ID: 1172650854

View in Genome Browser
Species Human (GRCh38)
Location 20:36500431-36500453
Sequence TCGAGCCAGGGGTCGGGTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 191}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172650854_1172650871 17 Left 1172650854 20:36500431-36500453 CCCCCACCCGACCCCTGGCTCGA 0: 1
1: 0
2: 0
3: 17
4: 191
Right 1172650871 20:36500471-36500493 CAGCAGAGCCGGCACAGCCAGGG 0: 1
1: 0
2: 0
3: 30
4: 319
1172650854_1172650865 6 Left 1172650854 20:36500431-36500453 CCCCCACCCGACCCCTGGCTCGA 0: 1
1: 0
2: 0
3: 17
4: 191
Right 1172650865 20:36500460-36500482 CTCCAGCTCCCCAGCAGAGCCGG 0: 1
1: 0
2: 3
3: 34
4: 371
1172650854_1172650872 18 Left 1172650854 20:36500431-36500453 CCCCCACCCGACCCCTGGCTCGA 0: 1
1: 0
2: 0
3: 17
4: 191
Right 1172650872 20:36500472-36500494 AGCAGAGCCGGCACAGCCAGGGG 0: 1
1: 0
2: 2
3: 29
4: 243
1172650854_1172650870 16 Left 1172650854 20:36500431-36500453 CCCCCACCCGACCCCTGGCTCGA 0: 1
1: 0
2: 0
3: 17
4: 191
Right 1172650870 20:36500470-36500492 CCAGCAGAGCCGGCACAGCCAGG 0: 1
1: 0
2: 0
3: 40
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172650854 Original CRISPR TCGAGCCAGGGGTCGGGTGG GGG (reversed) Exonic
900140391 1:1137239-1137261 TCGAGGCCGGCGTGGGGTGGGGG + Intergenic
900793342 1:4693375-4693397 TGGAGGCAGGGGGCGGGGGGAGG + Intronic
900920963 1:5670061-5670083 TGGAGCAGGGGGTTGGGTGGGGG + Intergenic
902402869 1:16167595-16167617 GCGGGCCAGGGGTGCGGTGGGGG + Intergenic
902465193 1:16613223-16613245 GCGAGCGCGGGGGCGGGTGGGGG - Intronic
903868724 1:26417028-26417050 TCAAGCCGGTGGTTGGGTGGGGG + Intronic
904941116 1:34165309-34165331 TCGCGCCGGGGGGCGGGAGGGGG + Intronic
905940711 1:41861050-41861072 TCGAGCCAGGGCACTGGAGGTGG + Intronic
908292776 1:62685530-62685552 TGGAGCCCGGGGGTGGGTGGGGG - Intronic
912416313 1:109510188-109510210 TCAAGACGGGGGTGGGGTGGGGG - Intergenic
914676912 1:149912962-149912984 TTGGGCCAGTGGTTGGGTGGTGG - Intronic
914764088 1:150622734-150622756 TGCAGCCAGGGGTCAGGAGGTGG - Exonic
917893874 1:179467047-179467069 TCTACTCAGGGGTCGGGTGGTGG - Intronic
922352614 1:224746707-224746729 AAGAGCAAGGGGTGGGGTGGGGG - Intergenic
924267756 1:242300411-242300433 TCCAGCCTGGGGTGGGGTGGCGG + Intronic
1063994167 10:11601397-11601419 TCAAGCCAGTGGTAGGATGGAGG + Intronic
1064998256 10:21315177-21315199 GGGAGGCAGGGGTGGGGTGGGGG - Intergenic
1067306739 10:45071530-45071552 TCGAGGTAGGGGTTGGGCGGTGG - Intergenic
1069801368 10:71083967-71083989 TCTAGGCAGGGGTAGGGGGGAGG + Intergenic
1074401270 10:113142707-113142729 TGGAGCCTGGGGCCGGCTGGAGG - Intronic
1076688381 10:132208316-132208338 GGGAGCCTGGGGACGGGTGGGGG + Intronic
1076777870 10:132708079-132708101 CCCAGCCTGGGGTGGGGTGGGGG - Intronic
1077273789 11:1693961-1693983 TTGGGCCAGGGGTTGGGGGGTGG + Intergenic
1077332899 11:1991077-1991099 TCCAGCCAGGTGTTGGGTGATGG + Intergenic
1077537320 11:3130587-3130609 CCGAGCCAGGGGCCAGGTGAGGG - Intronic
1078551963 11:12287376-12287398 CTGAGCCAGGGGTGGGGTGGAGG - Intronic
1079706855 11:23632350-23632372 TCCAGCCAGGGGTTGGGGAGGGG - Intergenic
1083940271 11:65891755-65891777 TCGAGCCTGGGGTGGGATGCGGG + Intergenic
1084870818 11:72097600-72097622 TCTGGCCAGGGATGGGGTGGGGG - Exonic
1085834272 11:79935646-79935668 TGGCGGCAGGGGTTGGGTGGGGG - Intergenic
1089274878 11:117328004-117328026 TCGAGGGAGGGGTTGGGCGGCGG + Intronic
1089289417 11:117428685-117428707 TCGAGCCAGGTTCCGGATGGAGG + Exonic
1089528575 11:119112518-119112540 TCGAGACAGTGGTCTGGAGGGGG - Exonic
1090199397 11:124843414-124843436 TCAAGCCAGGGGCGGGGGGGAGG + Intergenic
1202815882 11_KI270721v1_random:46253-46275 TCCAGCCAGGTGTTGGGTGATGG + Intergenic
1102033411 12:109757748-109757770 GGGAGCCAGGGGTGGGGAGGGGG + Intronic
1102258878 12:111431246-111431268 TCGAGTCAGGCATGGGGTGGGGG - Intronic
1103209441 12:119155651-119155673 TTGAGCCTGGAGTGGGGTGGAGG + Intronic
1103846687 12:123907020-123907042 TCAGGGCAGGGGTGGGGTGGGGG - Intronic
1103957032 12:124582943-124582965 TGGAGCCAGGGTGGGGGTGGGGG + Intergenic
1105210531 13:18254372-18254394 TCCAGCCAGGTATGGGGTGGAGG - Intergenic
1105284004 13:18989686-18989708 TGGGGCCAGTGGTGGGGTGGGGG + Intergenic
1105849907 13:24323961-24323983 TCAAGGCAGGGACCGGGTGGAGG - Intergenic
1106598406 13:31166552-31166574 TTGGGCCAGGGGTGAGGTGGTGG - Intergenic
1112334305 13:98501353-98501375 GCTAGCCAGGGGTGGGGCGGGGG + Intronic
1112487250 13:99831083-99831105 AAGAGGCAGGGGTTGGGTGGCGG + Intronic
1113931684 13:113972126-113972148 TAGAGGCCGGGGTCGGATGGAGG - Intergenic
1114280982 14:21192351-21192373 TCCAGCCAGGGTTTGGGTGGCGG - Intergenic
1121310196 14:92931659-92931681 TGTAGCCAAGGCTCGGGTGGGGG - Exonic
1121696564 14:95917971-95917993 TCCTGCCAGGGGCTGGGTGGAGG - Intergenic
1121963184 14:98280476-98280498 TCAGGCCAAGGGTGGGGTGGAGG - Intergenic
1122099354 14:99394861-99394883 TAGGGCCAGGGGTTGGGTGGCGG - Intergenic
1122782816 14:104150774-104150796 TGGGGCCAGGTTTCGGGTGGTGG + Intronic
1122791666 14:104186437-104186459 TGGAGCCTGCGGTCGGGTGTGGG - Intergenic
1122813494 14:104300699-104300721 GCTAGGCAGGGGCCGGGTGGTGG + Intergenic
1122953641 14:105060036-105060058 TCCAGCCAGTGGCAGGGTGGTGG - Intronic
1125655160 15:41350479-41350501 TGGAACCAGGGGTCGGGGGGAGG + Intronic
1127815827 15:62608097-62608119 TAGATGCAGGGGTGGGGTGGGGG - Intronic
1128322482 15:66703225-66703247 TGGCGCCAGGGGTGGGGGGGAGG - Exonic
1129313239 15:74726397-74726419 GCTAGCCGGGGGTAGGGTGGGGG - Intergenic
1129360542 15:75021297-75021319 TCTGGCCTGGGGTCGGGTGAAGG + Exonic
1131120666 15:89821575-89821597 TTGAGCCAGGGGTGGGCTGGGGG + Intergenic
1132518242 16:375909-375931 TCGGGTCAGAGGTGGGGTGGAGG - Intronic
1132594129 16:740554-740576 GCGACCCAGGGGTCGGGTTAGGG + Intronic
1133102196 16:3486302-3486324 CCGATGCAGGGGTGGGGTGGGGG + Exonic
1133220021 16:4315912-4315934 GCGAGCGAGGGGAGGGGTGGAGG + Intronic
1134346764 16:13398589-13398611 TCGAACCGGAGGTGGGGTGGGGG - Intergenic
1134510443 16:14842382-14842404 TATAGTCAGGGGTAGGGTGGGGG + Intronic
1134973751 16:18553807-18553829 TATAGTCAGGGGTAGGGTGGGGG - Intronic
1136428784 16:30185439-30185461 CAGAGCCATGGGTCCGGTGGAGG - Intronic
1136544292 16:30947239-30947261 TCGAGTCCGGGGGAGGGTGGGGG - Exonic
1137343973 16:47637358-47637380 GTGAGCCAGGTGTTGGGTGGGGG - Intronic
1137592663 16:49703375-49703397 TAGAGTCAGGGATGGGGTGGGGG + Intronic
1138094958 16:54204274-54204296 TCATGCCTGGGGTCGGGGGGTGG + Intergenic
1142586779 17:979180-979202 TGGGGGCAGGGGTCGGGGGGTGG + Intronic
1143099709 17:4498569-4498591 CCGAGGCAGGGGTTGGGTGAAGG + Intergenic
1144286254 17:13777694-13777716 TAGAGGCAGGGGTGGGGAGGAGG - Intergenic
1144735662 17:17553954-17553976 CCCAGCCAGGGGTGGGGTGGGGG + Intronic
1145029666 17:19495154-19495176 TCGAGCATGGGGGCAGGTGGTGG + Intergenic
1145260024 17:21349117-21349139 TGGAGCCATGGGGCTGGTGGGGG - Intergenic
1145316594 17:21738821-21738843 TGGAGCCATGGGGCTGGTGGGGG + Intergenic
1145858175 17:28182694-28182716 TCCAAACAGGGGTGGGGTGGTGG - Intronic
1147608088 17:41785551-41785573 TTCAGCCAGGGGCCGGCTGGGGG + Intronic
1147643980 17:42022747-42022769 AGGAGCCAGAGGTGGGGTGGAGG + Intronic
1147659818 17:42111537-42111559 TGGGGCCAGGGGTAGGGAGGCGG + Intronic
1148611009 17:48964617-48964639 TAAAGCCTGGGGTGGGGTGGGGG - Intronic
1152103239 17:78314843-78314865 GTGAACCAGGGGGCGGGTGGGGG - Intergenic
1153294694 18:3534352-3534374 TCAATCCAGGGGTCCGGAGGAGG + Exonic
1153935306 18:9914875-9914897 CCGGGGCAGGGGTCGGGGGGCGG - Intronic
1154501886 18:15001370-15001392 TCCTGCCACGGGTGGGGTGGAGG - Intergenic
1157626460 18:49055134-49055156 TGGAGACAGGGCTGGGGTGGGGG + Intronic
1160715200 19:573182-573204 TGGAGCCAGGGGTCAGGGGCTGG + Intronic
1161410399 19:4113750-4113772 TTGAGCCAGGGGTGGGGTTGGGG + Intronic
1161981692 19:7633370-7633392 TTGAGCTGGGGGTGGGGTGGGGG + Intronic
1162768917 19:12937553-12937575 TCTAGACTGGGGTCGGGGGGTGG + Intergenic
1163023387 19:14495762-14495784 TCCAGCCGGGGGACGGGGGGAGG + Intronic
1163035847 19:14568398-14568420 TCAAGCGAGGTGTGGGGTGGAGG - Intronic
1164658520 19:29942255-29942277 CCCAGCCAGGCGTCGCGTGGCGG - Exonic
1164735401 19:30537287-30537309 TGGAGCCAGGGTTGTGGTGGTGG + Intronic
1166184844 19:41133347-41133369 GCGAGCCAGTGGGCGGGGGGGGG - Intergenic
1166702532 19:44890667-44890689 CCGAACCAGAGGTGGGGTGGGGG + Intronic
1166805815 19:45486225-45486247 TAGAGCCGGGGGTGGCGTGGTGG - Intronic
1166817843 19:45557539-45557561 TCTAGCCAGGGGACAGGTGTGGG - Intronic
1167250621 19:48396744-48396766 TCGAGGCAGGGGAGGGGTGGTGG + Intronic
1167755732 19:51412254-51412276 TGGTGCCCGGGGTGGGGTGGGGG + Intronic
1167792698 19:51691135-51691157 TGGAGCTGGGGGTGGGGTGGGGG - Intergenic
1168290477 19:55354831-55354853 GGGAGCAAGGGGTGGGGTGGGGG - Exonic
1168405529 19:56108377-56108399 TCTGGGCAGGGGTTGGGTGGAGG - Intronic
924965612 2:73824-73846 TGGAGCCAGGGGTGGTGGGGGGG - Intergenic
929961479 2:46499830-46499852 GGGAGCCAGGGGTCGGGGTGGGG - Intronic
931427525 2:62184733-62184755 TACAGCCAGGGATGGGGTGGAGG + Intergenic
934691656 2:96365396-96365418 TCGGGCAGGGGGTGGGGTGGGGG - Intronic
937044367 2:118843419-118843441 TCGATCCAGGGATTGGCTGGCGG - Intronic
937148457 2:119668478-119668500 TGGAGCCAGGGGTGGGATTGGGG - Intergenic
938066647 2:128285226-128285248 CCCAGCCAGGGGTCTGGTGGAGG + Intronic
945080754 2:206085219-206085241 GCGGGCGTGGGGTCGGGTGGAGG - Intronic
946093369 2:217250126-217250148 TTCAGACAGGGGTCAGGTGGAGG - Intergenic
948745173 2:240086252-240086274 TGCAGCAAGGGGTGGGGTGGGGG + Intergenic
1168777804 20:462422-462444 ACCAGCCGGGGCTCGGGTGGGGG - Exonic
1169201471 20:3712366-3712388 TAGGGGCAGGGGTCGGGGGGGGG - Intergenic
1169207402 20:3748200-3748222 TCCAGCCTGGGGATGGGTGGTGG - Exonic
1170368055 20:15618690-15618712 TGCAGCCAGGGGTCAGGAGGTGG - Intronic
1170521148 20:17186748-17186770 TGGAGCCTGTGGTGGGGTGGGGG + Intergenic
1170917573 20:20642213-20642235 TTGAGGCAGGGGTCGGGGGATGG + Intronic
1171291672 20:23986062-23986084 TCCAGCCAGGTATGGGGTGGAGG - Exonic
1172519586 20:35558187-35558209 CCAAGCCAGGGGTCTGGTGCTGG - Intergenic
1172650854 20:36500431-36500453 TCGAGCCAGGGGTCGGGTGGGGG - Exonic
1174350821 20:49966441-49966463 TTGTGACAGGGGTGGGGTGGAGG + Intergenic
1174731947 20:52926765-52926787 TAGAGCCAGGGGTTGGATGAAGG - Intergenic
1175260348 20:57670188-57670210 TGGAGGTAGGGGTGGGGTGGGGG + Intronic
1176096083 20:63345247-63345269 TCCAGCCAGGGGTGGGGATGGGG - Exonic
1176107328 20:63395608-63395630 TCCAGGCAGGGGACGGGGGGCGG + Intergenic
1179221634 21:39412998-39413020 TCTAGCCAGGGATCAGATGGAGG + Intronic
1179343016 21:40530753-40530775 TCGAGCGATGGGGTGGGTGGTGG - Intronic
1179970945 21:44836353-44836375 TGGGGTCAGGGGTGGGGTGGGGG - Intergenic
1179970986 21:44836431-44836453 TGGGGACAGGGGTGGGGTGGGGG - Intergenic
1180765723 22:18345030-18345052 TCCAGCCAGGTATGGGGTGGAGG + Intergenic
1180780586 22:18517348-18517370 TCCAGCCAGGTATGGGGTGGAGG - Exonic
1180813306 22:18774669-18774691 TCCAGCCAGGTATGGGGTGGAGG - Intergenic
1180908314 22:19431390-19431412 CCGAGCCCGGAGTCGGGTCGGGG - Intronic
1181199481 22:21208985-21209007 TCCAGCCAGGTATGGGGTGGAGG - Exonic
1181400278 22:22646873-22646895 TCCAGCCAGGTATGGGGTGGAGG + Exonic
1181649086 22:24248918-24248940 TCCAGCCAGGTATGGGGTGGAGG - Intergenic
1181702254 22:24627971-24627993 TCCAGCCAGGTATGGGGTGGAGG + Exonic
1182094104 22:27614607-27614629 CCCACCCCGGGGTCGGGTGGTGG - Intergenic
1183110342 22:35644187-35644209 CCTGGCCAGGGGTGGGGTGGAGG - Intergenic
1184388797 22:44191268-44191290 CCGAGGCTGGGGTGGGGTGGGGG - Intronic
1184840246 22:47048340-47048362 TCCAGCCTGAGGTCGGGAGGTGG + Intronic
1184850166 22:47115348-47115370 TGGAGCCGGGGGTGGGGTGGTGG - Intronic
1203227345 22_KI270731v1_random:85921-85943 TCCAGCCAGGTATGGGGTGGAGG + Intergenic
1203263408 22_KI270734v1_random:351-373 TCCAGCCAGGTATGGGGTGGAGG - Intergenic
950441732 3:13014596-13014618 AAGAGCCAGGGCTGGGGTGGGGG + Intronic
950669865 3:14519588-14519610 TGGGGCCAGGGGCAGGGTGGGGG - Intronic
950815984 3:15702821-15702843 TTGGGCCAGGGGTGGGGTGGTGG - Intronic
953714644 3:45306952-45306974 GGGAGCCGGGGGTGGGGTGGGGG - Intergenic
954363278 3:50133614-50133636 TCCAGCCAGGAGGCAGGTGGGGG - Intergenic
954377940 3:50204827-50204849 CCCAACCAGGGGTGGGGTGGGGG - Intergenic
960623288 3:119656673-119656695 TCTGGGCAGGGGTCGGGTTGGGG - Intronic
961146604 3:124599030-124599052 TGGGGACAGGGGTGGGGTGGGGG + Intronic
966877608 3:184332102-184332124 TGGGGACAGGGGTGGGGTGGAGG + Intronic
967839353 3:193992372-193992394 TGGAGGGAGGGGGCGGGTGGCGG - Intergenic
968642033 4:1719828-1719850 TGGAGGCAGGTGTCGGGTGGAGG - Intronic
969701008 4:8767852-8767874 TTGAGCCAGGGGCCAGGGGGTGG - Intergenic
973221620 4:47732908-47732930 GCGAGACAGTGGTGGGGTGGGGG - Intronic
973279793 4:48347324-48347346 TTGAGCCAGGGGTGGGGGAGGGG - Intronic
973297341 4:48539518-48539540 TCGGGGCAGGGGGAGGGTGGGGG - Intronic
975415522 4:74099841-74099863 TGGAGCCAGGTGTTGGGTGCGGG + Intergenic
985747387 5:1654972-1654994 TCAGCCCAGGGGGCGGGTGGGGG - Intergenic
986714641 5:10514162-10514184 TGGAGTCAGGGATGGGGTGGGGG - Intronic
990046884 5:51443895-51443917 TTGTGCCAGGGGTCAGGTTGAGG - Intergenic
992081179 5:73235043-73235065 TTGGGCGAGGGGTGGGGTGGGGG - Intergenic
994130924 5:96226502-96226524 ATTAGCCAGGGGTGGGGTGGTGG + Intergenic
1000558431 5:162755992-162756014 TCGGGGCGGGGGTGGGGTGGGGG - Intergenic
1000869170 5:166554050-166554072 TCGAGCAAAGGGTCTGGTGTCGG + Intergenic
1001277182 5:170359478-170359500 GCGAGCCAGGACTCGGATGGTGG - Intronic
1001424857 5:171616344-171616366 CGGAGCCAGGGGGCGGGGGGAGG - Intergenic
1001563140 5:172683279-172683301 TCGAAGCCGGGGTGGGGTGGGGG + Intronic
1005649464 6:27873391-27873413 CCGTGCCAGGCGTCGGATGGCGG + Exonic
1007237590 6:40401917-40401939 GAGAGCCAGGGGTCGGGTAGGGG - Intronic
1007268698 6:40618883-40618905 TCGAGCCAGTGGTAGGGGGAAGG - Intergenic
1007421220 6:41720907-41720929 TGGAGCAGGGGGTTGGGTGGAGG - Intronic
1013821182 6:114154978-114155000 TCCAGCTGGGGGTGGGGTGGTGG - Intronic
1018475413 6:164135469-164135491 TCAAGCAAGGGGTGGGGTGGGGG - Intergenic
1019636562 7:2079047-2079069 CCGAGCCAGCGGTTGGGAGGGGG + Intronic
1019890689 7:3943527-3943549 AGGAGGCAGGGGTGGGGTGGGGG - Intronic
1020139062 7:5602880-5602902 TAGAGACGGGGGTGGGGTGGGGG + Intronic
1023856875 7:44189422-44189444 TCCAGCCAGGTGTGGAGTGGGGG + Intronic
1033315328 7:140292423-140292445 TGGGGCCAGGGGTCAGGAGGTGG - Intergenic
1035626481 8:1075003-1075025 TGCAGCCAGGGGTGGAGTGGGGG + Intergenic
1035706361 8:1678452-1678474 TCCAGCCAGGGGTCTGGAGGGGG - Exonic
1037989639 8:23311678-23311700 TCGAGCCATGGGTAGGTGGGAGG - Intronic
1038124289 8:24654332-24654354 GGGAGCCAGGGGTGGGATGGTGG - Intergenic
1039807100 8:41009616-41009638 TCTAGCCAGGGGCCAGGTGATGG - Intergenic
1044341275 8:91048991-91049013 TGAACCCAGGGGTAGGGTGGGGG - Intergenic
1047930792 8:129726767-129726789 TAGAGGCAGGGGGTGGGTGGGGG - Intergenic
1053050482 9:34957828-34957850 CCGCGCCGGGGGTTGGGTGGGGG - Intronic
1053134864 9:35644264-35644286 TGAAACCAGGGGTGGGGTGGAGG + Intronic
1059409686 9:114124253-114124275 AGTAGCCAGGGGTAGGGTGGGGG - Intergenic
1060821750 9:126665299-126665321 TGGAGCCAGGGCTGGGGCGGCGG + Intronic
1062457551 9:136646679-136646701 TGGAGCCAGGGGCAGAGTGGAGG - Intergenic
1062498599 9:136842977-136842999 TCCTGCCACGGGTGGGGTGGAGG + Intronic
1062507695 9:136886547-136886569 GCGAGCGCGGGGTCGGGTGCGGG + Intronic
1062579745 9:137223940-137223962 TGGAGCCTGGGTTCGGCTGGAGG + Intergenic
1188111326 X:26198527-26198549 TCGAGCCAGGAGTCAGGGCGAGG + Intergenic
1188231288 X:27667123-27667145 TAGAGAAAGGGGTGGGGTGGGGG + Intronic
1195992122 X:110693162-110693184 TGGGGGCAGGGGGCGGGTGGAGG + Intronic
1197674437 X:129314277-129314299 TAGAACCAGGGCTTGGGTGGTGG - Intergenic
1198321380 X:135521489-135521511 TCGCGCCTGGGGTCGGGGAGAGG + Intronic
1200075616 X:153549188-153549210 GGGAGCCAGGTGTGGGGTGGTGG + Intronic