ID: 1172653562

View in Genome Browser
Species Human (GRCh38)
Location 20:36522807-36522829
Sequence ATTTCTAAGGGGGTTGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 5, 3: 45, 4: 374}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172653553_1172653562 9 Left 1172653553 20:36522775-36522797 CCCATCTTGTTTACTTTGTTTGC 0: 1
1: 0
2: 0
3: 20
4: 368
Right 1172653562 20:36522807-36522829 ATTTCTAAGGGGGTTGGGGATGG 0: 1
1: 0
2: 5
3: 45
4: 374
1172653546_1172653562 27 Left 1172653546 20:36522757-36522779 CCACCCGCCTCAGCCTCCCCCAT 0: 1
1: 24
2: 1039
3: 31054
4: 157602
Right 1172653562 20:36522807-36522829 ATTTCTAAGGGGGTTGGGGATGG 0: 1
1: 0
2: 5
3: 45
4: 374
1172653552_1172653562 10 Left 1172653552 20:36522774-36522796 CCCCATCTTGTTTACTTTGTTTG 0: 1
1: 1
2: 2
3: 42
4: 551
Right 1172653562 20:36522807-36522829 ATTTCTAAGGGGGTTGGGGATGG 0: 1
1: 0
2: 5
3: 45
4: 374
1172653547_1172653562 24 Left 1172653547 20:36522760-36522782 CCCGCCTCAGCCTCCCCCATCTT 0: 1
1: 2
2: 31
3: 390
4: 4566
Right 1172653562 20:36522807-36522829 ATTTCTAAGGGGGTTGGGGATGG 0: 1
1: 0
2: 5
3: 45
4: 374
1172653551_1172653562 11 Left 1172653551 20:36522773-36522795 CCCCCATCTTGTTTACTTTGTTT 0: 1
1: 0
2: 5
3: 45
4: 756
Right 1172653562 20:36522807-36522829 ATTTCTAAGGGGGTTGGGGATGG 0: 1
1: 0
2: 5
3: 45
4: 374
1172653554_1172653562 8 Left 1172653554 20:36522776-36522798 CCATCTTGTTTACTTTGTTTGCT 0: 1
1: 0
2: 1
3: 58
4: 825
Right 1172653562 20:36522807-36522829 ATTTCTAAGGGGGTTGGGGATGG 0: 1
1: 0
2: 5
3: 45
4: 374
1172653549_1172653562 20 Left 1172653549 20:36522764-36522786 CCTCAGCCTCCCCCATCTTGTTT 0: 1
1: 0
2: 0
3: 50
4: 560
Right 1172653562 20:36522807-36522829 ATTTCTAAGGGGGTTGGGGATGG 0: 1
1: 0
2: 5
3: 45
4: 374
1172653550_1172653562 14 Left 1172653550 20:36522770-36522792 CCTCCCCCATCTTGTTTACTTTG 0: 1
1: 0
2: 2
3: 27
4: 340
Right 1172653562 20:36522807-36522829 ATTTCTAAGGGGGTTGGGGATGG 0: 1
1: 0
2: 5
3: 45
4: 374
1172653548_1172653562 23 Left 1172653548 20:36522761-36522783 CCGCCTCAGCCTCCCCCATCTTG 0: 1
1: 0
2: 8
3: 126
4: 1209
Right 1172653562 20:36522807-36522829 ATTTCTAAGGGGGTTGGGGATGG 0: 1
1: 0
2: 5
3: 45
4: 374

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172653562 Original CRISPR ATTTCTAAGGGGGTTGGGGA TGG Intronic
902080706 1:13818732-13818754 ATTCCTCTGGGGTTTGGGGAGGG + Intronic
902687483 1:18088092-18088114 ATTTCCAAGTGGGCTGGGCATGG + Intergenic
903246049 1:22016330-22016352 TTTTTTGCGGGGGTTGGGGACGG + Intergenic
903370080 1:22829699-22829721 AGTGCTGTGGGGGTTGGGGATGG + Intronic
903481778 1:23658749-23658771 AATATTAAGGGGGTTGGGGCTGG - Intergenic
904502083 1:30919057-30919079 ATTTCTAAGGGGATTGTTGAGGG + Intergenic
905755465 1:40505621-40505643 ATGTGTGAAGGGGTTGGGGAGGG + Intergenic
906333793 1:44910607-44910629 ATTACTTGGGGGGGTGGGGAGGG - Intronic
906539403 1:46573530-46573552 TTTTTTAGGGGGGATGGGGAGGG + Intronic
906982598 1:50647906-50647928 ATTTCTAAGAGGGTTGGAGAAGG + Intronic
908328894 1:63051078-63051100 GTGTGTACGGGGGTTGGGGACGG + Intergenic
908912601 1:69089474-69089496 GTTTTTTAGGGGGATGGGGAAGG + Intergenic
909979673 1:82083670-82083692 ATTTTTTAAAGGGTTGGGGATGG - Intergenic
910742210 1:90532161-90532183 CTTTCTATGGGGATTGGGTAGGG + Intergenic
911568104 1:99488642-99488664 ATTTCTAAAGATGTCGGGGAAGG + Intergenic
912392997 1:109317727-109317749 ATTTTTGGCGGGGTTGGGGAGGG - Intronic
912583132 1:110737803-110737825 AATAGTGAGGGGGTTGGGGATGG + Intergenic
912595757 1:110874223-110874245 ATTTCCAAGAGGGGTGGGGACGG + Intronic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914419085 1:147512116-147512138 ATATGAAAGGGGGTTGGGGTGGG - Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914715360 1:150249942-150249964 ATTTCCAAGGGGCTGGGGGCAGG + Intergenic
915226690 1:154417009-154417031 ATAGCTAAGGGGGTCAGGGAGGG + Intronic
915638452 1:157202980-157203002 ATTTTTAAGGAGCTTGAGGAAGG + Intergenic
916240265 1:162632363-162632385 ATTAGGAAGGGGGTTGGGGAGGG - Intronic
916274671 1:162980827-162980849 TTTGCTAAGGGAGTTGGAGAAGG - Intergenic
916457772 1:164988574-164988596 ATTTCAAAGGAGGTCTGGGAAGG - Intergenic
916523634 1:165588950-165588972 ATTTTTTTGGGGGGTGGGGAGGG - Intergenic
917500523 1:175580921-175580943 AGTTGTCAGGGGGTGGGGGATGG + Intronic
917891591 1:179443565-179443587 ATTGCCCAGGGGGTTGGGGGAGG - Intronic
918386945 1:184018344-184018366 ATTTGAAATGGGGTTGGGGTGGG + Intronic
920264916 1:204714663-204714685 ATTGGGAAGGGAGTTGGGGAGGG + Intergenic
920365743 1:205447567-205447589 ATTTAAAAGGGGGCAGGGGAAGG + Intronic
920689517 1:208135151-208135173 ATTTCTTAGGGGGTGGTGGGGGG + Intronic
921575601 1:216831145-216831167 ATTTCAAAGGGGGGAGGGGAAGG + Intronic
921707944 1:218345672-218345694 ATTCCTGAGGGGGTTGCGCAGGG - Intergenic
922064046 1:222118763-222118785 ATTTATCAGGGGGTGGGGGGAGG - Intergenic
922504503 1:226118745-226118767 ATTTCTAAGGGAGGAGAGGAAGG + Intergenic
923479390 1:234368585-234368607 ATAGTTAAGGGGGTTGAGGAAGG + Intergenic
923566331 1:235079413-235079435 ATTTCTCAGGGTGTTGGGGTGGG - Intergenic
923615996 1:235537895-235537917 ATTTTTGAGGGGGAGGGGGAGGG + Intergenic
923739167 1:236640061-236640083 ATCTCCAAGGAGTTTGGGGAAGG + Intergenic
923972148 1:239216640-239216662 ATTTAGAGGGGAGTTGGGGAAGG + Intergenic
924816942 1:247451089-247451111 ATTTCTCAGGGTGTAGGTGAAGG + Exonic
1063134158 10:3201853-3201875 CTTTCTGAGGGGCTGGGGGAGGG + Intergenic
1064583935 10:16820682-16820704 ATTTTTTAGTGGGTTAGGGATGG - Intergenic
1065280878 10:24136326-24136348 ATTTCTAAAGAGGAAGGGGAGGG + Intronic
1065437568 10:25718207-25718229 ATTGCTGGGCGGGTTGGGGAGGG - Intergenic
1065841486 10:29704860-29704882 GATTTTCAGGGGGTTGGGGAAGG + Intronic
1068827002 10:61452083-61452105 ATTCCTCTGGGGGTTGGGGGAGG + Intronic
1069524658 10:69158582-69158604 ATTTCTTGGGGGGAGGGGGAAGG + Intronic
1069786912 10:70994383-70994405 ATTCCGCACGGGGTTGGGGAAGG - Intergenic
1069855550 10:71439066-71439088 ATTTCTAAGGGTGGCTGGGAGGG - Intronic
1071310233 10:84336441-84336463 TTATCTAAGGTGGTTAGGGAAGG + Intronic
1073025057 10:100481826-100481848 GTTTCTAATTGGGTTGGGGGTGG - Intronic
1073111563 10:101065965-101065987 ATTCCTATGGGAGCTGGGGAAGG - Intronic
1073617153 10:105007648-105007670 ATTTTTTGGGGGGTTGGGGGAGG - Intronic
1073766812 10:106691650-106691672 CTTTCTCAGGGAGTTGGGGGTGG - Intronic
1074256891 10:111811950-111811972 ATATCTAAGGAGGCTTGGGAGGG - Intergenic
1074579432 10:114704624-114704646 CATTCTAAGGGGGGTGGGGGTGG + Intergenic
1075277675 10:121109389-121109411 ATTCCCAAGGTGGGTGGGGAGGG - Intergenic
1075351490 10:121728843-121728865 ATTTCCAAGGTGGTTGTGGGGGG + Intergenic
1075706711 10:124506631-124506653 ATTTCTTAGGGAGGTGGGGAGGG + Intronic
1076649052 10:131974720-131974742 ATTTCTAACGAGGTTGAAGACGG + Intronic
1076733038 10:132447598-132447620 TTTCCTAACGGGGTGGGGGATGG + Intronic
1077342417 11:2032024-2032046 CTTTCTAAGGGGGCAGGAGAAGG - Intergenic
1077524876 11:3057917-3057939 AGCCCTAAGGGGGTTGGGGATGG - Intergenic
1077782190 11:5343135-5343157 ATATCTAAGAGGGTTGCAGATGG + Exonic
1077796517 11:5498211-5498233 ATAGCTAAGGGGTTTAGGGAAGG - Intronic
1077833448 11:5901156-5901178 ATATCTCAGGGGGTTGCAGATGG - Exonic
1077909253 11:6559578-6559600 ATTCCCATGGGGGTTGGGGCAGG + Intronic
1078819386 11:14862231-14862253 ATTTCTGATGGGGTTGGGGGTGG + Intronic
1079249438 11:18776369-18776391 CTTCCTAAGGGAGTTGGGGAGGG - Intronic
1079367138 11:19819349-19819371 ATTTCCTAGGTGGTGGGGGAAGG + Intronic
1080596769 11:33780082-33780104 ATTAGTAATGGGGTGGGGGAGGG - Intergenic
1081873950 11:46396373-46396395 ATTTCCAAGGAGGATGGGGGAGG - Intergenic
1082170722 11:49001818-49001840 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1082839468 11:57677233-57677255 ATTTCTAAAGCTGGTGGGGAGGG + Intronic
1083441482 11:62679300-62679322 ATTTCTAAGGAGGGTGAGGCAGG - Intergenic
1084940043 11:72607557-72607579 ACTTCTAGGAGGTTTGGGGAAGG + Intronic
1084969754 11:72764678-72764700 AATTCTAAGAGGCTTGGGGAGGG + Intronic
1085139165 11:74124547-74124569 ATGTCTCATGGGGTTGGGGTGGG + Intronic
1085225265 11:74914274-74914296 ATTTAAAAGGGGGATGGGCACGG - Intronic
1085251187 11:75144952-75144974 ATTTTAATGGTGGTTGGGGATGG - Intronic
1085843637 11:80041772-80041794 ATTTTTTTGGGGGTTGGGGGTGG - Intergenic
1086405213 11:86493644-86493666 AGTTCCAAGTGGGTAGGGGAAGG - Intronic
1086695083 11:89834542-89834564 ATTTTTAAGGGGATTGTGGAAGG + Intergenic
1086711067 11:90009942-90009964 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1087137412 11:94734849-94734871 ATTTCCTTGGGGGCTGGGGATGG + Intronic
1088182983 11:107133106-107133128 ATTTTTAAGGTGGGTGAGGAGGG + Intergenic
1089129634 11:116201614-116201636 TTTTCCAAGGAGGTTTGGGAAGG - Intergenic
1089267272 11:117273719-117273741 AGTTTTAAGGGGATTGTGGAAGG + Intronic
1089400667 11:118162576-118162598 AGTCCCCAGGGGGTTGGGGAAGG + Exonic
1089454508 11:118618204-118618226 AAGGCTATGGGGGTTGGGGAGGG - Intronic
1089668927 11:120039011-120039033 GTTTCTAAGGGTGGTGGGGGTGG - Intergenic
1089949978 11:122516498-122516520 ATTTAGAAGGAGGTTGGAGAAGG - Intergenic
1202825403 11_KI270721v1_random:87213-87235 CTTTCTAAGGGGGCAGGAGAAGG - Intergenic
1092073126 12:5649607-5649629 ATTTTTTTGGGGGGTGGGGATGG + Intronic
1092163695 12:6329815-6329837 CTTCTGAAGGGGGTTGGGGATGG + Exonic
1093961039 12:25272941-25272963 ATTTCTAAGGAGGCTGAGGCAGG - Intergenic
1094284164 12:28773710-28773732 ATTTCTGGGGGTGTTGGGGGGGG - Intergenic
1094648379 12:32350070-32350092 AGCTCTAAGGGAGTTGGGCAGGG + Intronic
1094678640 12:32647787-32647809 ATTTTTGAGGGGGATGGGGATGG - Intergenic
1096038450 12:48493183-48493205 ATTTCTAATGGGGCTGAGGATGG - Intronic
1096070829 12:48774656-48774678 ATTTCTGAGGCTGTTGGGGAGGG - Intronic
1096868906 12:54581088-54581110 ATTCATAAAGGTGTTGGGGAGGG + Intronic
1098553204 12:71787829-71787851 ATTTATGTGGGGGTGGGGGAAGG + Exonic
1099614380 12:84915877-84915899 ATTTCTCAGTGGGTAGAGGATGG + Intergenic
1099620379 12:84996201-84996223 ATTTTTAAGGGGATTGTGAAGGG - Intergenic
1099823316 12:87743133-87743155 TTTTTTTAGGGGGGTGGGGATGG - Intergenic
1100350678 12:93778918-93778940 ATTTCTAAAGGGGCTGGCAAAGG - Intronic
1100705265 12:97193967-97193989 ATTTTTAAGGGTTTTGGAGAGGG + Intergenic
1102481953 12:113229865-113229887 CCCTCTATGGGGGTTGGGGAGGG + Intronic
1102678936 12:114677074-114677096 CTTTGAAAGGGGGTGGGGGAGGG + Intronic
1103932569 12:124458351-124458373 CTTTCTCCGGGGGCTGGGGAGGG - Intronic
1104388702 12:128373705-128373727 ATTCCTTTGGGGGATGGGGAAGG + Intronic
1104867068 12:131962061-131962083 ATTTCTAAGGTGTTGGGGCAAGG + Intronic
1105427930 13:20311791-20311813 ATTTCTAAGGGAGGAGGGGGAGG - Intergenic
1106299671 13:28452192-28452214 AGTTCTGAGGGAGTTGGGGTGGG + Intronic
1106949687 13:34869682-34869704 ATTTCCCTGGGGGGTGGGGAGGG + Intergenic
1107892368 13:44925299-44925321 ATTTCTAAAGGACCTGGGGAAGG - Intergenic
1109653795 13:65364063-65364085 AAGTCTAAGTGGGTTGAGGAGGG - Intergenic
1109710848 13:66157526-66157548 GTTTCTAAGAGGGTTGGGAAAGG + Intergenic
1111216517 13:85149780-85149802 GTTTCTAGGGGGGCTGAGGAAGG - Intergenic
1111445141 13:88338016-88338038 ATTTCTAGGGGAAATGGGGAGGG - Intergenic
1112880772 13:104104066-104104088 TTTTTTGAGGGGGTGGGGGATGG + Intergenic
1113412404 13:110101783-110101805 ATTTCTTAGAGGGATGGCGATGG - Intergenic
1114940641 14:27606136-27606158 ATTTGTATGTTGGTTGGGGAAGG + Intergenic
1118482289 14:66179458-66179480 ATTGCTAATGAGGTTGGGCATGG + Intergenic
1119361643 14:74054954-74054976 AACTCTAAGGAGGCTGGGGACGG - Intronic
1119756537 14:77124008-77124030 ATATCCATGGGGGTGGGGGAAGG - Intronic
1120314648 14:82875782-82875804 ATTTCAAAGGATGTTGAGGATGG + Intergenic
1121896276 14:97650891-97650913 ATAGCTAAAGAGGTTGGGGAAGG + Intergenic
1123028478 14:105439608-105439630 CTTTCTAAGGGTGTTGAGGGAGG + Intronic
1124177524 15:27440142-27440164 ATTTTTGAGAGTGTTGGGGATGG - Intronic
1124483066 15:30093003-30093025 ATTTCTGTGGGGGTGGGGGTGGG + Intronic
1125576339 15:40758027-40758049 ATTTCTAAAAGGGCTGGGCATGG - Intergenic
1126772779 15:52074432-52074454 AGTGCTAAGGGAGTTGGTGATGG - Intergenic
1127507266 15:59609518-59609540 AACTCAAAGGGGGTGGGGGATGG - Intronic
1127696653 15:61455201-61455223 ATTTTTTGGGGGGTGGGGGAAGG + Intergenic
1128058532 15:64718595-64718617 AGTAATAAGGGGGTTGGGGGTGG + Intergenic
1128120232 15:65140648-65140670 ATTTTTAAGGGGGTTGTGGAGGG - Intergenic
1129779961 15:78264015-78264037 ATTTTTTAGGGGGTTGGAGTGGG - Intergenic
1130741586 15:86606285-86606307 GTTTCTAAGGAGATTGTGGAAGG - Intronic
1132643072 16:986795-986817 ATTTCTCTGGGGGTGGGGGTGGG + Exonic
1134164551 16:11919711-11919733 AATTACCAGGGGGTTGGGGAGGG - Intergenic
1134396389 16:13868249-13868271 GTTTCTCAGGGGTTTGAGGAAGG - Intergenic
1134610034 16:15600606-15600628 TTTTTTAAGGGGGGAGGGGATGG + Intronic
1134779615 16:16883942-16883964 TTTTCTTCGGGGGGTGGGGATGG - Intergenic
1135538568 16:23312852-23312874 CTTTCTGTGAGGGTTGGGGAGGG - Intronic
1136563575 16:31055986-31056008 GTTTCTAAGGGGACTGTGGAGGG + Intergenic
1138628953 16:58278343-58278365 ATTTTCAAAGAGGTTGGGGAGGG - Intronic
1142610374 17:1106452-1106474 ACTTCTAGTGGAGTTGGGGATGG - Intronic
1143875756 17:9989558-9989580 TTTTCTAATGGGATTGGGGGAGG + Intronic
1144008628 17:11124292-11124314 ACTTCAAAGTGGGATGGGGAAGG + Intergenic
1144084399 17:11795854-11795876 ATTTCAAATGTTGTTGGGGAAGG - Intronic
1145736004 17:27232116-27232138 ATTTCCAACGGAGTTTGGGATGG - Intergenic
1145782743 17:27574018-27574040 ATGTTTAATGGGGCTGGGGAGGG - Intronic
1148220774 17:45860261-45860283 GTCTCTAAGGGGATTGTGGAGGG + Intergenic
1148712236 17:49690279-49690301 ATTGCTAAGTGGGGTGGGGAGGG - Intergenic
1150559898 17:66285569-66285591 ATCTCTATGGGGGCTGGGCATGG + Intergenic
1150590395 17:66557221-66557243 TTTTTTAAGGGCCTTGGGGAAGG + Intronic
1150801672 17:68287999-68288021 TTTTTTTTGGGGGTTGGGGATGG + Intronic
1150985379 17:70190724-70190746 ATTTTTAAGGAACTTGGGGAAGG - Intergenic
1151155792 17:72122370-72122392 TTTTCAAAGGGGGTTGGGGTTGG + Intronic
1151194356 17:72421131-72421153 AATTCCACAGGGGTTGGGGAAGG - Intergenic
1151257950 17:72894069-72894091 ATTACAGAGGGGGTTGGGCATGG + Intronic
1152778876 17:82217783-82217805 ACTTCCTGGGGGGTTGGGGAGGG - Intergenic
1153750817 18:8228336-8228358 ATATCTAAGGGACTTAGGGAAGG + Intronic
1153913995 18:9729648-9729670 ATTTAGAGGGGGGTGGGGGAGGG - Intronic
1154371250 18:13765197-13765219 AAATCTAAGAGAGTTGGGGAGGG + Intergenic
1155217638 18:23657356-23657378 ATTTCTCAGGGAGTTGAGGGCGG - Intronic
1156588502 18:38459523-38459545 ATTCCAAACGGGGGTGGGGAGGG - Intergenic
1158426416 18:57344056-57344078 ATTTCTCAGGCAGATGGGGAAGG + Intergenic
1158948006 18:62464486-62464508 ATTTCCTAGTGGCTTGGGGAGGG - Intergenic
1159076636 18:63688320-63688342 AGTTCCCAGAGGGTTGGGGAGGG + Intronic
1159263885 18:66053687-66053709 ATTTTTAAGGGGTTGGTGGAAGG + Intergenic
1160791573 19:925955-925977 ATTTGTCTGGGGGTGGGGGAGGG + Intronic
1162747306 19:12806021-12806043 ATCTCCAACGGGGGTGGGGAAGG + Intronic
1162834662 19:13308370-13308392 ATTTGTACAGGGGGTGGGGATGG - Intronic
1163324049 19:16591978-16592000 AGGTCTAGGGGGGATGGGGATGG - Intronic
1164425771 19:28140234-28140256 GTTTCTCAGGGGGTAGGGAAAGG - Intergenic
1164743391 19:30593683-30593705 ATTTCCAAGGGGGTGGGTGAGGG - Intronic
1165306314 19:35005077-35005099 AGTTCTATGGGGGGCGGGGAAGG + Intronic
1165388687 19:35526474-35526496 CTTTGTAAGGGAGATGGGGAAGG + Intronic
1166017735 19:39995673-39995695 ATTTTTAAGGGATTTGGGGGGGG + Intronic
1166823123 19:45592608-45592630 ATTTCAATGGGGGCAGGGGAGGG + Exonic
1167198026 19:48044096-48044118 ATCTCTACCCGGGTTGGGGAGGG + Intergenic
1167467683 19:49658685-49658707 ATTTGCCAGAGGGTTGGGGAGGG + Intergenic
1167636491 19:50658926-50658948 ACCTGTAAGGGGGGTGGGGACGG - Exonic
925177638 2:1796627-1796649 ATTTGTCAGGGAGGTGGGGATGG - Intronic
926429844 2:12774568-12774590 ATTTCAAGGGGGGTTGGGGAGGG - Intergenic
928464998 2:31515202-31515224 ATCTCTAAGGGGGCTGGGCCTGG - Intergenic
928832514 2:35504739-35504761 ATTTCTAAAGGGTTGAGGGAAGG + Intergenic
929063145 2:37943908-37943930 TTTTCTTAGGTGGTGGGGGAGGG - Intronic
929848190 2:45555073-45555095 ATTTTTAAGGGGATCGTGGAGGG - Intronic
929912051 2:46098321-46098343 ATTTCTGTGTGGGTTGGGGGGGG - Intronic
930382721 2:50652146-50652168 ATTTCAAAAAGGGATGGGGATGG - Intronic
930632317 2:53767505-53767527 ATTTCTAACGGGGCCGAGGAAGG - Intronic
930822280 2:55658596-55658618 TTGGGTAAGGGGGTTGGGGAGGG - Intronic
932159528 2:69447595-69447617 ATTTCTGGGCAGGTTGGGGAGGG + Intergenic
932623897 2:73283774-73283796 GTTTCTGAGGGGCTGGGGGAGGG - Intronic
933056846 2:77681125-77681147 ATTTCAAAGGAGGTGGTGGAGGG - Intergenic
933247880 2:79995962-79995984 GTTTCCAAGAGGGTTGGGCATGG - Intronic
933791224 2:85885464-85885486 AGTTCTAAGGAGACTGGGGAAGG - Intronic
933926979 2:87102269-87102291 ATTTCAAAGGAGGTGGTGGAGGG - Intergenic
934520750 2:95018779-95018801 TTTTTTAAGGGGTTTGGGGAAGG + Intergenic
936561699 2:113544178-113544200 ACTTCTAAGAGGGGTGGGCATGG + Intergenic
937467251 2:122145185-122145207 ATTTCAAATGGGGTGGGGCAGGG + Intergenic
940460490 2:153958217-153958239 AACTCTCAGTGGGTTGGGGAGGG - Intronic
941614700 2:167706046-167706068 CTTTTTAAGGGGGTCGGGGGAGG + Intergenic
941648753 2:168070175-168070197 ATCTCTTTGGGGGTCGGGGAAGG - Intronic
942573454 2:177337444-177337466 ATTTTTTTGGGGGTTGGGGCGGG - Intronic
943798559 2:192029153-192029175 CTTTCTTAGGGGTTGGGGGAAGG + Intronic
944074307 2:195710817-195710839 ATTTTGAAGGGGCTTGTGGAAGG + Intronic
945081453 2:206090204-206090226 ATTATTAAGGTTGTTGGGGAAGG - Intergenic
945185345 2:207134248-207134270 TTTTTTATGGGGGTAGGGGAAGG - Intronic
946740295 2:222794565-222794587 ATTTGACAGGGGGTGGGGGAAGG + Intergenic
1169021043 20:2331079-2331101 ATTTCACAGGTTGTTGGGGAAGG + Intronic
1170819112 20:19740895-19740917 CATTCTAAGGGATTTGGGGAGGG - Intergenic
1172222747 20:33284938-33284960 AATACTAAGGGGGCTGGGGAGGG - Intronic
1172273215 20:33666274-33666296 AATTCTAAGTGGTTTGGGAAAGG + Intronic
1172371992 20:34400550-34400572 ATTGCTAAGGGAGATGGAGATGG + Intronic
1172653562 20:36522807-36522829 ATTTCTAAGGGGGTTGGGGATGG + Intronic
1173900698 20:46586623-46586645 ATTTTTTAGGGGGCTGGGAATGG - Intronic
1174792198 20:53489654-53489676 ATTTCTATGGTGGGTGGGGTGGG + Exonic
1177831818 21:26147854-26147876 TTTTTTGGGGGGGTTGGGGAGGG - Intronic
1178555855 21:33589145-33589167 AGTTCTCTGGGGGTTGAGGAAGG - Intronic
1180246068 21:46548135-46548157 ATTGCTCAGGGGGCTGGGAAGGG + Intronic
1180754670 22:18152700-18152722 AGGTCTAAGGAGGATGGGGAGGG - Intronic
1181566195 22:23739885-23739907 ATTTCTAAGTGGGCCGGGCATGG - Intergenic
1181903158 22:26171369-26171391 ATTCAAAAGGGGGTGGGGGAGGG - Intronic
1182030976 22:27159209-27159231 ATTTGCAAAGGGCTTGGGGAGGG + Intergenic
1182104993 22:27682797-27682819 ATTTCTAGGGGGCTTCTGGAGGG - Intergenic
1183039062 22:35162443-35162465 TTTTCAAAGGGGGTGGGAGAAGG + Intergenic
1183284090 22:36951858-36951880 ATCTGTGAGGGGGTTGGGGCAGG + Intergenic
1183374174 22:37453479-37453501 ATTCCTGAGGGGGTGGGGGATGG - Intergenic
1184589073 22:45468984-45469006 ATTGCGGGGGGGGTTGGGGAGGG + Intergenic
1185172277 22:49301102-49301124 ATGACTGAGGGGGCTGGGGAGGG + Intergenic
949704788 3:6803837-6803859 ACTTGGAAGGGGGTTGGGGAGGG - Intronic
950391603 3:12701156-12701178 GTTTCTAAGGGGTTTGGAGTGGG + Intergenic
950643901 3:14365880-14365902 ACTCCTAAGAGGTTTGGGGAAGG + Intergenic
951074300 3:18370401-18370423 ATTTGTTGGGGAGTTGGGGATGG - Intronic
952467262 3:33602649-33602671 GTTTCTAAGGGGGTTTGGGAAGG - Intronic
952572952 3:34739610-34739632 ATTTCAAAGGGAGCTGGGCATGG + Intergenic
952594934 3:35005789-35005811 ACTTTTAAGGGGATTGTGGAGGG + Intergenic
952960015 3:38583241-38583263 ATTCCTTAGGCGGCTGGGGAGGG + Intronic
953669369 3:44949758-44949780 ATTTCCAAGGGGGCCTGGGAAGG + Intronic
954072116 3:48150662-48150684 CTTTTTAGGAGGGTTGGGGATGG - Intergenic
955210512 3:56936110-56936132 TTTTCTTAGGGATTTGGGGATGG + Intronic
955751228 3:62186877-62186899 ATCTTTAAGGGGGCTGGGGTGGG + Intronic
956726640 3:72162048-72162070 TTTTCTCTGGGCGTTGGGGAGGG - Intergenic
957878949 3:86185138-86185160 ATTTCTATGTGTCTTGGGGATGG - Intergenic
958667471 3:97159596-97159618 ATATCTTACAGGGTTGGGGAAGG - Intronic
959255348 3:104004212-104004234 ATTGTTGAGGGAGTTGGGGACGG - Intergenic
959878893 3:111419737-111419759 ATTTGTAAGTGTTTTGGGGAAGG + Intronic
961220561 3:125195870-125195892 TTTGCTAAGGAGGTTGGGAAGGG - Intronic
962126610 3:132625993-132626015 ATATGTAAGGGAGTTGGGGCAGG - Intronic
962881989 3:139586974-139586996 ATTTGTATTGGGGTTTGGGAGGG + Intronic
963855796 3:150251875-150251897 CTTTCAAATGGGGTTGGGGGTGG + Intergenic
963893878 3:150664966-150664988 ATTTCTAAGTGGGGAGAGGAAGG + Intronic
964020348 3:152002818-152002840 ATTTTTCAGGGGGTTGAGGGAGG - Intergenic
964860540 3:161196585-161196607 TTTTCTAAGGAGGGTGTGGAGGG + Intronic
965510597 3:169564859-169564881 ATTTCTCCTGGGATTGGGGAAGG - Intronic
965754923 3:172015945-172015967 TTTTGAAAGGGGGTTGTGGATGG + Intergenic
969144621 4:5111606-5111628 ACTTCAAAAGGGGTTGGGAAGGG + Intronic
969874717 4:10127553-10127575 GTTTCTCAGGGGGTTGTGGCAGG + Intergenic
970000094 4:11356274-11356296 ATTTCAATATGGGTTGGGGAGGG + Intergenic
970010393 4:11452389-11452411 ATTTTTTGGGGGGTGGGGGATGG - Intergenic
971419696 4:26464287-26464309 TTTTCTATGGGGGTGGGGGGTGG - Intergenic
972109187 4:35534028-35534050 ATTTTTTGGGGGGTGGGGGAAGG - Intergenic
973112660 4:46414482-46414504 GTTTCTAAGGGTGTTGGAGTGGG + Intronic
973619843 4:52715278-52715300 ATTGCTAAGGGGGTAAGGAAAGG + Intergenic
974317696 4:60303838-60303860 ATTTTTAAGTAGGTTGGAGAAGG + Intergenic
974734555 4:65912681-65912703 ATTTCTAAGGACTTTGTGGAAGG - Intergenic
974920447 4:68232851-68232873 ATTTGTAAGGGGGAGGGGGGAGG - Intronic
975650916 4:76592056-76592078 ATTTTTTAGGGGGTGGTGGAAGG + Intronic
976380284 4:84391004-84391026 ATTCCTCAGGGGGTTAGGGAGGG + Intergenic
977190984 4:94000521-94000543 ATAGCTATGGTGGTTGGGGATGG + Intergenic
977355224 4:95937975-95937997 TTGTCTGAGGAGGTTGGGGAGGG + Intergenic
977360537 4:95998890-95998912 ATGTCTAGGGGGGAGGGGGAAGG + Intergenic
977551841 4:98450849-98450871 ATTGCTAATGGGGGTGGGGCAGG + Intergenic
978603284 4:110450689-110450711 TTTTCTTAGTGGGGTGGGGATGG + Intronic
978765716 4:112403041-112403063 CTTTTTTAGGGGGTGGGGGAGGG + Intronic
980530641 4:134047878-134047900 ATTTTAAAGGGAGTTGGAGAAGG + Intergenic
980713875 4:136607513-136607535 ATTTCTTAGGGGGGTGTGGGGGG - Intergenic
981178715 4:141714208-141714230 AGTTATAAGGGGGATGGGGCTGG - Intronic
981647069 4:147011446-147011468 ATTGCAAAGGAGGTTGGGGGTGG - Intergenic
982255933 4:153451819-153451841 ATTTCAAAGGAGGGTGGGGTAGG + Intergenic
982908638 4:161112008-161112030 ATTGCTAAGGGGTGTGGGGAGGG - Intergenic
983273236 4:165587889-165587911 ATTTCCAAGTGTGTTAGGGAGGG - Intergenic
983869061 4:172803444-172803466 TTTTCCATGGGGGCTGGGGAGGG - Intronic
983959071 4:173730539-173730561 TTTTTTAGGGGGGGTGGGGATGG - Intergenic
984008564 4:174343148-174343170 GTTGCCAAGGGGTTTGGGGAAGG - Intergenic
984537639 4:180996896-180996918 TTTTCTAAGGGGTTCAGGGAAGG + Intergenic
984833445 4:183997688-183997710 ATTGCTGATGGGATTGGGGATGG + Intronic
986051381 5:4093675-4093697 ATTTCTAAAGACGTTGAGGAAGG - Intergenic
986715591 5:10521499-10521521 ATTGCTCAGGTGGTTGGGGGCGG - Intronic
987046672 5:14115411-14115433 ATTTCTAAGGGTTTTGGAGTGGG + Intergenic
987257864 5:16175312-16175334 ATCTCTAAGATGGTTTGGGAAGG - Intronic
987340880 5:16937496-16937518 ATTCCTAAGACTGTTGGGGAAGG + Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
990105993 5:52262287-52262309 ATTGCTAAGGGGCTGGGGAAAGG + Intergenic
991302990 5:65147016-65147038 AGTTCTGCTGGGGTTGGGGAGGG - Intergenic
992676964 5:79114654-79114676 ATTTCAAATGGGATTGGGGGTGG - Intronic
993853091 5:93035566-93035588 ATTGCTGAGGGGACTGGGGAGGG + Intergenic
995835341 5:116395071-116395093 GTTTCTAAAGGGGTTGGGGTGGG - Intronic
996274806 5:121651863-121651885 ATTTCTAAAGGGGGTAGGGATGG + Intergenic
997275092 5:132579187-132579209 ATTTCTAACGGGATAGGTGAAGG + Intronic
998385523 5:141755013-141755035 ATTCCTGTGGGGGCTGGGGAAGG + Intergenic
998970092 5:147581568-147581590 ATCTCTCAGTGAGTTGGGGAAGG + Intergenic
1000196786 5:158967103-158967125 ACTTATAAGGGGGGTGGGGAAGG + Intronic
1000330893 5:160204491-160204513 TTTTTTAGGGGGGGTGGGGATGG + Intronic
1000742742 5:164990234-164990256 CTTTTTAAGGGGGATAGGGATGG - Intergenic
1001313314 5:170626392-170626414 CTTTCTAATGGGGGTGGGGAAGG + Intronic
1001799933 5:174534368-174534390 AGTGCTGAGGGGCTTGGGGAGGG - Intergenic
1004460381 6:15829681-15829703 ATGTTGAAGGGGGTTGAGGAAGG + Intergenic
1004526406 6:16412665-16412687 ATTTCTTAGGGTGTGGGTGAGGG - Intronic
1006811972 6:36825974-36825996 ATTTGTAAAGGAGTTGGGAAAGG - Intronic
1007637008 6:43305712-43305734 AGTCCCATGGGGGTTGGGGAAGG - Exonic
1008130804 6:47718829-47718851 ATTCCTAAGGGGGTATGGGTGGG + Intronic
1009343546 6:62587743-62587765 ATTTCTGAGCAGGTGGGGGAGGG - Intergenic
1010717722 6:79248835-79248857 ATATCTAAGGGGGTTAGGAATGG - Intergenic
1011870971 6:91892221-91892243 ATGTTTAAGGGGATTGTGGAGGG - Intergenic
1012642148 6:101632240-101632262 AGTTCTCATGGGGGTGGGGATGG - Intronic
1017727754 6:157287468-157287490 ATTTCAGCGGGGGTTGGGGTTGG - Intergenic
1018030868 6:159840495-159840517 ACTTCTAGGGGGGTCGGGGTGGG - Intergenic
1021933082 7:25601411-25601433 TTTTCTAAGGGAGATGGGCAAGG + Intergenic
1021941498 7:25683247-25683269 ATTCCTAAGGGGGCAGGGCAAGG + Intergenic
1022208914 7:28189306-28189328 TATTTTCAGGGGGTTGGGGATGG - Intergenic
1023098436 7:36687674-36687696 ATTTCTAAGGGGGCAAAGGAAGG + Intronic
1023485584 7:40682719-40682741 ATTTTTTTGGGGGGTGGGGAGGG - Intronic
1024532762 7:50407026-50407048 ATCTCTAAGGGGGATGTGGATGG - Intergenic
1025975174 7:66363943-66363965 GTAACTAAGGGGGTTGGGGGGGG + Intronic
1026196223 7:68175984-68176006 ATTTTTCAGGGGGTTCGGGGTGG - Intergenic
1026439970 7:70435663-70435685 TTTTGTATGGGGGTTGGGGGAGG + Intronic
1026474401 7:70722138-70722160 ATTTTAAAAGGGGTTGGGGCCGG - Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027194681 7:76021611-76021633 GTTTTTAAGGGGATTGGGGAGGG - Intronic
1029436140 7:100565074-100565096 ATTTCTATGGGCCTTGGGGATGG + Exonic
1029479166 7:100802523-100802545 ATTTCTAAGGAGAGTGGGGCTGG - Intergenic
1030703596 7:112668059-112668081 TTCTCTAAGGAAGTTGGGGAAGG + Intergenic
1030832514 7:114243097-114243119 ATTTCTTAGGGGATTGAGGTGGG + Intronic
1031635900 7:124100557-124100579 ATTTCTAAGGGGGTGGGAAGAGG - Intergenic
1031936510 7:127740670-127740692 ATTTCCAAGGGGGTGGGGGGTGG + Intronic
1032736425 7:134696501-134696523 TGTTCGAGGGGGGTTGGGGAGGG + Intergenic
1032984103 7:137317755-137317777 CTTTTTCAGGGGGTGGGGGAAGG + Intronic
1033441403 7:141382973-141382995 ATTTCCAAGGAGATTGGGGTGGG - Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1033981800 7:147174226-147174248 ATATGTAAGGGAGTTTGGGAGGG - Intronic
1034247210 7:149655994-149656016 ATTTTTTTGGGGGGTGGGGAGGG - Intergenic
1034653935 7:152713659-152713681 ATACCTAACAGGGTTGGGGAGGG + Intergenic
1036560262 8:9895802-9895824 ATTTTCAAGGGGCTGGGGGAAGG + Intergenic
1037513369 8:19605729-19605751 ATTTCTTTGGGGGTGGGGAAGGG - Intronic
1038367621 8:26952737-26952759 CTTTCTTAGGGAGATGGGGAGGG + Intergenic
1038714679 8:29981094-29981116 GATTCTGAGGGGGCTGGGGAAGG + Intergenic
1039288225 8:36065881-36065903 ATCTCTTGGGGGGTTGGGGCGGG - Intergenic
1040790963 8:51230087-51230109 ATTTCTAAGGGGGAGGGGTGTGG + Intergenic
1040974052 8:53170332-53170354 ATTTTTAAGGGGGTCATGGATGG - Intergenic
1042040965 8:64587873-64587895 ATATGTAGTGGGGTTGGGGATGG - Intronic
1043099350 8:76020864-76020886 ATTCCCAATGGGGTTGGGGTGGG - Intergenic
1043717961 8:83509054-83509076 ATTGCTGGGCGGGTTGGGGAGGG + Intergenic
1044628790 8:94259908-94259930 AATTCTAAATGGGTTGGGGAAGG - Intronic
1045147872 8:99367964-99367986 ATTTTTAAAGGGATTGGGGAAGG + Intronic
1045245621 8:100439460-100439482 ATTTCTAAGGGAGGTGAGGAGGG + Intergenic
1046266671 8:111839373-111839395 ATTCCTATGGGGTGTGGGGAGGG + Intergenic
1047296637 8:123576301-123576323 ATTTCCAAGGGCGGTGGGGAGGG + Intergenic
1048265933 8:132985938-132985960 ATTTTGCAGGGGGTTGTGGAGGG + Intronic
1048945489 8:139443310-139443332 GTTTCCAACGGGGTGGGGGAGGG - Intergenic
1049037182 8:140085921-140085943 ATTCCTAAGGGGGTGTGGGGTGG - Intronic
1049129726 8:140827536-140827558 TTTTTTTAGGGGGGTGGGGATGG + Intronic
1049890983 9:71140-71162 ACTTCTAAGAGGGGTGGGCATGG - Intergenic
1049912300 9:280961-280983 TTTTCAAAAGGGGTTGGGCACGG + Intronic
1050748044 9:8900611-8900633 ATATTTAAGTAGGTTGGGGATGG + Intronic
1050821229 9:9882718-9882740 GTGTATAGGGGGGTTGGGGAGGG - Intronic
1050943428 9:11488323-11488345 ATTTCTTGGATGGTTGGGGAAGG + Intergenic
1051140859 9:13977665-13977687 ATTTATAAGGTGGTTGGGGACGG + Intergenic
1051158539 9:14179319-14179341 CTTTAGAAGGGGGTTGGGGGTGG - Intronic
1052403192 9:28026470-28026492 ATTTCTAAGGCGTTCTGGGATGG + Intronic
1052732625 9:32307470-32307492 ATTTTTAAGGGGATTGTGGAGGG - Intergenic
1052806710 9:33019910-33019932 ACCTCTAAGGGGGTCGGGAAAGG + Intronic
1052931681 9:34060912-34060934 AATTCTAGGGGGGAAGGGGAAGG - Intergenic
1053732445 9:41072337-41072359 ACTTCTAAGAGGGGTGGGCATGG - Intergenic
1054696006 9:68359381-68359403 ACTTCTAAGAGGGGTGGGCATGG + Intronic
1054853721 9:69875217-69875239 TTTTTTAAGGGGGTGAGGGAAGG + Intronic
1056044804 9:82704621-82704643 ATTGCTGGGCGGGTTGGGGAGGG + Intergenic
1058101368 9:100920943-100920965 ATTTCAAAGGGAATTTGGGAGGG + Intergenic
1058664310 9:107296256-107296278 ATTTTTAAGGTGGTGGGGGAAGG - Intronic
1059178865 9:112193020-112193042 ATTGCTAGGGAGGCTGGGGAAGG - Intergenic
1060028061 9:120189912-120189934 ATTTGGAATGGGGTTGGGGTGGG - Intergenic
1060108581 9:120890653-120890675 ATTTCAAAGGGCATGGGGGAGGG + Intronic
1061141578 9:128770855-128770877 ATTTTTAAGGGGGAGGGGAATGG - Intronic
1061399697 9:130361688-130361710 ATTTATTATGGGGATGGGGAGGG - Intronic
1061643566 9:131980072-131980094 ATTTCTTGGGGGATGGGGGAAGG + Intronic
1187151287 X:16684152-16684174 TTTTCTAAGGTGTTTGGGGAAGG - Intronic
1187643184 X:21317340-21317362 AGTTCTAAGGTTGTTGGGGTGGG + Intergenic
1188392148 X:29633995-29634017 ATTTCTGTGGGGTTTGGGGAAGG - Intronic
1188404514 X:29791217-29791239 ACTTGTAATGGGGTTGGGGGAGG - Intronic
1188595850 X:31899237-31899259 ATTTCTAAATTGGTTGGAGAAGG + Intronic
1189317084 X:40064017-40064039 ATCACTAATGGGGTGGGGGAGGG + Intronic
1189320279 X:40083438-40083460 ATTAGTAAGGGGGAGGGGGAAGG + Intronic
1190229143 X:48568303-48568325 ATTTAAAAGGGGGCTGGGCATGG + Intergenic
1190624214 X:52320785-52320807 TTTTTTATGGGGGTGGGGGAGGG + Intergenic
1191716938 X:64200235-64200257 ATTTGAACGGGGGGTGGGGAAGG - Intronic
1191912130 X:66162598-66162620 ATTTCTAAGGGAGTTGAGGCTGG + Exonic
1192587389 X:72329744-72329766 ATTTTTAAGCGAATTGGGGAGGG - Exonic
1192632171 X:72785743-72785765 ATTGCTGAGGGGGCTGGTGACGG - Intronic
1192649538 X:72935058-72935080 ATTGCTGAGGGGGCTGGTGACGG + Intronic
1193336815 X:80299351-80299373 ATATTTAATGGGATTGGGGATGG - Intergenic
1193402372 X:81060643-81060665 ATCTCTAAGTTGGTTGGGCATGG + Intergenic
1194669148 X:96708534-96708556 ATGTCGCAGGGGGTGGGGGACGG - Intronic
1194763646 X:97824005-97824027 TTTTTTAAGGGGATGGGGGAGGG - Intergenic
1195004081 X:100669604-100669626 ATTCCTAAGGTGGTTTAGGATGG - Intronic
1196006506 X:110843056-110843078 TTACCTAAGGGAGTTGGGGAAGG + Intergenic
1197368303 X:125594572-125594594 ATTTCTAAGGAGGATGCTGAGGG - Intergenic
1197807327 X:130410383-130410405 ATTTTTTGGGGGGTGGGGGAGGG + Intronic
1197859182 X:130951013-130951035 CTTTTTGAGGGGGTGGGGGAAGG + Intergenic
1198162773 X:134024026-134024048 CGTTCTAAGCGGGGTGGGGATGG - Intergenic
1199080645 X:143572977-143572999 ATTTTGAAGGGGTTTTGGGATGG - Intergenic
1199590853 X:149467311-149467333 ATTTTTGATGGGGCTGGGGAGGG - Intergenic
1199719550 X:150532724-150532746 TTTTCCAAGGGGTTTGAGGATGG - Intergenic
1200714122 Y:6518222-6518244 ATTTTTTTGGGGGTTGGGGATGG - Intergenic
1201019703 Y:9642933-9642955 ATTTTTTTGGGGGGTGGGGATGG + Intergenic
1201513552 Y:14791814-14791836 ATTTGTAAGTGGGTAGGGTAAGG - Intronic