914 10:12880028-12880050 ACTTCAGGATACACTTTAGGTGG - Intergenic
1064162358 10:12957521-12957543 ACTGCAGTCCCCAGTTTTGGAGG + Intronic
1064278031 10:13925124-13925146 AATACAGGCTGCAATTGTGGTGG + Intronic
1064407046 10:15073402-15073424 ACTTCTGGCAGCACTTTGGGAGG + Exonic
1066257644 10:33696161-33696183 ACTTCAGACTGCTGTGCTGGTGG + Intergenic
1067067763 10:43113296-43113318 CCACCAGGCTCCAGTTTTGGAGG + Intronic
1068589818 10:58841941-58841963 GATTCAGGCTGGTGTTTTGGGGG + Intergenic
1070402021 10:76061364-76061386 ACTTGAGGCTGAAGATTGGGAGG + Intronic
1070850575 10:79559168-79559190 ACTTCAGTCTGCAGGGGTGGTGG - Intronic
1070856642 10:79612119-79612141 ACTTCAGTCTGCAGGGCTGGTGG + Intronic
1071144871 10:82556787-82556809 ACTTCAGGGTGGAGGCTTGGAGG - Intronic
1072471980 10:95721416-95721438 CTCTCAGGCTGCAGTTATGGTGG + Intronic
1073130081 10:101182662-101182684 GCTTGAGGGTGCAGTTTAGGTGG + Intergenic
1074128670 10:110553139-110553161 ACGTCAGGCTTCATTTGTGGAGG + Intergenic
1075204502 10:120435208-120435230 GATTCATGCTGAAGTTTTGGGGG + Intergenic
1076520475 10:131077980-131078002 TCTCCAGGTTGCAGTCTTGGAGG + Intergenic
1076715125 10:132359881-132359903 ACAACAGGCTGCCGCTTTGGTGG - Intronic
1077036979 11:499977-499999 CCGTCAGGCAGCAGTTCTGGAGG + Exonic
1077369215 11:2173769-2173791 CCTTCAGGCTGAGGTCTTGGAGG - Intergenic
1081425510 11:42922040-42922062 ACTTCAGGGTGGAGGGTTGGAGG - Intergenic
1082107645 11:48237571-48237593 TCCTCAGGCTGCAGTTTGGTGGG - Intergenic
1083153621 11:60809360-60809382 ACTCCAGGCTCCAGTATTTGAGG + Intergenic
1084207614 11:67605127-67605149 TCCTGAGGCTGGAGTTTTGGAGG + Intronic
1086608442 11:88725148-88725170 ACTTCAGACTGCTGTGCTGGTGG - Intronic
1087143632 11:94790643-94790665 ACTTCAGGGTGGAATTTTTGTGG - Intronic
1089964461 11:122644485-122644507 AATGCAGGCTGGAGTTTTCGGGG - Intergenic
1090005524 11:122998951-122998973 ACTACAGCCTGCTGTTGTGGTGG - Intergenic
1090436808 11:126693954-126693976 ACTTCTGGCTTAAGTTTTGAGGG - Intronic
1095138917 12:38639188-38639210 CTCTCAGGCTGCAGTTATGGCGG - Intergenic
1095476680 12:42592914-42592936 ACTTCAACATGAAGTTTTGGAGG - Intergenic
1097377325 12:58856305-58856327 CTCTCAGGCTGCAGTTATGGCGG + Intergenic
1097480505 12:60118277-60118299 ACTTGAGGGTGCAGGGTTGGGGG + Intergenic
1098383913 12:69898393-69898415 ACCCCAGGCTGCATTTTTGTGGG + Intronic
1101920340 12:108927681-108927703 ACTTGAGCCTGCAGGTGTGGAGG - Intronic
1102237728 12:111304710-111304732 ACAGCAGCATGCAGTTTTGGTGG + Intronic
1103255656 12:119539559-119539581 ACTTCAGACTGCTGTGCTGGCGG + Intronic
1105064058 12:133181606-133181628 CCTTCTGGCTGCAGATCTGGAGG + Intronic
1108410275 13:50138857-50138879 AATTCAGGCTGCATTTTAGGGGG + Intronic
1109606780 13:64706886-64706908 ATCTCAGGCTGCAGTTATGGCGG + Intergenic
1110136215 13:72070684-72070706 ACTTCAAGCTTCAGTTTGTGAGG - Intergenic
1112629546 13:101145841-101145863 AATTCAGGCTGCCTTTTTGGAGG + Intronic
1120304118 14:82746483-82746505 ACTTCTGGCTGCAGTGTGGGGGG - Intergenic
1121577084 14:94997095-94997117 ACATCAAGCAGCAGATTTGGGGG + Intergenic
1121601039 14:95203125-95203147 TCCCCTGGCTGCAGTTTTGGAGG - Exonic
1122780419 14:104141104-104141126 GCTGCAGGCTGCAATTTTGCTGG - Intronic
1123061540 14:105596928-105596950 CCTTCAGGCTGCAGAAATGGGGG + Intergenic
1123085990 14:105717839-105717861 CCTTCAGGCTGCAGAAATGGGGG + Intergenic
1124632007 15:31343384-31343406 ACTGCAGGATGCTGTTTGGGAGG - Intronic
1125352157 15:38779300-38779322 ACTTCAGGCTGCAGCCTCGCAGG + Intergenic
1128052194 15:64674348-64674370 ACTTCTTGTTGCAGTTTGGGTGG - Exonic
1128362686 15:66973512-66973534 CTCTCAGGCTGCAGTTATGGCGG + Intergenic
1129825116 15:78629794-78629816 ACTTGAGGGTGCAGTTCTGCTGG + Exonic
1130078109 15:80707715-80707737 ACTTCATGCTGTGGTTTGGGAGG + Intronic
1132159730 15:99528748-99528770 TCTTCATGATTCAGTTTTGGTGG - Intergenic
1132939599 16:2500259-2500281 ACCTCAGGCTGCAGCTGGGGTGG - Exonic
1134040995 16:11068056-11068078 AAGTCAGGCTGCGGTTATGGAGG + Intronic
1138032741 16:53573374-53573396 ACTTCAGGCAGCAAACTTGGGGG - Intergenic
1139914424 16:70419262-70419284 ACTTCAGGCCACAGTCTTTGCGG + Intronic
1139914538 16:70419910-70419932 AGTCCAGGCTGCAGGTATGGAGG + Intronic
1140424620 16:74850595-74850617 ACTTCTGGCTGGTGATTTGGAGG - Intergenic
1149180124 17:53926315-53926337 AATTCAAGATGAAGTTTTGGTGG - Intergenic
1150862376 17:68814353-68814375 ACTTCAGGGTGAAGTGTAGGAGG - Intergenic
1155274497 18:24173243-24173265 ACCTCAGGATGGAGGTTTGGAGG + Intronic
1155365238 18:25042978-25043000 AAATCAGTCTGCAGTTTGGGTGG - Intergenic
1156400349 18:36733941-36733963 AATGCAGGCTGCGGTTTTGTGGG + Intronic
1156794234 18:41022569-41022591 AATTCTGGATGGAGTTTTGGTGG + Intergenic
1157899515 18:51501013-51501035 ACCTCAGGCTGCATCTTTAGGGG + Intergenic
1164173508 19:22748065-22748087 CTCTCAGGCTGCAGTTATGGTGG - Intergenic
1165299635 19:34960661-34960683 GCTTCAGGCAGCAGGTGTGGGGG + Intronic
1166214009 19:41324045-41324067 ACTCCAGGAGGCAGTTTTGAGGG - Exonic
1167728897 19:51238523-51238545 ATTGCAGGCTGTAGTGTTGGTGG + Intronic
925493172 2:4418424-4418446 ACTTGAGGGTGGAGTTTGGGAGG + Intergenic
928494954 2:31822208-31822230 TCTTCATGGTTCAGTTTTGGTGG + Intergenic
931160184 2:59681065-59681087 GCTTCAGGATGCAGGTTTGTGGG - Intergenic
931335982 2:61344406-61344428 ATTTAAGGCTGCAGTCTTGATGG + Intronic
931539895 2:63318759-63318781 ACTTGAGGCTGGAGTGTGGGAGG + Intronic
931546759 2:63396810-63396832 ACTTGAGGGTGGAGTTTGGGAGG - Intronic
931677031 2:64707639-64707661 ACTTGAGGGAGCAGGTTTGGAGG + Intronic
933173948 2:79156232-79156254 ACTGGAGGCTGCAGTCATGGGGG + Intergenic
935015826 2:99181221-99181243 ATTTCAGGCTGAAGGTTTAGCGG + Exonic
935592986 2:104857569-104857591 TCTTTAGGCAGCTGTTTTGGAGG - Exonic
936999979 2:118457159-118457181 ACTTCAGACTGCTGTGTTGGCGG + Intergenic
937523957 2:122744541-122744563 GCTTCATGCTGCTCTTTTGGGGG - Intergenic
938807169 2:134817057-134817079 CGGTCAGACTGCAGTTTTGGAGG + Intergenic
943094880 2:183416868-183416890 ACTTCAGACTGCTGTGCTGGAGG - Intergenic
943778773 2:191797805-191797827 ACTTCAAGCTGCAGTATCTGTGG - Intergenic
944101242 2:196030369-196030391 AATTCAAGATGCAGTTTAGGTGG + Intronic
945964751 2:216174976-216174998 ATTAAAGGGTGCAGTTTTGGTGG - Intronic
946549585 2:220786531-220786553 GCTTCAGGCTGAACTTTTGCTGG - Intergenic
947068806 2:226262593-226262615 AATTCAAGATGCAGTTTGGGTGG - Intergenic
1169449230 20:5697111-5697133 AAGTCACGCTGCAGTTTTGGTGG - Intergenic
1169745463 20:8937997-8938019 ATTACAGTCTGCAGTTTTTGTGG - Intronic
1170646973 20:18206518-18206540 AGTTCTTGCTACAGTTTTGGTGG + Intergenic
1172641711 20:36444099-36444121 ACTTCAGGCTGCAGTTTTGGAGG + Intronic
1173258823 20:41415182-41415204 ACTTCAGGCGGGAATCTTGGTGG - Exonic
1173521644 20:43704386-43704408 ACTTCAGGATGTAAATTTGGGGG + Intronic
1173745229 20:45431652-45431674 ACTTCAGACTGCAATTTGGGGGG - Intergenic
1174674592 20:52341175-52341197 CCTGCAGGCTGCAGGGTTGGGGG + Intergenic
1175014495 20:55774787-55774809 ACTTGAGTGTGCAGCTTTGGCGG - Intergenic
1177896201 21:26858053-26858075 CTCTCAGGCTGCAGTTATGGCGG - Intergenic
1181889890 22:26053191-26053213 ACTACATGGTCCAGTTTTGGAGG - Intergenic
1182870311 22:33640698-33640720 ACTTCAGACTGCTGTGCTGGTGG - Intronic
1184167359 22:42737886-42737908 ACTGCACCCAGCAGTTTTGGTGG - Intergenic
1184670099 22:46007822-46007844 ACTTCAGGCCGGAGGCTTGGCGG - Intergenic
951026797 3:17839520-17839542 ACTAGAAGCAGCAGTTTTGGGGG + Intronic
951770525 3:26251166-26251188 ACTTCAGGATGCAGATCTGCTGG - Intergenic
956326126 3:68055026-68055048 CCTTCAGGCAGTTGTTTTGGTGG + Intronic
958100430 3:89001935-89001957 ACTTCAGGCTTCACTTATTGTGG - Intergenic
959935296 3:112022705-112022727 AGTTCAGGCTGCTGTTCTAGAGG + Intergenic
961351784 3:126308750-126308772 AGCTCAGGCTGCTGTTTTTGGGG - Intergenic
962377873 3:134873859-134873881 ACTTCAGGTTCTAGTTTTGGTGG + Intronic
963062524 3:141235947-141235969 AGTTCAGTCTGCAGTGATGGCGG + Intronic
965281296 3:166757042-166757064 ACTTCAGGGAGAAGTATTGGGGG + Intergenic
967562668 3:190934887-190934909 ACTTCAGACTGCTGTGCTGGCGG + Intergenic
967760204 3:193215458-193215480 ACATCAGACTGCAGTTTCGTTGG - Intergenic
972003776 4:34072590-34072612 ACTTCAGGCTGTTTTTTTGGAGG - Intergenic
973714168 4:53658423-53658445 AATTCAGCTTGCTGTTTTGGAGG + Intronic
974441382 4:61922809-61922831 AGTTCAGCCTGGAGTTATGGAGG + Intronic
974520415 4:62974996-62975018 CCCTCGGGCTGCAGTTATGGTGG - Intergenic
974672600 4:65052124-65052146 ACTTTGGGCTGCAGGTTTGCAGG - Intergenic
975040168 4:69736398-69736420 ACTCCAGGCTGCACAGTTGGTGG + Intronic
976464768 4:85354625-85354647 TCTTGGGGCTGCAGTTATGGTGG + Intergenic
977583444 4:98748978-98749000 AGTTGCGGCTGCAGTCTTGGAGG + Intergenic
978909506 4:114047798-114047820 CTCTCAGGCTGCAGTTATGGTGG - Intergenic
979883246 4:125988841-125988863 ACTTCAGGGTGGAGTTTGAGAGG - Intergenic
980351969 4:131695236-131695258 ACTTAATCCTACAGTTTTGGCGG + Intergenic
980507493 4:133741440-133741462 ACTTCAGGGTGAAGGTTAGGAGG - Intergenic
981871253 4:149488560-149488582 ACTTCACGCTGCTGTTTTTGAGG + Intergenic
982199521 4:152946696-152946718 AACACAGGCTGCAGTTCTGGAGG + Intronic
983179447 4:164630705-164630727 ACTTCAGACTGCTGTGCTGGTGG - Intergenic
984723698 4:183000376-183000398 CTGTCAGGCTGCAGTTATGGTGG - Intergenic
984775626 4:183479600-183479622 ACTTCAGGTTTCAGATTTGTAGG + Intergenic
985979463 5:3450425-3450447 CTTTCAGGCTGCAGTTTACGTGG - Intergenic
986092777 5:4526646-4526668 AATTCAAGATGAAGTTTTGGGGG - Intergenic
988202010 5:28080648-28080670 ACTTCAGTCTGCAGGACTGGGGG - Intergenic
988966727 5:36426065-36426087 ACCTGAGGGTGGAGTTTTGGAGG - Intergenic
992279939 5:75163964-75163986 AGTACAGGCTGGAGTTTTAGTGG + Intronic
993241929 5:85400353-85400375 ACTTCAGGCTGAAATTATTGGGG + Intergenic
994729107 5:103471055-103471077 ACTTCAGCCTGTAGATATGGAGG - Intergenic
994805383 5:104440669-104440691 AATTCAGGATGTAGTCTTGGTGG - Intergenic
1003962234 6:11219503-11219525 AGTCCAGGCTAAAGTTTTGGGGG - Intronic
1004797086 6:19098836-19098858 GAATCAGGTTGCAGTTTTGGTGG + Intergenic
1008082017 6:47204679-47204701 ACTCCAAGTTGTAGTTTTGGTGG - Intergenic
1008631913 6:53370278-53370300 AGTTGATGGTGCAGTTTTGGAGG - Intergenic
1009479784 6:64142400-64142422 ACATGAGGCTCCAGTTTTGGGGG - Intronic
1009718274 6:67428326-67428348 GCTTCAGACTGCTGTGTTGGCGG + Intergenic
1011189831 6:84717250-84717272 CTCTCAGGCTGCAGTTATGGCGG + Intronic
1011978078 6:93333031-93333053 ACTTGAGGGTGGAGTTTTGGAGG - Intronic
1012485263 6:99714024-99714046 ACTGTGGCCTGCAGTTTTGGTGG + Intergenic
1012509089 6:99982155-99982177 ACTTCTCACTGCAGTTATGGCGG + Intronic
1013992001 6:116264865-116264887 ACTTCAAGCTGTAATTCTGGGGG + Intronic
1014971590 6:127822864-127822886 AGTTAATGCTGCAGTTTTGAGGG - Intronic
1016557477 6:145354626-145354648 ATTTCAGGCTGCATTTTTTCTGG - Intergenic
1018684143 6:166290164-166290186 TCTTCAGGCTGCAGATTTCAAGG - Intergenic
1018760994 6:166894257-166894279 CTCTCAGGCTGCAGTTATGGTGG - Intronic
1019008064 6:168819985-168820007 TCTACAGGCCGCAGATTTGGTGG - Intergenic
1020650905 7:10874905-10874927 GATTCAGGCTTCAGTTTAGGTGG + Intergenic
1020853203 7:13383760-13383782 ACAACAGGCTGGAGTTTTGATGG - Intergenic
1023079212 7:36512000-36512022 ACCTCAGACTCCAGTTTTGCAGG + Intergenic
1023918372 7:44607225-44607247 ACTTCTGGCAGCAGGTGTGGGGG - Intronic
1024150993 7:46571156-46571178 TCTTCAGGTTGCAGGATTGGGGG + Intergenic
1025064871 7:55845066-55845088 ACTTGAGGGTGGAGGTTTGGAGG - Intronic
1025700371 7:63814143-63814165 ACTTGAGCCTGCATTTTGGGTGG - Intergenic
1026032823 7:66809249-66809271 ACTTGAGGTTGCAGTGGTGGAGG - Exonic
1027303791 7:76870413-76870435 ACTTCAGGCTGCAGTGTGCGTGG + Intergenic
1027680514 7:81214749-81214771 ATTTCAGGCTGCAGTTTCGAGGG + Intergenic
1027814860 7:82955405-82955427 ACGTCAGGCTGCAGAAATGGAGG - Exonic
1028588637 7:92474645-92474667 CTCTCAGGCTGCAGTTATGGTGG + Intronic
1030291290 7:107874907-107874929 ATTTCAGGATGCAGTTGAGGAGG - Intergenic
1031732551 7:125316534-125316556 ACTTCAGTCTGCAGTGGTGAGGG - Intergenic
1032442683 7:131954050-131954072 AATTCATGCTGCAGTCTTGAGGG - Intergenic
1034249141 7:149674407-149674429 CTCTCGGGCTGCAGTTTTGGCGG - Intergenic
1037329468 8:17730117-17730139 ACTTCAGGTTTAATTTTTGGAGG - Intronic
1038859403 8:31370309-31370331 ACTTGAGGATGCAGTGTGGGAGG - Intergenic
1039116933 8:34101561-34101583 AATTCAGGATGCAATTTGGGTGG - Intergenic
1040493534 8:47946667-47946689 ACTTCAGGCTATACATTTGGAGG - Intronic
1041384211 8:57280774-57280796 ACTGCGGGCTGCAGGCTTGGGGG + Intergenic
1041929428 8:63270642-63270664 ACTTCAGGTCCCAGTTTTGATGG + Intergenic
1042787259 8:72562286-72562308 GCTTGAGGCTCCAGGTTTGGAGG - Intronic
1043834392 8:85030694-85030716 ATTTCAAGCTGCATTTTAGGAGG + Intergenic
1045303088 8:100931446-100931468 AGCTCAGGCAGCAGTTTTGGTGG - Intronic
1045403358 8:101841067-101841089 ATGTCAGACTGCAGTCTTGGAGG + Intronic
1046094934 8:109546377-109546399 ACTTACGGCTTCAGTTGTGGTGG - Intronic
1046385837 8:113507949-113507971 ACTTCAGTCAGCAGTATAGGTGG - Intergenic
1048058131 8:130888916-130888938 CCTTCAGCCTGCAGTCTTGCTGG - Intronic
1048747520 8:137631390-137631412 ACTGCATACTGCGGTTTTGGTGG - Intergenic
1049036533 8:140080710-140080732 ACTTCAAGCAAGAGTTTTGGTGG + Intronic
1050238381 9:3607783-3607805 ACTTGAGGGTGGAGTTTGGGAGG - Intergenic
1051199426 9:14599717-14599739 ACTTCAGACTGCTGTGCTGGTGG - Intergenic
1056060701 9:82882956-82882978 AGTTCAGGTTAAAGTTTTGGTGG - Intergenic
1057347304 9:94261563-94261585 ACTTGGGGTTGCAGATTTGGGGG - Intronic
1059056544 9:110987477-110987499 ACTTCAGTCTCCAAATTTGGGGG + Intronic
1061207315 9:129172348-129172370 ACTTCATGCTGCAGTTTCCAGGG - Intergenic
1061741416 9:132708942-132708964 CCTTCAGCCTGCAGATTTTGAGG - Intergenic
1186302369 X:8214074-8214096 TCTTCAGGCTGCTGTTTTTTTGG - Intergenic
1188570491 X:31579622-31579644 ACATCAGACTACAGTTTTGTGGG + Intronic
1188873625 X:35403618-35403640 ATTTGTGGCTGCAGATTTGGAGG + Intergenic
1189590639 X:42507295-42507317 ACTTCAGACTGCTGTGCTGGTGG - Intergenic
1192499685 X:71641831-71641853 TCTTCATGATTCAGTTTTGGTGG + Intergenic
1192689548 X:73348102-73348124 AATTCAAGCTGAAATTTTGGTGG - Intergenic
1193172019 X:78347742-78347764 CTCTCAGGCTGCAGTTATGGTGG + Intergenic
1193254033 X:79325540-79325562 ACTTCAGGCTGCTGTGCTGGCGG + Intergenic
1193306662 X:79959105-79959127 CTCTCAGGCTGCAGTTATGGTGG - Intergenic
1194320193 X:92436811-92436833 CCTTGAGGGTGGAGTTTTGGAGG + Intronic
1194990566 X:100542999-100543021 ACTTTAGCCTGCAGTGGTGGTGG - Intergenic
1197118455 X:122861876-122861898 ACTTCAGTCTGCAATTTTAAAGG - Intergenic
1198992262 X:142528166-142528188 AATTCAAGATGCAGTTTGGGTGG + Intergenic
1199243460 X:145575183-145575205 AGATCAGGCTGCTGTTTTGGAGG + Intergenic
1200035008 X:153321284-153321306 ACTTCTGGCTGCAGGTGTGGGGG - Intergenic
1200225191 X:154413220-154413242 ACTTCAGGTTCCAGATGTGGCGG - Exonic
1200628315 Y:5549943-5549965 CCTTGAGGGTGGAGTTTTGGAGG + Intronic
1201011284 Y:9549677-9549699 AATTCAGGCTCCTGTTGTGGTGG - Intergenic
1201905551 Y:19082832-19082854 CTCTCAGGCTGCAGTTATGGTGG - Intergenic