ID: 1172644084

View in Genome Browser
Species Human (GRCh38)
Location 20:36459087-36459109
Sequence CAGGCTGGGGATTAGGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 742
Summary {0: 1, 1: 0, 2: 6, 3: 84, 4: 651}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172644068_1172644084 2 Left 1172644068 20:36459062-36459084 CCCCCGGATGGGGAGCCTTGGGG 0: 1
1: 0
2: 1
3: 15
4: 135
Right 1172644084 20:36459087-36459109 CAGGCTGGGGATTAGGGAGGGGG 0: 1
1: 0
2: 6
3: 84
4: 651
1172644066_1172644084 3 Left 1172644066 20:36459061-36459083 CCCCCCGGATGGGGAGCCTTGGG 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1172644084 20:36459087-36459109 CAGGCTGGGGATTAGGGAGGGGG 0: 1
1: 0
2: 6
3: 84
4: 651
1172644071_1172644084 0 Left 1172644071 20:36459064-36459086 CCCGGATGGGGAGCCTTGGGGTC 0: 1
1: 0
2: 1
3: 18
4: 182
Right 1172644084 20:36459087-36459109 CAGGCTGGGGATTAGGGAGGGGG 0: 1
1: 0
2: 6
3: 84
4: 651
1172644072_1172644084 -1 Left 1172644072 20:36459065-36459087 CCGGATGGGGAGCCTTGGGGTCC 0: 1
1: 0
2: 2
3: 12
4: 140
Right 1172644084 20:36459087-36459109 CAGGCTGGGGATTAGGGAGGGGG 0: 1
1: 0
2: 6
3: 84
4: 651
1172644070_1172644084 1 Left 1172644070 20:36459063-36459085 CCCCGGATGGGGAGCCTTGGGGT 0: 1
1: 0
2: 1
3: 8
4: 106
Right 1172644084 20:36459087-36459109 CAGGCTGGGGATTAGGGAGGGGG 0: 1
1: 0
2: 6
3: 84
4: 651

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172644084 Original CRISPR CAGGCTGGGGATTAGGGAGG GGG Intronic
900310766 1:2032192-2032214 CAGGCTGGGGATGGAGGGGGTGG + Intergenic
900514017 1:3072881-3072903 CAGCCAGGGGCTGAGGGAGGGGG - Intronic
900695224 1:4005533-4005555 CAGGCTGGGCATGAGGGAGGGGG + Intergenic
900728705 1:4236834-4236856 GAGGCTGGGGAACAGTGAGGGGG - Intergenic
900884551 1:5405184-5405206 CTGGGTGGGGACTAAGGAGGGGG - Intergenic
901229665 1:7634679-7634701 CAGGCTGGGGCTGCCGGAGGAGG + Intronic
901286118 1:8080188-8080210 GAGGATGGGAATTAGGGAGTAGG + Intergenic
901687800 1:10953765-10953787 CAGGGAGGGGACAAGGGAGGCGG - Intronic
901810523 1:11764628-11764650 CAGCCTGGGGCCTAAGGAGGGGG + Intronic
902137225 1:14319634-14319656 CAGGCTGTCGAGAAGGGAGGAGG - Intergenic
902156050 1:14487423-14487445 GAGGCTGGGGATGAGAAAGGAGG - Intergenic
902412101 1:16217651-16217673 CAGGCTGGGGAGGAGGGGCGCGG - Intergenic
902514866 1:16984775-16984797 CATGCTGGGGAGAAGGGATGTGG - Intergenic
903666605 1:25011854-25011876 CATGAAGGGGATTAGGGACGGGG - Intergenic
903930040 1:26856777-26856799 CAGGCCTGGGAGGAGGGAGGCGG - Exonic
903947396 1:26972325-26972347 CAGGTTGGGGAATAGGAAGGAGG + Intergenic
904371300 1:30049113-30049135 TGGCCTGGGGATTGGGGAGGTGG - Intergenic
904377761 1:30092526-30092548 GAGGCTGGGGACCAGTGAGGAGG + Intergenic
904398123 1:30236651-30236673 CAGGATGGGGAATTGGAAGGGGG + Intergenic
904464041 1:30697642-30697664 TAGGGTGGGGGTTGGGGAGGAGG - Intergenic
904994839 1:34623456-34623478 CAGGCTGGGGTTCAGTGATGTGG - Intergenic
905212793 1:36385931-36385953 AAGGCTGGGGAGGAGGGGGGCGG - Intergenic
905268308 1:36770187-36770209 CAGGATGGGAAATAGAGAGGAGG - Intergenic
905390727 1:37634149-37634171 CAGGCTGCGGACTGGGGTGGGGG + Intronic
905824789 1:41019658-41019680 CAGGCCGGGACTTAGGGAGTTGG - Intronic
906677223 1:47701908-47701930 GAGGCTGGGGATCAGGGAGTAGG - Intergenic
906677239 1:47701964-47701986 GAGGCTGGGGGTCAGGGAGGAGG - Intergenic
907283205 1:53363978-53364000 AAGGGTGGGGACTGGGGAGGAGG - Intergenic
907461155 1:54606390-54606412 CAGGCAGGGGAGTGGGGAGGAGG + Intronic
907718162 1:56947092-56947114 AAGGAAGGAGATTAGGGAGGAGG - Intronic
907876940 1:58499221-58499243 CAGGCTGGGGATCGGGGAGTAGG + Intronic
907895590 1:58687093-58687115 CAGGCTTGGGAGTAGGGACTTGG - Intronic
908001256 1:59682626-59682648 CAGGCAGGAGATTAGAGAGAGGG - Intronic
908517336 1:64906417-64906439 AATGCTGGGGAGGAGGGAGGAGG - Intronic
910429314 1:87145612-87145634 GAGGCTGGGGAGGAGGGAGTGGG - Intronic
910541073 1:88357860-88357882 CAGAGTGGGGAGTAGGGAGGGGG + Intergenic
910759556 1:90720245-90720267 CAGGGTGGGAAGTAGGGAGGGGG + Intergenic
910929198 1:92425777-92425799 CAGGGAGGGGATTAAGGAGATGG + Intergenic
911178782 1:94843088-94843110 CAGGCTGGGCATAGGGGAAGAGG + Intronic
911183132 1:94878325-94878347 CAGGCTGGGGACTGGGGACAGGG - Intronic
911894307 1:103411093-103411115 AAGGATGGGGGTTAGGGAAGGGG + Intergenic
912280904 1:108312394-108312416 GAGTCAGTGGATTAGGGAGGGGG + Intergenic
912457352 1:109806953-109806975 CAGGCTGGGGGTGAGGGATGTGG - Intergenic
912796233 1:112695226-112695248 AAGGGTGGGGATTGGGGAAGTGG + Intronic
912843516 1:113059725-113059747 GAGGATGGGGACTAGGGTGGGGG + Intergenic
912937053 1:114012730-114012752 CAGCCTGGGGGAGAGGGAGGAGG - Intergenic
912956439 1:114156896-114156918 GAGGCTGGGGCAAAGGGAGGAGG + Intergenic
913326429 1:117632300-117632322 CAGGCTGGAGAGGAGGGCGGGGG + Intergenic
913688028 1:121252641-121252663 CAGGGTGTGGATTGGGGTGGTGG + Intronic
914039885 1:144040281-144040303 CAGGGTGTGGATTGGGGTGGTGG + Intergenic
914149574 1:145027639-145027661 CAGGGTGTGGATTGGGGTGGTGG - Intronic
914928564 1:151909556-151909578 CAGGGCGGGGCTTGGGGAGGAGG + Exonic
915098203 1:153478991-153479013 TGGGCTGGAGACTAGGGAGGAGG - Intergenic
915107222 1:153542089-153542111 GAGGTTGTGGATTGGGGAGGGGG + Intergenic
915166991 1:153953462-153953484 CAGGGTGGGGGTGAGGGAGCAGG + Intronic
915213747 1:154327273-154327295 CAGGCTGGGGAGTAAGGATGAGG + Intronic
915300392 1:154948213-154948235 CAGGCTGGGGGTGAGGGTGCAGG - Exonic
915406196 1:155661481-155661503 CAGGCTGGTGAATGGGGTGGTGG + Intronic
915419403 1:155767599-155767621 CAGGCTGGTGAATGGGGTGGTGG + Intronic
915648181 1:157288698-157288720 CAGGATGGGGGTGAGGGAGGAGG + Intergenic
915662484 1:157415808-157415830 CAGGATGGGGGTGAGGGAGGAGG - Intergenic
915897514 1:159823431-159823453 CAGGCTGGGGGTGAGGGAGCAGG - Intergenic
915911253 1:159916947-159916969 GAGGCTGGGGAGTTGGGAGATGG + Intergenic
916399265 1:164428540-164428562 AGGGCTGGGGGATAGGGAGGAGG + Intergenic
917476518 1:175373790-175373812 AAGGCTGGGGATAAGGGGGCTGG - Intronic
918072607 1:181143987-181144009 CAGGCTGGGGAATGGGGTGAAGG - Intergenic
918108718 1:181436693-181436715 GAGGCTGGGGACGAGGGGGGTGG + Intronic
919470936 1:197978452-197978474 GAGGCTGGGGATGGGGGAGAGGG - Intergenic
920096135 1:203487703-203487725 CAACCTCGGGTTTAGGGAGGAGG + Exonic
920475350 1:206271140-206271162 CAGGGTGTGGATTGGGGTGGTGG + Intronic
921284102 1:213593585-213593607 CAGGAAGGGCTTTAGGGAGGAGG + Intergenic
922199906 1:223393229-223393251 GAGGCTGGGGATGGGGGTGGTGG - Intergenic
922229313 1:223671947-223671969 GAGGCTGGGGATGAGTGTGGAGG + Intergenic
922471592 1:225880423-225880445 CAGGCTGAGGAGAAGGCAGGGGG + Intronic
922791872 1:228315369-228315391 AGGGCAGTGGATTAGGGAGGAGG + Intronic
922947723 1:229531240-229531262 TAGGGTGGGAATAAGGGAGGAGG - Intronic
924264831 1:242270748-242270770 CAGCCTTGGGTTTAGGGAGGTGG - Intronic
1062962283 10:1581468-1581490 CAGGCTGGGAACTCAGGAGGTGG - Intronic
1063623369 10:7667648-7667670 CGGGGTGGGGACTGGGGAGGAGG - Intergenic
1063752802 10:8970270-8970292 CAGGTTGGTAATAAGGGAGGTGG + Intergenic
1064495468 10:15905512-15905534 AGAGCTGGGGATTAGGGTGGTGG - Intergenic
1065088576 10:22206029-22206051 CAGACAGGGGATAGGGGAGGGGG - Intergenic
1065437541 10:25718063-25718085 CAGCCTGGGGAGAAGGGAAGAGG - Intergenic
1066719978 10:38327734-38327756 CAGCCTTGGGTTTAGGGAGGTGG + Intergenic
1067092687 10:43277303-43277325 CAGGCAGGGGAATAGAGAGAAGG - Intergenic
1067578267 10:47421160-47421182 CAGGCTGGGACTGTGGGAGGAGG + Intergenic
1068383755 10:56295827-56295849 CTAGCTGGGGTTTAGTGAGGTGG - Intergenic
1069567271 10:69472186-69472208 CAGGCAGAGGATGAGGGAAGGGG - Intronic
1069606839 10:69744127-69744149 CAGCCTGGGGATGAAGGAGGGGG - Intergenic
1069728375 10:70595731-70595753 TGGGCAGGAGATTAGGGAGGTGG - Intergenic
1071251377 10:83823119-83823141 GAGGCTGGGGTTTAAGAAGGTGG + Intergenic
1071328399 10:84538803-84538825 CAGGCCAGGGATTGGGGTGGGGG + Intergenic
1071498837 10:86189442-86189464 CAGGCAGGGGAGTAATGAGGAGG - Intronic
1072722216 10:97788025-97788047 AAGGCTGGGGCTGAAGGAGGAGG - Intergenic
1072865889 10:99061139-99061161 AAGGCTGTGGACTAGGGTGGTGG + Intronic
1073013786 10:100382284-100382306 CAGCCTGGGGAGAAGGGGGGAGG - Intergenic
1074075071 10:110115408-110115430 CAGGCTGGAAAATGGGGAGGAGG + Intronic
1074128257 10:110548202-110548224 CAGGCAGGGGATGGGGGTGGCGG - Intergenic
1074243116 10:111658969-111658991 CAAACTGGGGAGAAGGGAGGAGG - Intergenic
1074447810 10:113534591-113534613 CAGCCTGGTGGTTAGGGATGTGG + Intergenic
1074857665 10:117485392-117485414 CAGGCTGGGAGCCAGGGAGGAGG - Intergenic
1075419005 10:122287058-122287080 CAGGCTCAGGCTCAGGGAGGGGG - Intronic
1075807627 10:125201555-125201577 CAGGCTGGGGGATAGGATGGAGG - Intergenic
1075939355 10:126375983-126376005 GAGGCTGGGGGGTGGGGAGGGGG - Intronic
1076379573 10:130015794-130015816 CAGGCTGGGGATTGGGGAGCAGG + Intergenic
1076406205 10:130213972-130213994 CAGGCTGGGGATCTGGGTGCTGG - Intergenic
1076426175 10:130369249-130369271 GAGGCTGGGGAAGAGGGAGCAGG + Intergenic
1077060070 11:614083-614105 GGGGCTGGGGATTGGGGAGCTGG - Intronic
1077143318 11:1034391-1034413 CAGGAGGGGGATGAGTGAGGGGG - Intronic
1077376063 11:2205566-2205588 GAGGCTGGGCAGTAGGGAGGTGG - Intergenic
1077376142 11:2205797-2205819 GAGGCTGGGAAGTAGGGAGGTGG - Intergenic
1077376191 11:2205956-2205978 GAGGCTGGGAGGTAGGGAGGTGG - Intergenic
1077376201 11:2205980-2206002 GAGGCTGGGAAGTAGGGAGATGG - Intergenic
1077376223 11:2206044-2206066 GAGGCTGGGAAGTAGGGAGATGG - Intergenic
1077482003 11:2819359-2819381 CAAGCTGGGGATTTGGGAATGGG + Intronic
1077551776 11:3203587-3203609 CAGGCTGGGGGTGGGGGTGGGGG + Intergenic
1077837445 11:5937186-5937208 CAGGCTAGGGATGAGAGAGACGG - Intronic
1077864696 11:6212346-6212368 TAGGCTGGGGAAGAGGGAAGTGG - Intronic
1077896484 11:6457194-6457216 TAGGCTGGGGAATGGGGAGCTGG + Intronic
1077955197 11:7011047-7011069 GAGCCTTGGGATTAGGGAGAGGG - Intronic
1078599153 11:12715378-12715400 AAGCCTGGGGACTGGGGAGGAGG + Intronic
1079022896 11:16924034-16924056 CAGGCTGGGCTCTGGGGAGGTGG - Intronic
1080959584 11:37142745-37142767 CAGGCTGTAGAGTAGGGAGAGGG - Intergenic
1081546840 11:44077742-44077764 GAGGCTGGGGATTACAGGGGAGG + Intronic
1081758465 11:45560811-45560833 GTGGGTGGGGATTAGGGAGAAGG - Intergenic
1083120637 11:60509636-60509658 TCGGCTGGGCATGAGGGAGGGGG - Intergenic
1083168912 11:60910477-60910499 CAGGAGGGGGAAGAGGGAGGGGG - Intergenic
1083315129 11:61810234-61810256 CAGGCTGGGGATCAGCAGGGTGG + Intronic
1083990717 11:66244299-66244321 CAGGCTGGGGCCTAAGGAGGGGG - Exonic
1084047070 11:66575241-66575263 CAGCCTGGGGAGCGGGGAGGAGG - Intergenic
1084194460 11:67516553-67516575 CAGGCTGAGGCCTGGGGAGGTGG + Intergenic
1084212878 11:67631936-67631958 CAGGCCTGGGATGAGGGATGAGG - Intronic
1084265807 11:68004579-68004601 CAGGATGGGGACATGGGAGGTGG - Intronic
1084430510 11:69108221-69108243 CAGGCTGGGGACCAGGGTGGAGG - Intergenic
1084529181 11:69717084-69717106 CTGGCTGGGGCTTTGGGAAGAGG - Intergenic
1085042513 11:73334851-73334873 CAGGCTGGGGAACTGGGTGGAGG + Intronic
1085303951 11:75474650-75474672 CAGGCTGGGGGGCAGGAAGGAGG + Intronic
1085396606 11:76209889-76209911 CAGGCTGGGGGCTAGGGAGGAGG - Intronic
1085807739 11:79651859-79651881 CAAACTGGCTATTAGGGAGGGGG - Intergenic
1086004928 11:82026845-82026867 CAGCCTGGGGAGTAGGGGAGAGG - Intergenic
1086525384 11:87719411-87719433 AAGGTTGGGGAGCAGGGAGGAGG - Intergenic
1088005841 11:104938859-104938881 CAGTCTTGGGATTTGTGAGGTGG - Intergenic
1089017179 11:115175526-115175548 CAGGAGGGGAAGTAGGGAGGGGG - Exonic
1089096424 11:115923479-115923501 CACGGTGGGGATTGGGGCGGGGG + Intergenic
1089340956 11:117757050-117757072 CAGGGTGGGGAGTTGGCAGGAGG + Intronic
1090380036 11:126320043-126320065 CAGGCTGGAGTGTAGTGAGGCGG + Intronic
1090754719 11:129779815-129779837 CAAGGTGGGGATGAGGGAGAAGG - Intergenic
1092030942 12:5284636-5284658 GAGGGTGGGGATGAGGAAGGGGG - Intergenic
1092056501 12:5512211-5512233 GAGTCTGGGAATTGGGGAGGGGG + Intronic
1092739415 12:11613749-11613771 CAGCCTGGGGAGAAGGGAAGAGG + Intergenic
1093262002 12:16950260-16950282 GAAGCTGGGGTTCAGGGAGGGGG + Intergenic
1093638920 12:21502367-21502389 CTGGCTGGTTATTTGGGAGGCGG + Intronic
1093703583 12:22250103-22250125 CAGGGTGGGGTTTTGGGAGTGGG - Intronic
1094484750 12:30915552-30915574 GAGGCTGGGGATTAGGGGTTGGG + Intergenic
1094536162 12:31324468-31324490 CATGCTGGTGCGTAGGGAGGCGG - Intronic
1095258564 12:40070982-40071004 CAAGGTGGGGATTAGGGCAGTGG + Intronic
1095839356 12:46675439-46675461 CAGATTGGGGATGAGGGAAGTGG + Intergenic
1096184219 12:49567795-49567817 CAGGCTGGTGGCTGGGGAGGTGG + Intronic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1096788076 12:54029220-54029242 CAGTCTGAGGAGAAGGGAGGGGG + Intronic
1096846066 12:54407796-54407818 CAGGCTGGGGCCAAGGGAGGGGG - Intronic
1096907279 12:54947004-54947026 CAGTCTGGGGATGAGGGGAGAGG + Intergenic
1097191230 12:57220535-57220557 CAGGCAGGGGTAGAGGGAGGGGG + Intronic
1097361945 12:58668163-58668185 CTGGCAGGGGAATAAGGAGGTGG + Intronic
1097728788 12:63104569-63104591 AAAGCTGGGGGTTAGAGAGGTGG - Intergenic
1099109996 12:78546845-78546867 TAGGGTGGGGGTTAGGGTGGGGG + Intergenic
1100000820 12:89833125-89833147 CTTGCTGGGGAGTAGGGTGGGGG - Intergenic
1100353532 12:93807588-93807610 GAAGTTGGGGATCAGGGAGGTGG + Intronic
1100518572 12:95351801-95351823 CAGGCTGGAGAGCAGGGTGGGGG + Intergenic
1101168278 12:102061814-102061836 CAGGGTGGGGACTCGGAAGGTGG + Intronic
1101492038 12:105218642-105218664 CAGGCTGGGAATGAGGCAGTGGG + Intronic
1101705966 12:107221601-107221623 GGGGTTGGGGATTTGGGAGGCGG + Intergenic
1102010521 12:109615774-109615796 CTGGCTGAGGATTCTGGAGGGGG + Intergenic
1102031507 12:109742535-109742557 AAGGCTGGCGATTGGGGAGGGGG + Intronic
1102525358 12:113508836-113508858 CTGGCTGGGGACTTGGGAGATGG - Intergenic
1102652025 12:114448812-114448834 AAGGATGGGGGTTGGGGAGGCGG - Intergenic
1102781601 12:115570475-115570497 CAGTCCGGGGATCAGGGAGCCGG - Intergenic
1103412096 12:120719650-120719672 CAGGCTGGAGATGACAGAGGAGG + Intronic
1104685325 12:130781015-130781037 CAGGTTGTGGCTCAGGGAGGCGG + Intergenic
1104821522 12:131680058-131680080 CAGGCTGGGATTCAGGGAAGGGG - Intergenic
1104952248 12:132446506-132446528 CAGGCAGGGGGCTAGGGAGTGGG - Intergenic
1105313824 13:19237889-19237911 GAGGCTGGGAAGTGGGGAGGGGG + Intergenic
1106156559 13:27163280-27163302 AAGGCTGGAGAGTAGGAAGGGGG - Intronic
1106918297 13:34538593-34538615 CAGGCTGGGTAGGAGGGAAGGGG + Intergenic
1107171995 13:37354089-37354111 GAGGCTGGAGATTTGGGTGGAGG - Intergenic
1107456364 13:40559508-40559530 CAGGCTGAGGGTTAGTGAGCAGG - Exonic
1107991290 13:45820918-45820940 CAGTCTGGGGAGGACGGAGGTGG - Intronic
1108709088 13:53015745-53015767 CAGGCAGGGGAAGAGGGTGGTGG - Intergenic
1111127528 13:83930714-83930736 CAGGCTGGGGGATGGGGAGCGGG - Intergenic
1112506926 13:99981133-99981155 GAGGCGGGGGAGTAGGGGGGAGG - Intergenic
1112700370 13:102000992-102001014 AAGGCTGGAGTTTAGGGAGAGGG + Intronic
1113059325 13:106304666-106304688 CAGACTGTGGAGGAGGGAGGTGG + Intergenic
1113846801 13:113396414-113396436 AAGGCTGGGGATGTGGGATGTGG + Intergenic
1113911416 13:113843183-113843205 CGGGATGGGGATCAGGGAGGTGG - Intronic
1114221579 14:20702192-20702214 CAGCCTGGGGAGGAGGGAAGAGG - Intergenic
1114562805 14:23605291-23605313 CAGGCTGGGGAAGATGGAGAGGG + Intergenic
1114693449 14:24606347-24606369 CAGCATGGGGTTTAGGGAGGAGG + Intergenic
1115826129 14:37279941-37279963 GAGGCTGGGGATGAGGGTGGAGG - Intronic
1116923031 14:50601442-50601464 CTGGTTGGGGAGGAGGGAGGAGG + Intronic
1117191540 14:53297327-53297349 CAGGGTGGGCCTTATGGAGGAGG + Intergenic
1117279894 14:54228865-54228887 AGGGATGGGGAATAGGGAGGGGG + Intergenic
1118285966 14:64473003-64473025 AAAGCTGGGGGTTGGGGAGGGGG + Exonic
1119732031 14:76957127-76957149 GAGGCTGGGGCTGAGGGAGGGGG - Intergenic
1120064182 14:80020342-80020364 CAGGCTCAGGATTAGGGATTGGG - Intergenic
1121415488 14:93776435-93776457 CAGGCTGGGGGCTACGGAGATGG - Intronic
1121523766 14:94604196-94604218 CAGGAAGGGGAGTAGGAAGGAGG - Intronic
1121559966 14:94867149-94867171 CAGACTGGGGATTTGGGAGAGGG - Intergenic
1121609781 14:95269874-95269896 CAGCCTGTGGATTGGGGTGGGGG - Intronic
1122769815 14:104092962-104092984 CTGGCTGGGGGTGTGGGAGGAGG - Intronic
1124097611 15:26663208-26663230 CAGGGTTGGGATTAGAGAGGAGG - Intronic
1124694532 15:31853011-31853033 CAGCCTGGGGGGAAGGGAGGTGG - Intronic
1126465865 15:48961445-48961467 CAGGCTGGGCCTTATGGAGGAGG - Intronic
1127135021 15:55911024-55911046 TAGCCTGGGGATGTGGGAGGCGG - Intronic
1127285228 15:57526868-57526890 CACGCTGGGCATTGGGAAGGGGG + Intronic
1127396152 15:58545520-58545542 CAGGCTGGGCATTAGCTAGCGGG - Intronic
1127975050 15:63990934-63990956 CAGGCAGAGGAGTAGGGAGGGGG - Intronic
1128220072 15:65962815-65962837 CAGGCTGGGGAGTAGACTGGTGG + Intronic
1128770553 15:70278548-70278570 CAGGATGGGGATGGGGGAGTGGG + Intergenic
1129165618 15:73775487-73775509 GAGGCTGAGGAGTAGGGAGAGGG + Intergenic
1129232378 15:74203899-74203921 CAGGATGGGGATGGGGGTGGGGG + Intronic
1129259340 15:74355537-74355559 CAGTCTGGGGATGAGGGGAGAGG - Intronic
1129351024 15:74956109-74956131 CAGGATGGGGATTCGGGGGCTGG + Exonic
1129851655 15:78797190-78797212 CAGGCTGGGGTTTAGAGGGTGGG - Intronic
1130251335 15:82301900-82301922 CAGGCTGGGGTTTAGAGGGTGGG + Intergenic
1130775978 15:86983695-86983717 GAGGCTGGAGATTAGGAAAGGGG - Intronic
1131446271 15:92500262-92500284 CAGGCTGGTAATTGGGGAGGGGG + Intronic
1131499908 15:92952317-92952339 CAGGCTGGGGAGGAGGGAGGGGG + Intronic
1131833226 15:96367341-96367363 CAAGATGGGGGTTGGGGAGGTGG - Intergenic
1131906835 15:97152087-97152109 CAGGCTGGGAAAAAGGAAGGAGG - Intergenic
1132618627 16:854247-854269 CAGGCTGGGCCTCTGGGAGGAGG + Exonic
1132663489 16:1071612-1071634 CAGGCTGGGGAGGAGGGGAGGGG + Intergenic
1132670751 16:1101453-1101475 CAGGCTGGGGAATGAGGTGGAGG - Intergenic
1132755979 16:1485767-1485789 CATCCTGGGGAGTGGGGAGGTGG - Intergenic
1132783487 16:1641762-1641784 CAGGCTGTGGAGTAGGGTGGCGG - Intronic
1132852250 16:2030067-2030089 GAGGCTGGGGGCTGGGGAGGCGG - Intronic
1132852828 16:2032622-2032644 CTGGCTGGGGATAGGGGAGGTGG + Intronic
1134598002 16:15511225-15511247 CAGGCTGTGGCTTGGGGAGAGGG - Intronic
1135005526 16:18818777-18818799 GAGGCTGTGGATTGGGCAGGGGG - Intronic
1135221859 16:20621161-20621183 CGGGCTGGGGATTTGTGAAGAGG - Intronic
1135478361 16:22798798-22798820 CATGGGGGGGATTAGGGAAGAGG + Intergenic
1137444266 16:48522275-48522297 CAGGCTGGGGTTGGGGGTGGTGG + Intergenic
1137719882 16:50621758-50621780 CAGCTTGGGGCTTTGGGAGGAGG + Intronic
1138083744 16:54115535-54115557 CAGGCTGTGGGGAAGGGAGGTGG + Exonic
1138309552 16:56011693-56011715 AAGGCAGGGGAGTAGGGAGTGGG + Intergenic
1140031403 16:71342079-71342101 GAGGCTGGGGAGTAGGGACAAGG + Intergenic
1140790496 16:78386626-78386648 CAGGCTGGGGGGTGGGGCGGGGG - Intronic
1141054445 16:80803522-80803544 CAGGTGGGGGGTGAGGGAGGTGG + Intronic
1141611523 16:85183762-85183784 CAGGCTGAGGCTCAGAGAGGTGG + Intronic
1141635873 16:85313525-85313547 CAGGAAGGGGATCAGGGGGGTGG - Intergenic
1141783478 16:86181587-86181609 CAGGCTGAGGGTTGGGGAGCTGG - Intergenic
1141899820 16:86983842-86983864 AAGGCTGGGGAGTTTGGAGGTGG + Intergenic
1142425103 16:89998092-89998114 GAGGGTGGAGAATAGGGAGGTGG + Intergenic
1142688851 17:1592839-1592861 CAGGCTGGGGGTTGGGGAGCAGG + Intronic
1142867553 17:2799880-2799902 CAGGCTGGGGATGGAGGAGCTGG + Intronic
1143015419 17:3888890-3888912 CAGGCTGTGGACCAGGGTGGTGG + Intronic
1143180202 17:4979907-4979929 GAGGGTGGGGGTGAGGGAGGGGG + Exonic
1143352008 17:6295698-6295720 CAGGCTGGGGCTGAGGGAAGAGG - Intergenic
1143476696 17:7207286-7207308 TGGGCTGGGGATCAGGGAGAGGG + Intronic
1143679790 17:8467712-8467734 CAGACTCGGGGTGAGGGAGGCGG + Exonic
1144808828 17:17985500-17985522 GAGGATGGGGGTTAGGGAGGTGG + Intronic
1145080764 17:19892509-19892531 CAGCCTGGGGAGGAGGGAAGAGG + Intergenic
1145857585 17:28176917-28176939 TAGGCAGGGGGTTAGGGGGGTGG - Intronic
1145861744 17:28216932-28216954 CAGGCAGGGGGTTGAGGAGGAGG + Intergenic
1145865086 17:28236012-28236034 CAGGCTTGGGAACAGGCAGGAGG + Intergenic
1145961186 17:28887351-28887373 CAGGCTAGGGACTAGGGAAGAGG + Intronic
1146379054 17:32315004-32315026 AAGGATGGGGAGAAGGGAGGAGG + Intronic
1146827124 17:36032555-36032577 CAGGCTGGAGAGGAGGGAGTTGG - Intergenic
1147161578 17:38572143-38572165 CAGCCAGGGGATTAAGGAGCCGG - Intronic
1147176153 17:38657454-38657476 CTGGCTGGGGCTCCGGGAGGTGG - Intergenic
1147235748 17:39056185-39056207 CAGGCTGGGGGCTAGGGAGTGGG - Intergenic
1147404623 17:40202009-40202031 CTGCCTGGGGATGAGGGAGGAGG + Intergenic
1147445413 17:40472291-40472313 CAGGCTGGGGAGAAGGGTGCTGG - Intergenic
1147464172 17:40597943-40597965 CAGGCTGGGGAGTAGAGAAGGGG + Intergenic
1147905263 17:43818433-43818455 GAGGCTGGGGAGTAGAGAAGGGG - Intronic
1147935596 17:44008852-44008874 CAACCTGGGGATTAGGGGAGGGG + Exonic
1147960733 17:44166114-44166136 CAGGCTGAGGCTAAGGCAGGAGG - Intergenic
1148219035 17:45849467-45849489 CAAGCTGGGGGTTGGGGAAGAGG - Intergenic
1148680423 17:49470424-49470446 CAGACTGGGGATCGGGGTGGGGG + Intronic
1148683587 17:49488274-49488296 CTGGCAGGGGAGCAGGGAGGGGG - Intergenic
1148761468 17:50004119-50004141 CAGGCTTGGGAATAAGCAGGAGG - Intergenic
1148785538 17:50144431-50144453 CAGGCTGTGATGTAGGGAGGGGG - Intronic
1149864284 17:60141874-60141896 GAGGCTGGGGTTTAGGGGAGCGG - Intergenic
1151248316 17:72813805-72813827 CAGGATGGGGCAGAGGGAGGCGG + Intronic
1151367825 17:73628729-73628751 AGGGCTGGGAATCAGGGAGGAGG - Intronic
1151385459 17:73752690-73752712 CAGGCTGGCGAGAAGTGAGGTGG - Intergenic
1151491116 17:74432676-74432698 CCGGCTGGGGACTGGGGGGGTGG + Intronic
1151513481 17:74577310-74577332 CAGGCTGGGGAGTTTGCAGGAGG - Intergenic
1151635466 17:75344845-75344867 CAGGCGGGGGGGTTGGGAGGGGG - Intronic
1151713602 17:75820201-75820223 TAGGCTGGGGGTTAGGGCAGAGG + Intronic
1151763952 17:76122536-76122558 AAAGCTGGGAAGTAGGGAGGGGG + Intergenic
1152331969 17:79678750-79678772 AAGGCTGGGGTTGAGGAAGGAGG - Intergenic
1152687487 17:81701763-81701785 TAGGCTGAGGACAAGGGAGGTGG - Exonic
1152693844 17:81734162-81734184 CAGGCTGGGGTTGGGTGAGGAGG - Intergenic
1153661970 18:7333404-7333426 CATGCGGGGGATTACGGTGGGGG - Intergenic
1153767663 18:8389572-8389594 GAGGCGGGGCTTTAGGGAGGGGG - Intronic
1153770502 18:8412044-8412066 AAGGCTGAGGAAAAGGGAGGTGG + Intergenic
1153954352 18:10083430-10083452 CTGGCTGGGGGTCAGGCAGGTGG + Intergenic
1154031195 18:10755879-10755901 CAGGATGGGGAATAAGGATGAGG + Intronic
1154123460 18:11670087-11670109 CAGGCTGGGGCTGGGGGAGAGGG - Intergenic
1156292403 18:35759452-35759474 GAGGCTGGGGAGGGGGGAGGGGG + Intergenic
1156715739 18:40007768-40007790 GAGGCTGGGGATAAGGGAAATGG - Intergenic
1156915717 18:42463177-42463199 CAGTCTGGGGATGAGGGGAGAGG - Intergenic
1157116572 18:44867723-44867745 CAGGATGGGGAATGGGGGGGTGG + Intronic
1158379729 18:56915963-56915985 CAGGCAGTGGATTACTGAGGAGG - Intronic
1159615835 18:70578633-70578655 CAGGCCTGGGGTCAGGGAGGTGG - Intergenic
1160493451 18:79356721-79356743 GTGGCCAGGGATTAGGGAGGAGG + Intronic
1160979831 19:1811823-1811845 CAGACTGGGGATTGGAGAGTTGG + Exonic
1161012616 19:1967854-1967876 CAGCCTGGGGAGAAGGGAGGAGG - Intronic
1161012637 19:1967915-1967937 CAGCCTGGGGAGAAGGGAGGAGG - Intronic
1161012697 19:1968084-1968106 CAGCCTGGGGAGGAGGGAGGAGG - Intronic
1161012733 19:1968192-1968214 CAGCCTGGGGAGGAGGGAGGAGG - Intronic
1161012792 19:1968362-1968384 CAGCCTGGGGAGGAGGGAGGAGG - Intronic
1161124799 19:2549773-2549795 CAGGCCGGGGGTGAGGGCGGGGG + Intronic
1161206930 19:3046437-3046459 CGGGCTGGGGATGGGGAAGGGGG + Intronic
1161492087 19:4567690-4567712 CAGCCTGGGGATCAGGGCGGAGG - Intergenic
1161975129 19:7604363-7604385 AAGGCTGGGGCTTAGAGAGATGG - Intronic
1162349020 19:10137699-10137721 AAGGCTGAGGACTCGGGAGGAGG + Intronic
1162563307 19:11430656-11430678 CAGGCTGGAAATGAAGGAGGAGG + Intronic
1162929918 19:13952678-13952700 GAGGGTGGGGAGTAGGGACGAGG + Intronic
1163035696 19:14567661-14567683 GAGGCTGGGTCTGAGGGAGGCGG - Intronic
1163471507 19:17500079-17500101 CAGGCTGGGAAGGTGGGAGGAGG + Intronic
1163537909 19:17888281-17888303 CAGGCAGGGGATAAAAGAGGAGG + Intronic
1163614371 19:18318160-18318182 CACACTGTGGATTAGGGTGGTGG - Intronic
1163675883 19:18655075-18655097 CCAGGTGGGGATCAGGGAGGTGG + Intronic
1163779764 19:19240101-19240123 AAGGATGGGGAGGAGGGAGGAGG - Intronic
1163848826 19:19652280-19652302 GAGGCTGGGGAGTTGGGTGGGGG - Intronic
1163966597 19:20752308-20752330 CAGGCTTGGGAACAGGCAGGAGG + Intronic
1164635151 19:29786248-29786270 CAGGCTCGGCAATGGGGAGGTGG + Intergenic
1165058417 19:33193733-33193755 GAGGCTGGGGACTTGGGAGGAGG - Intronic
1165135621 19:33666551-33666573 GAGGCTGGGCATCAGGGAAGAGG + Intronic
1165435080 19:35790945-35790967 GAGGCTGGAGAACAGGGAGGAGG + Intergenic
1165742158 19:38210881-38210903 CAGGCAGGGGAAGAAGGAGGTGG + Intergenic
1165782627 19:38442891-38442913 CACGCTTGGGATGGGGGAGGTGG - Intronic
1166113979 19:40641516-40641538 CAGGCTGGAGTCCAGGGAGGAGG + Intergenic
1166380390 19:42352493-42352515 CAGGCTGGGGCACATGGAGGTGG + Intronic
1166672407 19:44718867-44718889 CAGGATGGAGAGCAGGGAGGAGG + Intergenic
1166763885 19:45241134-45241156 GAGGCTGGGGACCAGGGAGGAGG - Intronic
1166882413 19:45937635-45937657 CAGTCTGGAGATTAGGGGTGGGG + Exonic
1166981493 19:46634567-46634589 CGGGGTGGGGAATAGGGCGGGGG - Intronic
1167148688 19:47696730-47696752 CAGGCTGGGGCTCAGGAGGGCGG + Intronic
1167427585 19:49437337-49437359 CAGCCTAGGGGGTAGGGAGGGGG + Intronic
1167533746 19:50035764-50035786 CAGGCTGAGCATTAGAGAGGTGG + Intronic
1167745936 19:51351922-51351944 GAGGCAGGGAATTAGGGATGAGG - Intronic
1167747838 19:51363261-51363283 CAGCCTGGGGATGATGGAGTAGG + Intronic
1167768325 19:51499038-51499060 AAGGCTGAGGCTGAGGGAGGGGG + Intronic
1168103444 19:54153115-54153137 CAGGAGTGGGAATAGGGAGGGGG - Intronic
1168405940 19:56110758-56110780 CAGGCTATGGATGGGGGAGGCGG + Intronic
1168721518 19:58557319-58557341 CAAGCTGGGGAGCAGGGAGAGGG - Intronic
924977639 2:192675-192697 TGGGATGGGGATTGGGGAGGAGG - Intergenic
925896209 2:8474210-8474232 CAGGTGAGGGGTTAGGGAGGAGG - Intergenic
926425626 2:12736311-12736333 CAGGCTGGGAAGGAGGGAGAGGG + Intronic
926619160 2:15031605-15031627 TAGGCTGGAGTTGAGGGAGGAGG - Intergenic
927095777 2:19746850-19746872 CTGGCTGGGGGTTGGGGCGGGGG - Intergenic
927219153 2:20690688-20690710 CTGGCGGGGGATGGGGGAGGAGG + Intronic
927487159 2:23496476-23496498 CAGGATGGGGGAGAGGGAGGAGG - Intronic
927714638 2:25343476-25343498 CAGGGTGGGGGTTGGGGAGACGG - Intergenic
927899182 2:26806579-26806601 CAGGAAGGTGATTTGGGAGGTGG - Intergenic
928114093 2:28533973-28533995 GAGACAGAGGATTAGGGAGGTGG - Intronic
928163309 2:28949922-28949944 GAGGCTGGGAGTTAGGGTGGGGG + Intergenic
928363570 2:30684943-30684965 GGGGCTGGGGAGTGGGGAGGGGG + Intergenic
929277897 2:40045246-40045268 TAGGGTGGGGATTAGGATGGAGG + Intergenic
929564447 2:42975661-42975683 CGAGCTGGGGCTTGGGGAGGAGG + Intergenic
929954872 2:46449374-46449396 CAGGCTGTGGATTAGGAAGGGGG - Intronic
930221180 2:48748326-48748348 CAGTCTGAGGCTTAGGGATGGGG + Intronic
931682972 2:64768190-64768212 CAGCCGGGGGATGCGGGAGGCGG - Intergenic
931978656 2:67670594-67670616 AAGGATGGGGATAAGGGAGGGGG + Intergenic
932337263 2:70938369-70938391 CAGGCTGGGGAGGAGACAGGTGG - Intronic
932478663 2:72024959-72024981 GAGGCTGGTGATTAGGTATGGGG - Intergenic
932498716 2:72161231-72161253 CAAGTTGAGGATGAGGGAGGCGG - Intergenic
932886587 2:75554429-75554451 CAGGCTGGGGAGAAGGAAAGGGG + Intronic
933559734 2:83875138-83875160 CAGGCTAGGGATGAGAGAGATGG + Intergenic
933759769 2:85665468-85665490 CAGGCAGGGCCTAAGGGAGGAGG - Intronic
933773260 2:85756828-85756850 CAGGCTGGGGGCTGGGGGGGTGG - Intronic
933813510 2:86048166-86048188 CAGCCTGAGGAGTGGGGAGGAGG - Intronic
934778802 2:96955940-96955962 CAGGCAGGGGAAGAAGGAGGTGG - Intronic
934917762 2:98314120-98314142 CAGGCTGCAGCATAGGGAGGGGG + Intergenic
935269540 2:101422072-101422094 AGGGCTGGGGATTATGGAGGGGG - Intronic
935606877 2:104980485-104980507 TAGGCTGGGGAAAAGGGAAGGGG - Intergenic
936126089 2:109790007-109790029 CAAGATGGGGAGTAGGGAAGTGG + Intergenic
936218604 2:110581461-110581483 CAAGATGGGGAGTAGGGAAGTGG - Intergenic
937080272 2:119135586-119135608 GAGGCTGGGGAGAAGGGATGGGG - Intergenic
937254567 2:120546129-120546151 CAGGCTCGGGAGCAGTGAGGTGG + Intergenic
937867650 2:126766058-126766080 CAGGCTGTGGAATTGGGGGGTGG + Intergenic
938775373 2:134537106-134537128 CAGTCTGGGTATTAGAGATGTGG - Intronic
938892017 2:135715239-135715261 CAGGCTGGGACTGAGGCAGGAGG + Intronic
939561966 2:143742961-143742983 CAGGCTGGGGTTAAGTGAGCTGG + Intronic
940252388 2:151693415-151693437 GAGGCTGGGGGTGGGGGAGGCGG - Intronic
940453719 2:153871826-153871848 CAGGCTGGGGCTACGAGAGGAGG + Intergenic
940650418 2:156435905-156435927 CAGGCTGGGGAAGACGGTGGCGG - Intronic
941129133 2:161624966-161624988 CTGCCTGGGGATGAGGCAGGGGG - Intronic
942455730 2:176137010-176137032 CATGCTGGGGAGCGGGGAGGGGG - Intergenic
943208276 2:184928459-184928481 CAGCCTGGGGTTAGGGGAGGGGG + Intronic
943783146 2:191846812-191846834 CAGGCTGGGGCTTGGTGTGGAGG + Exonic
944314430 2:198269861-198269883 TAAGGTGGGGATTAGGGAGTAGG - Intronic
944884560 2:204049214-204049236 GAGGGTGGGGACTAGGGTGGTGG + Intergenic
945555528 2:211270853-211270875 CAGGTAGGGGATGAGGGAGAGGG - Intergenic
946292377 2:218754961-218754983 CAGGGTGGGTATTTGGAAGGAGG - Exonic
946295963 2:218783687-218783709 AAGGTTGGGGAAGAGGGAGGGGG + Intronic
946415556 2:219538225-219538247 CAGCCTGGGGATAAGGGGTGTGG - Exonic
946483711 2:220080569-220080591 CAGATTCGGGGTTAGGGAGGGGG + Intergenic
948772658 2:240259480-240259502 CAAGCTGGGGCTGAGGTAGGGGG - Intergenic
948852537 2:240715432-240715454 CAGGCAGGGGATGAGGGTGGCGG + Exonic
949007177 2:241656316-241656338 CAGGCTGGGGATGTGGGACGGGG - Intronic
1168796250 20:611803-611825 CAGGCTGGGCTTTGGGGAGGAGG + Intergenic
1168859454 20:1035485-1035507 CAGGATGGGGGTTGGGGACGTGG + Intergenic
1169070234 20:2722618-2722640 CAGGCTGTGGCATAGGGAGAAGG - Intronic
1169197025 20:3688833-3688855 CAGGCTTGGGAGTGGGGAAGAGG + Intronic
1170545368 20:17431596-17431618 CAAGCTGGGGCTAAGGGAGTGGG - Intronic
1170629207 20:18053964-18053986 AAGGCTGGGGAGAAGGGAGGCGG - Intronic
1170778839 20:19405116-19405138 GAAGCTGGGGATTGGGGCGGGGG - Intronic
1171238755 20:23548362-23548384 CAGGCTCTGGATTAGGGGAGGGG + Intergenic
1171242850 20:23585876-23585898 CAGGCTCTGGATTAGGGGAGGGG - Intergenic
1171256658 20:23693687-23693709 AGGGCTGGGGACTAGGGATGAGG - Intergenic
1171408316 20:24928747-24928769 CAGGCTTGGGAACAGGCAGGAGG - Intergenic
1171474043 20:25393887-25393909 CAGGGTGGGGACCATGGAGGCGG - Intergenic
1171902055 20:30867335-30867357 CAGGCTGGGGATTTAAGAAGTGG - Intergenic
1172524731 20:35592489-35592511 AAGGCTGAGGGTTAGGTAGGAGG + Intergenic
1172644084 20:36459087-36459109 CAGGCTGGGGATTAGGGAGGGGG + Intronic
1172801773 20:37581159-37581181 AAGGCTGGGGGTTAGGGGGCAGG - Intergenic
1173075149 20:39811186-39811208 AAGGCTGGGGACCAAGGAGGAGG + Intergenic
1173085439 20:39911700-39911722 AAGGCTGGTGATTAGGCAAGTGG - Intergenic
1173617726 20:44413863-44413885 CTGGCTGGGGAGAATGGAGGTGG - Intronic
1173750089 20:45469810-45469832 CAGGCTGAGGAGGAGGGCGGCGG - Exonic
1173791178 20:45828691-45828713 CAGGCTGGGCACTGGGGAGTAGG + Intronic
1173870930 20:46341707-46341729 CAGGCTGGGAAGTGGGGATGGGG + Intergenic
1173924077 20:46767962-46767984 CAGGGTGGGGAAAAGTGAGGAGG - Intergenic
1174918480 20:54677539-54677561 CAGCCTGGAGATCAGGGAGGAGG + Intergenic
1175178281 20:57126947-57126969 CAGGCTGGGCAGGAGAGAGGAGG + Intergenic
1175284339 20:57827833-57827855 CAGGCTGGGGGATGGGGAAGGGG + Intergenic
1175358678 20:58389738-58389760 GAGGCTGGGGGTCGGGGAGGAGG - Intronic
1175912127 20:62410045-62410067 CAGGCCAGGGACTAGTGAGGAGG + Intergenic
1175956008 20:62609806-62609828 GAGGCTGGGGACTTGGGGGGTGG + Intergenic
1176057183 20:63154949-63154971 CAGTGTGGGGAGGAGGGAGGAGG - Intergenic
1176092639 20:63325795-63325817 GAGGCTGTGGGGTAGGGAGGGGG + Intronic
1176196132 20:63836992-63837014 CGGGCTGGGGGATATGGAGGGGG - Intergenic
1176310845 21:5148083-5148105 CCGGGTGGGGATTGGGGATGAGG - Intronic
1177257457 21:18683868-18683890 CAGGGTGTGGAAGAGGGAGGAGG + Intergenic
1177731218 21:25028810-25028832 CATGCTGGAGATCAGGGAAGAGG - Intergenic
1178007611 21:28240653-28240675 CAGGCTGTGGAGGAGGGAGGAGG - Intergenic
1178584138 21:33858798-33858820 CAGGCTGGGGATTAGAGGAGAGG - Intronic
1179375001 21:40842177-40842199 CAGCCTGGGAGATAGGGAGGTGG - Intronic
1179381393 21:40902626-40902648 GAGGCGGGGGATCTGGGAGGAGG + Intergenic
1179410098 21:41155966-41155988 CAGGATGGGGATCTGGGAGCTGG - Intergenic
1179536977 21:42059186-42059208 GGGGCTGGGGATTAGGCAGCTGG - Intergenic
1179555699 21:42174233-42174255 CAGGCTGGAGAGGAGGCAGGTGG + Intergenic
1179622737 21:42628147-42628169 CAGGCTGGGGCTGAGACAGGTGG + Intergenic
1179823432 21:43950747-43950769 CGGGCTGGGGAACAGGGAAGAGG - Intronic
1179846210 21:44113952-44113974 CCGGGTGGGGATTGGGGATGAGG + Intronic
1180059151 21:45375692-45375714 CAGGCTGGGGGGGATGGAGGAGG + Intergenic
1180948726 22:19710824-19710846 GAGGCTGAGGATGAGGGAAGAGG - Intergenic
1181035598 22:20168456-20168478 CAAGCTGGGGCTTAGGGAAGTGG - Intergenic
1181275074 22:21683031-21683053 CAAGCAGGGCATGAGGGAGGAGG - Intronic
1181436612 22:22914803-22914825 CAGGCTGGGAACAAGGTAGGAGG + Intergenic
1181570655 22:23766355-23766377 CAGGCTGGGGATGTGGGGAGGGG - Intronic
1182723803 22:32426477-32426499 CAGGCTGGGGGCAAGGCAGGTGG - Intronic
1183001438 22:34862754-34862776 CAGGCTGGTGAAAAGGAAGGAGG - Intergenic
1183013812 22:34969665-34969687 GTGGCTGGGGTTGAGGGAGGTGG + Intergenic
1183072683 22:35407349-35407371 GACGCGGGGGATCAGGGAGGAGG - Intronic
1183433788 22:37781830-37781852 CTGTCTGGGAATGAGGGAGGAGG - Intergenic
1184455405 22:44607203-44607225 CAGGCAGGGGCCCAGGGAGGAGG + Intergenic
1184465750 22:44668367-44668389 CAGGTCGGGGCTTGGGGAGGGGG + Intergenic
1184557127 22:45239739-45239761 TAGGCTGGGGATTTCTGAGGGGG - Intronic
1184881194 22:47305067-47305089 CAGGCCGAGGGTTAGGAAGGTGG - Intergenic
1184986413 22:48139188-48139210 GAGGCTGGGGCTGAGGCAGGAGG + Intergenic
1185013805 22:48331974-48331996 GAGGCTGGGGACAAGGGAGGAGG - Intergenic
1185031014 22:48442922-48442944 CAGGCTGAGGATGAGGGGAGGGG + Intergenic
1185151274 22:49165028-49165050 CAGGCAGGGGATTTGGCTGGCGG - Intergenic
1185173448 22:49306286-49306308 CCCTCTGGGGATTAGGCAGGAGG + Intergenic
949861203 3:8506412-8506434 AAGGCTGGGGACCAGGAAGGAGG + Intronic
949959756 3:9302317-9302339 CAGGCTGGGGAGGGGTGAGGGGG - Intronic
950531693 3:13556017-13556039 TAGGCTGGGGTTGATGGAGGAGG + Intronic
950536433 3:13581658-13581680 CATGGTGGGGATTAAGGAGGGGG + Intronic
950545853 3:13637503-13637525 CCGTCTGGGGATGAGGGGGGTGG + Intronic
950700903 3:14745268-14745290 CAGGGAGGGAACTAGGGAGGTGG + Intronic
950715698 3:14846267-14846289 GAGGATGGGGCTGAGGGAGGAGG + Intronic
951137157 3:19117858-19117880 TTGGCTGGGGAGTAGGAAGGTGG - Intergenic
951803478 3:26622761-26622783 CAGGCTGGGAATGAGGGAGGAGG - Intergenic
952823904 3:37509044-37509066 AGGGCTGAGGATTAGGGAAGGGG - Intronic
952909200 3:38167296-38167318 GAGGCTGGGGACTGGGGATGAGG + Intronic
953038199 3:39231596-39231618 CAGGGTGGGGATTGGAGGGGAGG + Intergenic
953237644 3:41120294-41120316 GAGGCTGGGGAGTGGGGAGAAGG - Intergenic
953415504 3:42713313-42713335 CACCCTGGTGATTAGAGAGGAGG + Exonic
953502549 3:43451617-43451639 AAGGGTGGGGATTAGGGGGTGGG + Intronic
953908197 3:46878867-46878889 CAGCCTGGGGATTAGAGACAGGG + Intronic
954109339 3:48425427-48425449 CAGGCTGGGCGGTGGGGAGGGGG - Intronic
954574932 3:51670890-51670912 CAGGCTGGGGACCAGGGAGCTGG - Intronic
954617011 3:51974313-51974335 CAAGCTGGGGATAAGGGGGATGG - Intronic
954671707 3:52294489-52294511 CAGGCTGGAGATTGGGAGGGAGG + Intergenic
954803997 3:53204715-53204737 CAGGCTGTGGGACAGGGAGGGGG + Intergenic
954938173 3:54346022-54346044 GAGGCTGGGGGTAAGGGAGGAGG + Intronic
955552203 3:60096834-60096856 CAGGCTGGGGAAGGGGCAGGAGG + Intronic
955633695 3:61002608-61002630 GAGGCTGGGGGATAGGGAGAGGG - Intronic
955779951 3:62473723-62473745 CTGGCTGGGGATTGGGTAGCAGG + Intronic
956194967 3:66644458-66644480 CAGACTGCAGATTAGGTAGGTGG + Intergenic
957281860 3:78161258-78161280 CAGGCTGAAGATTTTGGAGGAGG - Intergenic
957364787 3:79208764-79208786 CATGGTGTGGGTTAGGGAGGAGG + Intronic
957675344 3:83357179-83357201 CAGTCTGGGGATGAGGGGAGAGG + Intergenic
958750911 3:98192606-98192628 CAGTCTGGGGATGAGGGGAGAGG - Intronic
959114141 3:102156003-102156025 AAGGTAGGGGAGTAGGGAGGTGG + Intronic
959398233 3:105868549-105868571 CAGGCCGGGGAGGAGGGAGAGGG - Intronic
960176351 3:114522310-114522332 TAGGCTGGAGGTTAGGAAGGGGG + Intronic
961012645 3:123446889-123446911 AAGGCTGGGGATTTGGTAGCTGG - Intronic
961028829 3:123584848-123584870 GAGGCTGGGGCTCGGGGAGGCGG - Intronic
961241652 3:125416724-125416746 CAGGCTGGGGTGCAGGGATGTGG + Intergenic
961331856 3:126147246-126147268 ATGGCTGGGGACTAGGAAGGTGG + Intronic
961698386 3:128722701-128722723 CAGTGTGGAGATTTGGGAGGTGG + Intergenic
962169241 3:133083185-133083207 CAGGCTGAGGAGTGGGGCGGCGG - Intronic
962205051 3:133427562-133427584 CTGGCTGAGGAGCAGGGAGGTGG - Intronic
962261776 3:133914962-133914984 CAGACTGGGGAGTAGGGAGACGG + Intergenic
962754852 3:138459293-138459315 CAGGGTGGGGATCAGGGAAGGGG + Intronic
963111941 3:141695346-141695368 CAGTCTGGGGAGGAGGGAAGAGG + Intergenic
963346888 3:144105563-144105585 CAGGCTGGGGAGGTGGGAGTGGG + Intergenic
963456756 3:145555225-145555247 CAGGCTGGGGAGGAGGGGAGAGG + Intergenic
963468520 3:145712024-145712046 CAGCCTGGGGAGGAGGGGGGAGG - Intergenic
963612046 3:147481944-147481966 TTAGCTGGGGAGTAGGGAGGTGG + Intronic
965738475 3:171847777-171847799 CACGGTGGGGATGGGGGAGGAGG + Intronic
967948641 3:194823717-194823739 CAGGATGGGGCTGAGGCAGGTGG - Intergenic
968446364 4:654238-654260 AGGGGTGGGGTTTAGGGAGGTGG + Intronic
968652499 4:1765842-1765864 CAGAGTGGGGAGAAGGGAGGAGG + Intergenic
968727107 4:2252817-2252839 CAGGGTGGGGATGGGGGATGGGG - Intronic
968761203 4:2443450-2443472 CAGGCTGGGGCTTGGGCAGTTGG - Intronic
968901831 4:3435664-3435686 CAGGCTGGGGGCTGTGGAGGAGG - Intronic
969072772 4:4552695-4552717 CTGGCTGGGGATTTGTGGGGAGG + Intergenic
969439408 4:7208386-7208408 CAGGCAGGGGATTGGCGGGGAGG + Intronic
969446155 4:7245777-7245799 CAGCCTGGGGTTTAGGGACATGG + Intronic
969518542 4:7662228-7662250 CAGGGTGGGGGTGGGGGAGGGGG - Intronic
969587403 4:8102314-8102336 CAGGCTGGGCCTCACGGAGGAGG - Intronic
969588826 4:8109706-8109728 CTGTCTGGGGATGAGGGAGAGGG + Intronic
969714558 4:8861963-8861985 CGGGCTGGGGAGCCGGGAGGCGG + Intronic
970071327 4:12162796-12162818 CATTGTGGGGATTGGGGAGGGGG + Intergenic
972886904 4:43503619-43503641 CTGACTGGGGAATAGGGAGTGGG - Intergenic
973992074 4:56419085-56419107 CAGTCTGGGGATGAGGGATGAGG + Intronic
974715800 4:65668722-65668744 CAGGATTGGGGGTAGGGAGGGGG + Intronic
975427856 4:74251671-74251693 CACAATGGGGTTTAGGGAGGGGG - Intronic
975781946 4:77849151-77849173 GAGGCTGGGGGCTGGGGAGGGGG - Intergenic
975981999 4:80171710-80171732 CAGGCAGGGGGTTAGGGACTAGG + Intergenic
976572201 4:86625383-86625405 CAAGGTTGGGATGAGGGAGGAGG - Intronic
977446530 4:97138680-97138702 CAGCCTGGGGAGGAGGGAAGAGG + Intergenic
977578142 4:98696458-98696480 CAGGCTGGGGAGTGGGAAGAGGG + Intergenic
979879476 4:125936954-125936976 AAGGCTGGGGGTTAGGAAGGAGG + Intergenic
982076895 4:151746793-151746815 CATGCTGGGGAACAGGGAGATGG + Intronic
982288417 4:153757844-153757866 GAGGATGGGGAATAGGGAGATGG + Intronic
984715285 4:182918836-182918858 CAAGCGGTGGATTTGGGAGGAGG - Intergenic
984942904 4:184950124-184950146 CAGGCTGCGGAGTGGGGGGGGGG + Intergenic
985548788 5:523040-523062 GAGGCTGCGGAGAAGGGAGGAGG + Intronic
985660994 5:1156368-1156390 GAGTCTGGGGATGGGGGAGGTGG - Intergenic
985703498 5:1387408-1387430 CAGGCTGGGGTGAGGGGAGGAGG + Intergenic
986255104 5:6095869-6095891 CTGGTTGGGGAGTGGGGAGGAGG + Intergenic
986308318 5:6532067-6532089 CAAGCTGGGGATTAAAAAGGAGG - Intergenic
986648279 5:9939609-9939631 CGGGCTGGGGAAGAGGGAGGAGG + Intergenic
986781972 5:11074957-11074979 CATTCTGGGGGTTAAGGAGGTGG - Intronic
986785592 5:11111390-11111412 CTGGCTGGGGATTGGGGATCGGG + Intronic
987046118 5:14110475-14110497 CAGGTTTGGGATGAGGTAGGAGG + Intergenic
989074352 5:37547779-37547801 TAGTTGGGGGATTAGGGAGGAGG - Intronic
989439912 5:41458118-41458140 CAGGCGTGGGATGAGGGAGTAGG - Intronic
990347552 5:54884486-54884508 CAGGCTGGAGGGTTGGGAGGAGG + Intergenic
990713395 5:58609033-58609055 CATGTTGGGGAGTGGGGAGGAGG + Intronic
992066663 5:73115963-73115985 CGACCTGGGGGTTAGGGAGGAGG + Intergenic
992326624 5:75666269-75666291 CAGGCTGGGGCTTGGGGAAGAGG - Intronic
993650728 5:90519083-90519105 CAGACTGGGGAATAGGGTGGTGG - Exonic
993775647 5:91992044-91992066 CAGGCTGGAGATAACGGAGGTGG + Intergenic
993902486 5:93593948-93593970 CAGGCTGGGTGGGAGGGAGGAGG + Exonic
994145848 5:96393880-96393902 TAGGCTGGGGAGGAGGGAGCTGG + Intronic
994573691 5:101547953-101547975 GAGGCTGGGGATTGGAGAAGAGG + Intergenic
996185994 5:120476031-120476053 CAGCATAGGGATTAGAGAGGTGG - Intronic
996861046 5:128066019-128066041 CAGGCAGGGGTTTAGGGATTAGG - Intergenic
997222425 5:132180604-132180626 CAAGCTGGGGTGTGGGGAGGGGG + Intergenic
997554761 5:134786373-134786395 CAGGCAGGGGAAGAGGGAGGAGG - Intronic
997726044 5:136120525-136120547 CTGGGTGGGGATTAGAGTGGAGG - Intergenic
997752272 5:136357673-136357695 GAGGCTGGGGCGTAGGGTGGTGG + Intronic
998076408 5:139240220-139240242 CAGGCTGAGGGTGAGGGTGGGGG + Intronic
998130971 5:139650880-139650902 CAGGCTGGAGCTTGGGGGGGTGG + Intronic
998159255 5:139803833-139803855 CTGGCCTGGGCTTAGGGAGGGGG + Intronic
998368939 5:141649122-141649144 AAGGTTGGGGAACAGGGAGGTGG - Intronic
998389740 5:141779806-141779828 CAGGCTGGGAAGCAGGGGGGAGG + Intergenic
1000662186 5:163950581-163950603 TGGGCTTGAGATTAGGGAGGAGG - Intergenic
1000848142 5:166306704-166306726 CAGGCTTTGGAATAGGGAGTAGG + Intergenic
1001017672 5:168156128-168156150 CAGGCTGAGGCTCAGAGAGGTGG + Intronic
1001406017 5:171478181-171478203 GAGGCTGGGGATTAAGGAGATGG - Intergenic
1002375174 5:178783673-178783695 CAGGCACGGGGCTAGGGAGGGGG - Intergenic
1002534682 5:179869739-179869761 CTGGCTGGGGAGTGGGCAGGAGG + Intronic
1002594312 5:180312175-180312197 GAGGCTGAGGACCAGGGAGGCGG + Intronic
1003098913 6:3162672-3162694 CAGCCTCGGGATTAGGGGAGAGG - Intergenic
1003299170 6:4861319-4861341 CAGGCTGGTGGCTGGGGAGGAGG + Intronic
1004803091 6:19172653-19172675 CAAGGTGGGGATGTGGGAGGAGG - Intergenic
1005886410 6:30101054-30101076 CCGGCTGGGGACTGGGTAGGCGG - Intergenic
1005957797 6:30676780-30676802 CAGGCTGTGGTCAAGGGAGGAGG + Exonic
1006059672 6:31410894-31410916 CAGGCTGGGGGTGAGGAATGGGG + Intronic
1006071981 6:31505126-31505148 CATGGTGGGGACAAGGGAGGGGG - Intronic
1006132394 6:31877468-31877490 CTGGGGAGGGATTAGGGAGGAGG - Intronic
1006154006 6:32004424-32004446 CAGTTTGGGGATTTGGGAAGAGG - Intergenic
1006160313 6:32037161-32037183 CAGTTTGGGGATTTGGGAAGAGG - Intergenic
1006269184 6:32950816-32950838 CAGGGTGAGGTTCAGGGAGGTGG + Intronic
1006454521 6:34124160-34124182 CAGTCCGGGGATCAGGGAGAAGG - Intronic
1007178911 6:39914595-39914617 CAGGCTGGGGGTGCTGGAGGGGG - Intronic
1007515412 6:42406760-42406782 AAGGCTGGGGAGGAGGGGGGTGG - Intronic
1007675921 6:43594935-43594957 AAGGCTGGGGGCTGGGGAGGTGG + Intronic
1007694951 6:43726071-43726093 AATGCTGGGGAGTTGGGAGGAGG - Intergenic
1007777055 6:44229803-44229825 CAGGCTGGGGGCTGGGGAGGGGG - Intronic
1010265027 6:73856319-73856341 CAGGCTGGGAAACAGGGAGAAGG + Intergenic
1012057590 6:94433211-94433233 CAGGCAGGGGACTAGGGGAGGGG + Intergenic
1012367861 6:98464192-98464214 CAAACTGGGGAAAAGGGAGGAGG + Intergenic
1012772403 6:103455562-103455584 GAGGCTAGGGAGCAGGGAGGTGG + Intergenic
1013344145 6:109243800-109243822 CTTCCTGAGGATTAGGGAGGAGG + Intergenic
1016778568 6:147933488-147933510 CAGGCTAGGGAATAGGGAAGTGG + Intergenic
1017079975 6:150658743-150658765 CAGGGTGAGGAGCAGGGAGGAGG - Intronic
1017820256 6:158044063-158044085 AAGACTGGGGATTAGTGGGGAGG - Intronic
1018395854 6:163377636-163377658 CAGGCTGGAGATGAGGGATTTGG - Intergenic
1019312039 7:367589-367611 CAGCCTGGGGAGGAGGGAGGGGG + Intergenic
1019489873 7:1307334-1307356 CAGGCTGGGGACCTGGGAGTGGG - Intergenic
1019661350 7:2225696-2225718 CAGGCTGGGGAACAGGGGAGGGG + Intronic
1019714348 7:2531453-2531475 CAGGCTGGGGACGAGGGCAGTGG + Intergenic
1019741975 7:2679619-2679641 CAGGCTGGGGACGAGGGCAGTGG - Exonic
1021128838 7:16886217-16886239 CAGGCTGGAGAATATGGATGTGG + Intergenic
1021182132 7:17518958-17518980 CAGGGTGGGGGTTAGGGGGTGGG + Intergenic
1021997387 7:26193595-26193617 CAGGGTGGGGGCTACGGAGGTGG - Exonic
1022612424 7:31890184-31890206 CATGCTGGGGACTGGGGAGAGGG + Intronic
1022788833 7:33666163-33666185 AAGGCTGGGGATGAGGGAAATGG - Intergenic
1024306123 7:47931052-47931074 CAGACTGGGGATTGGAGAAGTGG + Intronic
1024428935 7:49263070-49263092 GAGGCTTGGGATGAGGGATGGGG + Intergenic
1024625616 7:51206858-51206880 GGGGCTGGGCAATAGGGAGGTGG + Intronic
1025847941 7:65217290-65217312 CAGGATGGGGGGTGGGGAGGAGG - Intergenic
1025898183 7:65723154-65723176 CAGGATGGGGAGTGGGGAGGAGG - Intergenic
1026091734 7:67306098-67306120 AAGGCTGGGAATTAGAAAGGGGG - Intergenic
1026111120 7:67459602-67459624 CAAGCTGGTGATACGGGAGGGGG - Intergenic
1026136090 7:67662328-67662350 AAGTCTGAGGATGAGGGAGGTGG - Intergenic
1026451126 7:70530619-70530641 CAGGCTGGGGGCTGGGGAAGAGG - Intronic
1026532556 7:71212239-71212261 CAGGCTGTGGCTTTGGAAGGTGG + Intronic
1026638664 7:72105833-72105855 AGGGATGGGGATGAGGGAGGGGG + Intronic
1027362400 7:77422789-77422811 CAGGTTGGGGAACAGGGAGTGGG - Intergenic
1027375288 7:77542036-77542058 ATGGCTGGGGGTTGGGGAGGTGG + Intronic
1028159809 7:87473336-87473358 CAGGTTTGGGAGTAGGGATGTGG - Intronic
1028401039 7:90425710-90425732 CAGGCTAGGGATGGGGGAGAGGG + Intronic
1028653067 7:93171943-93171965 CAGGCAGGGGACTAGGGAATGGG + Intergenic
1028789293 7:94835173-94835195 CAGGCAGGTGGGTAGGGAGGTGG - Intergenic
1029232043 7:99078518-99078540 CAGCCTGGGGGATGGGGAGGAGG - Intronic
1029377206 7:100186311-100186333 AAGGCTGGGAATTAGAAAGGGGG - Intronic
1029381671 7:100219447-100219469 CAGGCTGGGGGTTGTGGGGGAGG + Intronic
1029401832 7:100351895-100351917 CAGGCTGGGGGTTGTGGGGGAGG + Intronic
1029506248 7:100965685-100965707 ATGGCTGGGGGTTGGGGAGGGGG - Exonic
1029746283 7:102517407-102517429 GGGGCTGGGAACTAGGGAGGGGG - Intronic
1029764221 7:102616386-102616408 GGGGCTGGGAACTAGGGAGGGGG - Intronic
1030445874 7:109646190-109646212 CAGTCTGGGGATGAGGGGAGAGG + Intergenic
1030472457 7:109982275-109982297 CAGGCAGGGGACTAGGGAATGGG - Intergenic
1032472264 7:132187163-132187185 CAGGCGGGGGGTTAGGGAGTGGG - Intronic
1032550008 7:132776294-132776316 CACGCAGGGGATGAGGGGGGTGG - Intergenic
1032841166 7:135714562-135714584 CAGCCTGGGGTTCAGGCAGGTGG + Intronic
1033220833 7:139525242-139525264 CAGGCTCGAGGTCAGGGAGGGGG + Intronic
1033282230 7:140014407-140014429 CAGGCTGGGGCTGAGGTAGGAGG + Intronic
1033363873 7:140656833-140656855 CAGGCTGGGACATATGGAGGAGG - Intronic
1033433336 7:141308823-141308845 AAGGCTGGGGATTCAGGAGCCGG - Intronic
1033589513 7:142797626-142797648 AAGACTGGGGAAGAGGGAGGGGG + Intergenic
1034219109 7:149430946-149430968 CTGGCTGAGGAGTAGGGTGGCGG - Intergenic
1034289035 7:149913383-149913405 CAGACTGAGGATAGGGGAGGCGG + Intergenic
1034420389 7:150987491-150987513 CCAGCTGGGGAGCAGGGAGGGGG + Intergenic
1034436850 7:151066601-151066623 CAGGCTGGGCTTTGGGCAGGGGG - Exonic
1034662036 7:152779466-152779488 CAGACTGAGGATAGGGGAGGCGG - Intronic
1034919508 7:155068412-155068434 CTGGCAGGGGGTAAGGGAGGGGG + Exonic
1035314515 7:157989820-157989842 CAGGCGGGGGATTGGGCAGAAGG - Intronic
1035469291 7:159099525-159099547 CAGGCTGGGGCTCAGAAAGGAGG + Intronic
1035939083 8:3875680-3875702 CTGGCTGAGGTCTAGGGAGGGGG + Intronic
1037628129 8:20626455-20626477 CTGGCTTGGGATTAAGGAGATGG + Intergenic
1037745011 8:21636276-21636298 CAGACTGGGGCTTGGGGAGCAGG + Intergenic
1037748286 8:21663400-21663422 CAGGCTGGGGGTTAGGGTCCAGG - Intergenic
1037961584 8:23102276-23102298 GAGGCTGAGGAGTAGGTAGGAGG - Intronic
1037969940 8:23164645-23164667 GAGGCTGAGGAGTAGGTAGGAGG + Intergenic
1038227548 8:25670780-25670802 CTGGCTGGGAATTAGAGAGGAGG + Intergenic
1038398201 8:27262485-27262507 CAGGATGGCGATCAGGGAGCAGG + Intergenic
1038798884 8:30731865-30731887 CAGGCTTGGGAACAGGCAGGAGG - Intergenic
1039458070 8:37721065-37721087 CAGTATGAGGATTTGGGAGGTGG - Intergenic
1040864954 8:52039448-52039470 CAGGCAGGAGATTATGCAGGTGG - Intergenic
1041005386 8:53492784-53492806 GAGGGTGGTGATGAGGGAGGCGG + Intergenic
1041044345 8:53877442-53877464 CCGGCTGGGGCTTGGGGTGGAGG - Intronic
1042526473 8:69769722-69769744 CAGGCTGGGGAGATGGGAGTTGG + Intronic
1043176385 8:77027528-77027550 TTGGCTGGGGGTTAGGGAGAGGG - Intergenic
1043226983 8:77745678-77745700 CAGCCTGAGGTTTGGGGAGGGGG - Intergenic
1043598746 8:81915054-81915076 CAGTCTGGGGATGAGGGGAGAGG - Intergenic
1044328084 8:90883648-90883670 AAGGCTGGGGTTAAGGGAGAAGG - Intronic
1047526554 8:125638812-125638834 CAGGCAGGGCTTCAGGGAGGAGG + Intergenic
1048563773 8:135571726-135571748 GAGGCTGGGGATTAGAGTTGGGG + Intronic
1049273286 8:141707474-141707496 CACGCTGGGGTGTGGGGAGGGGG - Intergenic
1049361732 8:142215277-142215299 CTGCCTGGGGATGAGGGTGGGGG + Intronic
1049407022 8:142456133-142456155 GGGGCTGGGGAACAGGGAGGGGG - Intronic
1049468721 8:142765463-142765485 CAGGGTGGGGGGTGGGGAGGAGG + Intronic
1049511382 8:143028430-143028452 GAGGCTGTGGATGGGGGAGGTGG - Intergenic
1049692728 8:143969707-143969729 CAGGCCGGGGAGTGGGGAGTGGG + Intronic
1050233040 9:3548805-3548827 CAGGCTAGGGAGTATGCAGGAGG + Intergenic
1050712057 9:8476170-8476192 CAGGGTGGGGATTGGGGGGATGG + Intronic
1050837978 9:10108454-10108476 TGGGCTGGGGATTAGAGAGATGG - Intronic
1052680136 9:31680566-31680588 AAGGAAGGGGAATAGGGAGGAGG + Intergenic
1054752599 9:68923121-68923143 GAGTCTGGGGCTGAGGGAGGAGG - Intronic
1056331175 9:85522592-85522614 CAGGCTGTTGAGTAGGGAAGTGG + Intergenic
1056406883 9:86283094-86283116 CACGCTGGGGAGAAGGGTGGAGG - Intergenic
1056927546 9:90847621-90847643 CAGGCAGGGTATTAGTGAGAGGG + Intronic
1057264309 9:93603929-93603951 CAGGCTGGGGGATCTGGAGGTGG - Intronic
1057739171 9:97697062-97697084 CAGTCTGGGGACCGGGGAGGCGG + Intronic
1057999308 9:99848880-99848902 CAGACTGGGGCCTGGGGAGGTGG + Intronic
1059671652 9:116497714-116497736 CAGGCTGGGGAGAAGGGGGAGGG + Intronic
1060114522 9:120929455-120929477 CAGGCAGGGGACCAGGGTGGGGG - Intergenic
1060384901 9:123216162-123216184 CAGGCAAAGGATTAGGAAGGGGG - Intronic
1060530635 9:124345370-124345392 CAGGCTGGGGCGGATGGAGGAGG + Intronic
1060729788 9:126030076-126030098 CAGGCTGGAAAGTTGGGAGGAGG - Intergenic
1061238864 9:129357793-129357815 CAGGCTGGGGAGGAGGGTGGTGG - Intergenic
1061257301 9:129460308-129460330 CAGGCGGGGGAGGAGGGAGGAGG - Intergenic
1061292788 9:129661486-129661508 CAGCCTGGGGATAAGGGCTGGGG - Intergenic
1061389172 9:130307680-130307702 CTGGCTGGGGGTCAGGGCGGCGG - Intronic
1061389185 9:130307727-130307749 CAGGCTGGGGGTGAGGGTGGGGG - Intronic
1061805878 9:133137613-133137635 CAGGCGGGGGAAGAGCGAGGAGG + Intronic
1061818003 9:133207744-133207766 GAGGCTGAGGGTTAGGGACGGGG - Intronic
1061818023 9:133207810-133207832 GAGGCTGAGGGTTAGGGATGGGG - Intronic
1061961277 9:133990541-133990563 CAGGCTGGGGCTCAGGGCAGAGG - Intronic
1062016365 9:134293217-134293239 CAGGCTGGGGCTCCTGGAGGGGG + Intergenic
1062280753 9:135750648-135750670 CAGGATAGGGATTGGGGAGCAGG - Intronic
1186415811 X:9382287-9382309 CAGGCTGGGGCTTAGAGCAGAGG - Intergenic
1186506590 X:10098310-10098332 CTGGCTGGGGAGGGGGGAGGGGG - Intronic
1186856946 X:13635910-13635932 CAGAGTGGGGATGAGAGAGGGGG - Intergenic
1188992921 X:36845844-36845866 CAGGATGGGGATATGGAAGGAGG + Intergenic
1189268661 X:39735489-39735511 ATGGCTGGGGAAGAGGGAGGGGG + Intergenic
1189284211 X:39840162-39840184 CAGGCTGGGGGTGTGGGGGGTGG + Intergenic
1189369806 X:40418673-40418695 CAGCCCGGGGATTAGGGGGTCGG + Intergenic
1189419370 X:40842976-40842998 CAGGCAGGGGGTTAGGGAATGGG - Intergenic
1191750355 X:64535722-64535744 CAGGCTGGGGTCTAAGCAGGTGG + Intergenic
1191774769 X:64801916-64801938 CAGACTGGGGCTATGGGAGGGGG - Intergenic
1191780431 X:64858439-64858461 CAGGTTGGAGAGTAGGGTGGAGG - Intergenic
1192062098 X:67838422-67838444 CAGCCTGGGGTTAGGGGAGGAGG - Intergenic
1192191725 X:68995288-68995310 GAAGCAGGGGAATAGGGAGGAGG - Intergenic
1192428939 X:71099875-71099897 AAGGCTGGGATTCAGGGAGGGGG + Intronic
1193225381 X:78976452-78976474 CAGGCTTGGTATTAGGGTGATGG + Intergenic
1194400317 X:93432950-93432972 CAGGCTTGGGAACAGGCAGGAGG - Intergenic
1196717938 X:118827824-118827846 AAGGCTGGGGAATGGGGTGGAGG + Intergenic
1197147414 X:123185112-123185134 CAGGCTGGTGCTGGGGGAGGTGG + Intronic
1197769799 X:130082721-130082743 CTGGCTGGCGAGGAGGGAGGTGG - Intronic
1197892342 X:131279563-131279585 TAGGCTGCGGAGTGGGGAGGGGG - Intronic
1198551454 X:137749533-137749555 TAAGCTGGGGATTTGGGTGGGGG + Intergenic
1198994836 X:142562438-142562460 CAGCTGGGGGATGAGGGAGGTGG - Intergenic
1199979134 X:152911495-152911517 CAGGCCAGGGACCAGGGAGGAGG + Intergenic
1201497376 Y:14602881-14602903 CTGTCTGGGGATTTGGGAGGAGG + Intronic
1201521039 Y:14873886-14873908 GAGGCTGAGGAATAAGGAGGAGG + Intergenic
1201559613 Y:15302129-15302151 CAGGCAGGGGATTAGGAAATGGG - Intergenic
1201770586 Y:17613894-17613916 CAGGCTAGGGATGAGAGAGATGG - Intergenic
1201830969 Y:18292092-18292114 CAGGCTAGGGATGAGAGAGATGG + Intergenic
1201977570 Y:19869493-19869515 CGGGCTGGGGAATGGGAAGGCGG - Intergenic