ID: 1172653994

View in Genome Browser
Species Human (GRCh38)
Location 20:36525824-36525846
Sequence GGGCCAGATGGGGATCAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 267}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172653994_1172654008 21 Left 1172653994 20:36525824-36525846 CCCCACTGATCCCCATCTGGCCC 0: 1
1: 0
2: 0
3: 22
4: 267
Right 1172654008 20:36525868-36525890 ACGCCCCACAGCCCAGGACCTGG 0: 1
1: 0
2: 3
3: 21
4: 257
1172653994_1172654005 15 Left 1172653994 20:36525824-36525846 CCCCACTGATCCCCATCTGGCCC 0: 1
1: 0
2: 0
3: 22
4: 267
Right 1172654005 20:36525862-36525884 CAACCCACGCCCCACAGCCCAGG 0: 1
1: 1
2: 1
3: 35
4: 373
1172653994_1172654011 25 Left 1172653994 20:36525824-36525846 CCCCACTGATCCCCATCTGGCCC 0: 1
1: 0
2: 0
3: 22
4: 267
Right 1172654011 20:36525872-36525894 CCCACAGCCCAGGACCTGGCAGG 0: 1
1: 1
2: 5
3: 45
4: 524
1172653994_1172654013 26 Left 1172653994 20:36525824-36525846 CCCCACTGATCCCCATCTGGCCC 0: 1
1: 0
2: 0
3: 22
4: 267
Right 1172654013 20:36525873-36525895 CCACAGCCCAGGACCTGGCAGGG 0: 1
1: 0
2: 5
3: 76
4: 575

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172653994 Original CRISPR GGGCCAGATGGGGATCAGTG GGG (reversed) Intronic
900796100 1:4709255-4709277 GGGCCTGATGGGGGCCGGTGGGG + Intronic
901061764 1:6475021-6475043 GGGCTTGATGGGGCTCAGGGTGG - Intronic
902035332 1:13453864-13453886 GGGCCACATGGGGCTCAGGATGG + Intergenic
902820207 1:18938870-18938892 GGGACAGATGGGACACAGTGTGG + Intronic
904044587 1:27602206-27602228 GGGCCAGATGTGGAGGGGTGGGG - Intronic
904486083 1:30825201-30825223 GAGCCAGATGAGGAACGGTGGGG + Intergenic
905017791 1:34789425-34789447 GGGACAGCAGGAGATCAGTGTGG - Intronic
905203039 1:36326655-36326677 GGGCAAGAAGGGGAGCAGGGAGG + Intronic
905214998 1:36400716-36400738 GTGCCAGGTGTGGAGCAGTGAGG + Intergenic
906186179 1:43863833-43863855 GGTCCAGATTGGGATCTATGAGG - Intronic
906945631 1:50292011-50292033 GGGCCAGATGGGAGGCAGGGGGG + Intergenic
907183330 1:52589844-52589866 GTGCCTTTTGGGGATCAGTGAGG + Intergenic
907866959 1:58407753-58407775 GGACAAGATGGGGAGCAGGGAGG - Intronic
908246084 1:62228618-62228640 GGGCTGGATGGGGCTCAGAGGGG + Intergenic
908624569 1:66026370-66026392 GGGCCAGATGGGGATAATAGAGG - Intronic
911570032 1:99509742-99509764 GGGCCACAAGGTGCTCAGTGGGG - Intergenic
912058152 1:105631554-105631576 GGGCCAGCTGGGGTTCCGGGTGG - Intergenic
912544029 1:110438157-110438179 GGGCCATAAGGTGCTCAGTGGGG - Intergenic
912936504 1:114007800-114007822 AGGCCAGATGGGGCCCTGTGAGG - Intergenic
913540562 1:119816259-119816281 CAGCCAGATGGGCAGCAGTGTGG + Intergenic
915117207 1:153608526-153608548 GGGCCAGCTGTGGAGCAGGGTGG - Intronic
917071956 1:171161150-171161172 GGGCCAGGCGGGGATCTGTCAGG - Exonic
917083810 1:171285304-171285326 GAGCCAGATGTGGATCCGTTAGG - Exonic
917230212 1:172828394-172828416 GAAACAGATGGGAATCAGTGAGG + Intergenic
917930422 1:179818873-179818895 GGGCCAGCTGGGGAGGAGGGTGG - Intergenic
919814684 1:201429955-201429977 GGAGCAGATGGGGTTCAGGGTGG - Intergenic
920416833 1:205804539-205804561 AGGGCAGATGGGGCTCACTGGGG - Intronic
920587410 1:207180281-207180303 GTGCTAGATGGGGCCCAGTGCGG + Intergenic
920710826 1:208293425-208293447 AGGTCAGATGGGGACCAGAGAGG + Intergenic
920829782 1:209453781-209453803 GGGCCACAAGGTGCTCAGTGGGG - Intergenic
920924924 1:210331808-210331830 GGGACAGATGGAGTTCATTGAGG + Intronic
922477554 1:225916925-225916947 GGGCCAGATGGGAATGAGGGTGG - Intronic
922562716 1:226580681-226580703 GGGCAGCATGGGGAGCAGTGGGG - Intronic
923104289 1:230842795-230842817 GGGCCAGAGGAGGATGGGTGAGG + Intronic
923355320 1:233149441-233149463 GGGCCAGATGCATTTCAGTGGGG + Intronic
1062996379 10:1870625-1870647 GGGCCATGGGGGGATCACTGAGG + Intergenic
1063667659 10:8073893-8073915 GGGCGAGATGTGGCTCAGGGAGG - Exonic
1068291055 10:55001667-55001689 GAGCCAGGCAGGGATCAGTGAGG - Intronic
1071053049 10:81474097-81474119 GAGCCAGATGCAGAGCAGTGAGG - Intergenic
1072161565 10:92771686-92771708 AGGCCACATGGGGGTCAATGAGG + Intergenic
1073335092 10:102701111-102701133 TTGCCAGGTGGGGGTCAGTGTGG + Intronic
1075311127 10:121414460-121414482 GGGCCACATGGCGAACACTGTGG + Intergenic
1075795900 10:125119154-125119176 GGGCCAGAAGGTGAGCAGAGGGG + Intronic
1076222946 10:128749355-128749377 CTTCCACATGGGGATCAGTGTGG - Intergenic
1076768273 10:132649526-132649548 AAGCCACATGGGGATCAGTGTGG + Intronic
1077186107 11:1236102-1236124 GGGCTGGATGGGGAGCAGGGTGG + Intronic
1077553947 11:3217204-3217226 AGGCCGGGTGGGGACCAGTGTGG + Intergenic
1078848127 11:15140157-15140179 GGCACACATGGGCATCAGTGAGG + Intronic
1080639113 11:34148546-34148568 GGGCCAGATGGTGAGGTGTGGGG - Intergenic
1081163808 11:39785009-39785031 GAGCCAGCTGGGGAGCGGTGAGG + Intergenic
1081629895 11:44681839-44681861 GGGCCAGCTGGGCAGCAATGTGG + Intergenic
1083460387 11:62807190-62807212 AGGCCAGCTGGGGGCCAGTGGGG - Exonic
1083798911 11:65035114-65035136 GGGCGGGGTGGGGATCAGAGGGG - Exonic
1085447526 11:76610666-76610688 GGGCATGATGTGGAGCAGTGTGG + Intergenic
1087667448 11:101067100-101067122 GGGCAAGATGGGCATCAATATGG - Intronic
1090062986 11:123479654-123479676 GGGCCAGATGGTGAGCATTGTGG + Intergenic
1091263711 11:134253904-134253926 GGGCCAGATGGGGACCCGGATGG - Intronic
1092137402 12:6159518-6159540 GGGCCAGCTGGAGTTCAGGGTGG + Intergenic
1092592201 12:9962636-9962658 GGGCCACAAGGTGCTCAGTGGGG + Intronic
1096257473 12:50072267-50072289 GGGCCAGAGGAGGAGCAGTGGGG - Intronic
1097446399 12:59678031-59678053 GAGCCAGGTGTGGAGCAGTGAGG + Intronic
1099262551 12:80400896-80400918 GGTCCAGATGGGGGTCAGGGCGG + Intergenic
1101740398 12:107495538-107495560 GGGCCAGAAGGGCATCAGAGAGG + Intronic
1102050211 12:109856543-109856565 GAGCCTGCTGGGGGTCAGTGAGG - Intronic
1102146132 12:110656333-110656355 AGGACAGGTGGGGAGCAGTGTGG + Intronic
1102484569 12:113247113-113247135 GGGCACGATGGGCTTCAGTGGGG + Intronic
1102774211 12:115504819-115504841 ACCCCAGATGGGGCTCAGTGTGG - Intergenic
1103727548 12:123005551-123005573 GTGCCCCATGGGGATCAGAGAGG + Intronic
1106346696 13:28886309-28886331 GGGCCAGCAGGGGAGCAGGGAGG + Intronic
1106552465 13:30784075-30784097 TGGGCACATGGGGATAAGTGAGG - Intergenic
1107872216 13:44757857-44757879 GGGGAAGATGGGGAACAGAGTGG - Intergenic
1108798740 13:54067078-54067100 GGGGCAGGTGGGGGTCAGGGTGG - Intergenic
1110751979 13:79125076-79125098 GGGCCAGATGAGGGCCAGTTGGG - Intergenic
1111748297 13:92296707-92296729 GGGCCAGCTGGAGTTCCGTGTGG + Intronic
1112644825 13:101318246-101318268 GAGCCAGGTGGGGAGCAGTGCGG + Intronic
1113087351 13:106581919-106581941 GGGGAAGCTGGGGAACAGTGTGG - Intergenic
1113722515 13:112570281-112570303 GAGACAGATGGTGATGAGTGGGG + Intronic
1114517450 14:23308973-23308995 GGGCCAGGTGGGGCTAGGTGTGG + Exonic
1116268519 14:42728450-42728472 GGGCCTGATGGAGATAAGTGGGG - Intergenic
1117540773 14:56744545-56744567 GGGCCAGATGTGGCCCAGAGAGG - Intergenic
1117966808 14:61214659-61214681 GGGTCAGATGGGGAAGGGTGAGG - Intronic
1118616678 14:67578874-67578896 GGGACAGTTTGGGAGCAGTGTGG - Intronic
1119856440 14:77904658-77904680 GGTCCAGATTGGCATCCGTGTGG + Intronic
1119861671 14:77940500-77940522 GGGACAGATGGTCAGCAGTGTGG + Intergenic
1120207169 14:81599382-81599404 TGGCCACATGGAGAACAGTGAGG + Intergenic
1121005648 14:90489158-90489180 GAACCAGGTGGGGCTCAGTGGGG + Intergenic
1122279134 14:100610821-100610843 GGGCCTGGTGGGGATGGGTGCGG + Intergenic
1122389782 14:101372480-101372502 GGGCCAGATGGTGAACATCGTGG - Intergenic
1122740471 14:103869019-103869041 GGGCAAGCTGGGGCTCAGGGCGG + Intergenic
1122954659 14:105065050-105065072 GGTCCAGATGGGGGTGAGTCAGG - Intronic
1122993719 14:105251228-105251250 GGGACAGATGGGCTTCACTGGGG - Intronic
1202918410 14_KI270723v1_random:6156-6178 GGGCCAGCTCGGGCTCAGGGAGG - Intergenic
1124479759 15:30068221-30068243 GGGCCTGATGGGAAGCAGGGTGG - Intergenic
1124490846 15:30154121-30154143 GGGACAGATGGGGATGAGAGGGG + Intergenic
1124681791 15:31738271-31738293 GGGCCAGATGAGGACCTCTGTGG + Intronic
1124752687 15:32384209-32384231 GGGACAGATGGGGATGAGAGGGG - Intergenic
1128238396 15:66082901-66082923 GGGCCAGATGGGGGTGTGTGTGG - Intronic
1128752604 15:70159848-70159870 GGAGCAGATGGGGATCAGGGAGG + Intergenic
1129663313 15:77565336-77565358 GGGCCAGATGCGACTCAGAGAGG + Intergenic
1129762789 15:78140697-78140719 GGGCCAGGTGGGAAGAAGTGGGG - Intronic
1130020460 15:80226449-80226471 GGGCCAGAGAGAGATCAGGGAGG - Intergenic
1131625793 15:94119333-94119355 GGGTCAGAAGGGGATGACTGGGG - Intergenic
1132693639 16:1192630-1192652 GGGCCAGCTGGGGTACAGGGAGG + Intronic
1133408700 16:5549875-5549897 GGCCCAGGTGTGGATGAGTGTGG + Intergenic
1133688878 16:8194060-8194082 GGACCTGATGGGGAGAAGTGAGG - Intergenic
1136008609 16:27347953-27347975 CGGGCAGATGGGGATCTCTGTGG - Intronic
1138620988 16:58211300-58211322 GGGCCAGAATTGGGTCAGTGGGG - Intergenic
1138645517 16:58421578-58421600 GGGCCAGAGGGAGAACTGTGGGG + Intergenic
1139517283 16:67459483-67459505 GTGCCAGCTGGGGCTCAGTGTGG - Intronic
1141635874 16:85313528-85313550 GGGCAGGAAGGGGATCAGGGGGG - Intergenic
1142052027 16:87965201-87965223 GGGCCTGATGGGGCTCATTCCGG - Intronic
1142306909 16:89290844-89290866 GGGACAGATGGGCATTACTGTGG + Intronic
1143544362 17:7587899-7587921 GGGCCAGAAGGGAAGCAGGGAGG - Exonic
1143568524 17:7740038-7740060 AGGACAGATCGGGATCAGGGCGG + Intronic
1144082956 17:11781280-11781302 GTGCCAGATGGGAATCTTTGTGG + Intronic
1144891259 17:18495699-18495721 GGCCCAGAGGGGGCTCTGTGTGG - Intergenic
1148029129 17:44608041-44608063 GGGGCAGGTGGGGATCCCTGAGG + Intergenic
1148886715 17:50778863-50778885 GGGCCAGAAGGGGTTCCTTGTGG - Intergenic
1149250648 17:54765101-54765123 GAGCCATGTGGGTATCAGTGGGG - Intergenic
1149281776 17:55112804-55112826 GGGCCAGATGAGGAGCAGTCAGG + Intronic
1149993401 17:61395162-61395184 AGTCAGGATGGGGATCAGTGGGG - Intergenic
1150161358 17:62900926-62900948 GGGCAAGAAGGGGATGAGGGAGG + Intergenic
1152565183 17:81097216-81097238 GGGGCAGGTGGGGTTTAGTGTGG + Intronic
1153828125 18:8896077-8896099 AGGCCAGCTGGGATTCAGTGTGG - Intergenic
1153911596 18:9709718-9709740 GGGGGAGGTGGGGATCTGTGCGG - Intronic
1154036470 18:10807124-10807146 CAGCCAGATGCGGATCAGAGTGG + Exonic
1155652860 18:28161651-28161673 GGGCGAGATGGGCATCTGTCAGG - Intronic
1156571130 18:38254491-38254513 GGGCAAGATGGGGTTCTGAGAGG + Intergenic
1157046581 18:44107470-44107492 AGGAGAGATGGTGATCAGTGAGG - Intergenic
1160191871 18:76721491-76721513 GGGCCACATGGGGCACAGTAGGG + Intergenic
1161361442 19:3852250-3852272 TGGCCAGATGGGGCTCAGCTGGG + Intronic
1161541129 19:4852085-4852107 GGGCCAGATGGTGTTGAGTGGGG - Exonic
1161681542 19:5682142-5682164 GGGCCTCATGGGGTGCAGTGAGG + Intronic
1163579422 19:18129378-18129400 CGGGCAGAGGGGGATCAGAGAGG + Intronic
1163675880 19:18655072-18655094 GGCCCAGGTGGGGATCAGGGAGG + Intronic
1164576254 19:29407096-29407118 GGGCCAGGGTGGGAGCAGTGTGG - Intergenic
1164715100 19:30385291-30385313 TGACCCGATGGGGGTCAGTGTGG + Intronic
1164748995 19:30637157-30637179 GGTCCAGATGTGGGTCAGTATGG - Intronic
1165112968 19:33512940-33512962 GGTCCTCAGGGGGATCAGTGAGG - Intronic
1166356372 19:42229887-42229909 GAGCCAACTGGGGATCAGAGAGG - Intergenic
1166415980 19:42595284-42595306 GAGCCAGATGGGGATGGGAGAGG - Intronic
1166432731 19:42740844-42740866 GAGCCAGATGGGGATGAAAGAGG - Intronic
1166435839 19:42766072-42766094 GAGCCAGATGGGGATGAAAGAGG - Intronic
1166445720 19:42856100-42856122 GAGCCAGATGGGGATGAAAGAGG - Intronic
1166453110 19:42918248-42918270 GAGCCAGATGGGGATGAAAGAGG - Intronic
1166455595 19:42937559-42937581 GAGCCAGATGGGGATGAAAGAGG - Intronic
1166471517 19:43083039-43083061 GAGCCAGATGGGGATGAAAGAGG - Intronic
1166482656 19:43186854-43186876 GAGCCAGATGGGGATGAAAGAGG - Intronic
1166492281 19:43269906-43269928 GAGCCAGATGGGGATGAAAGAGG - Intergenic
1167000883 19:46745558-46745580 GGTCCAGATGGGGAACCGGGAGG - Intronic
1167660024 19:50790867-50790889 GGGCCAGGTGGGGGTCACTATGG - Intronic
926016387 2:9455485-9455507 GGGACATAGGGAGATCAGTGGGG + Intronic
926675843 2:15619172-15619194 CTGCCAGAGGGGGAGCAGTGAGG - Intronic
927242472 2:20930937-20930959 GACACAGATGGGGAACAGTGTGG - Intergenic
927641774 2:24849981-24850003 GGGCCACAAGGAGAGCAGTGGGG - Intronic
927709091 2:25314168-25314190 GGGAGAGAAGAGGATCAGTGGGG + Intronic
928239646 2:29575437-29575459 GGGTCAGGTGGGGATGAGGGAGG - Intronic
928649289 2:33387907-33387929 GGACCAGATGGACATGAGTGGGG - Intronic
929532954 2:42763843-42763865 GGGCCTGGTGGGGAACAGTTTGG - Exonic
929688155 2:44052240-44052262 GGGCCACAGGGGGAACAGGGAGG + Intergenic
933608824 2:84412929-84412951 GGCCCAAATGGGAATGAGTGTGG - Intergenic
934753620 2:96810282-96810304 GGGCCAGATGGGAGGCAGGGTGG - Exonic
938671707 2:133592887-133592909 GGGCTAGATGGGGATTAATCTGG + Intergenic
939738811 2:145881227-145881249 GGGCCAGCTGGAGTTCAGGGTGG - Intergenic
942077249 2:172367219-172367241 GGGCCACAGAGTGATCAGTGAGG - Intergenic
942683700 2:178508759-178508781 GGGCCGGATGGGCATGAGAGAGG - Exonic
943727016 2:191262291-191262313 GGGCCAGCTGGGGAGGAGGGGGG - Intronic
944962415 2:204890153-204890175 GGGCCAGATGGATTGCAGTGTGG - Intronic
947932090 2:233972786-233972808 GGGCCAGATGGAGTTCCGGGTGG - Intronic
948151490 2:235748014-235748036 GGGCAAGATGGGAATGAATGAGG + Intronic
1168920753 20:1533679-1533701 GGGCCCTACGGGGATCAGGGAGG + Intergenic
1170478949 20:16745880-16745902 GGGCCACTGGGGGTTCAGTGAGG - Intergenic
1170500863 20:16974526-16974548 CAGCCAGTTGGGGAGCAGTGCGG + Intergenic
1172028288 20:31964500-31964522 GGGCCAGGGTGGGATCAGTTTGG - Intergenic
1172031982 20:31988754-31988776 GGGCTAGAGGGGCATCAGAGAGG + Intronic
1172653994 20:36525824-36525846 GGGCCAGATGGGGATCAGTGGGG - Intronic
1173852411 20:46227470-46227492 GGGCCAGAGGCGGAGCCGTGGGG - Intronic
1174448911 20:50608255-50608277 GGGACAGATGAGGACCCGTGAGG + Intronic
1174546876 20:51332283-51332305 GGGCCTGATGGGGGATAGTGGGG - Intergenic
1175879112 20:62246485-62246507 TGGCCAGCTGGGTGTCAGTGGGG + Intronic
1180057783 21:45367772-45367794 GGTCCAGAGGGGACTCAGTGAGG + Intergenic
1182123367 22:27800553-27800575 GGGGCAGAGGGGGATCAATAGGG + Exonic
950394811 3:12725991-12726013 GGGAAAGAAGGGGAGCAGTGGGG + Intergenic
951896955 3:27618620-27618642 AGGAAAGATGGGGATCAGGGTGG - Intergenic
952570356 3:34708675-34708697 GAGTCAAATGTGGATCAGTGGGG - Intergenic
954428049 3:50453974-50453996 GGGGGAGATGGGGCTCCGTGAGG - Intronic
956232947 3:67038061-67038083 GGGTCACAAGGTGATCAGTGGGG + Intergenic
956989859 3:74751079-74751101 GAGCCAGGTGTGGAGCAGTGAGG + Intergenic
957277438 3:78108432-78108454 GGGCCAGATGGAGTTCCGGGTGG + Intergenic
957617198 3:82545706-82545728 GGGGCTGATGTGAATCAGTGTGG - Intergenic
957674941 3:83354374-83354396 GGGTCACAAGGGGCTCAGTGAGG + Intergenic
958819158 3:98952660-98952682 TGGGCAGATGGGGAGCAGTGAGG - Intergenic
960149835 3:114238608-114238630 GGGCCAGTTGGAGTTCAGAGTGG - Intergenic
960725751 3:120668115-120668137 AGGCCAGCTGGGGACCAGGGAGG + Intronic
961817481 3:129558732-129558754 TGGCCAGCTGGGGTGCAGTGGGG + Intronic
962604597 3:137023212-137023234 GGGTTGGAAGGGGATCAGTGAGG - Intergenic
962743753 3:138382219-138382241 GGGCACCATGGAGATCAGTGAGG - Intronic
963908111 3:150790990-150791012 GAGCCAGATGTGCTTCAGTGAGG + Intergenic
964733826 3:159895578-159895600 GGGGCAGAGGGGGAGGAGTGTGG - Intronic
966982341 3:185149465-185149487 GGTCCATATGGGGTCCAGTGTGG + Intronic
968504970 4:967398-967420 GGGTCAGGCGGGGTTCAGTGGGG + Intronic
969362326 4:6672766-6672788 GGGCCAGCTGGAGTTCAGGGTGG + Intergenic
970204475 4:13642480-13642502 GGGCCAGATGGGGTCCAGAGAGG - Intergenic
970818802 4:20189600-20189622 AGGCCAGGTGGAGATCATTGAGG + Intergenic
974029300 4:56761916-56761938 CAGCCAGAAGGGGCTCAGTGAGG + Intergenic
977030575 4:91877202-91877224 GGGCCAGGTGTGGAACAATGTGG + Intergenic
977358850 4:95980097-95980119 TCACCAGATGGGGAGCAGTGGGG + Intergenic
978998075 4:115179734-115179756 GGGCCAGCTGGGGTTCCGGGTGG - Intergenic
981176614 4:141690176-141690198 GGGCCAGCTGGAGTTCCGTGTGG - Intronic
981797573 4:148614398-148614420 TGGCCAGTGGGGAATCAGTGAGG + Intergenic
987474809 5:18377921-18377943 GGGCCAAATGGCAAGCAGTGTGG + Intergenic
989350073 5:40476012-40476034 GGATCAGATGGTGTTCAGTGTGG - Intergenic
991958078 5:72015362-72015384 GGGCAAGCTGAGGATGAGTGTGG + Intergenic
991962117 5:72055484-72055506 GGTCCAGAGCGGGAGCAGTGGGG - Intergenic
992522850 5:77573947-77573969 GGGGCAGATGGGGAAAAGTGGGG - Intronic
993328607 5:86569841-86569863 GGGCCAGCTGGAGTTCAGGGTGG - Intergenic
994776388 5:104039949-104039971 GGGCCACAAGGTGCTCAGTGGGG + Intergenic
999243092 5:150138757-150138779 GGGGCAGATGGGCCTCTGTGGGG - Intronic
999309832 5:150544918-150544940 GGGCGAGCTGGGGCTCAGAGTGG - Intronic
1000338586 5:160260160-160260182 GGGCCAGATGGAGAGTAGGGAGG - Intronic
1002318979 5:178363993-178364015 GGGTCTGATGGGGAACAGTCAGG - Intronic
1002488057 5:179553154-179553176 GGGCAAGAGTGGGATCAGGGAGG - Intronic
1002878189 6:1229494-1229516 GGGCCAGATGGGCCTGTGTGTGG + Intergenic
1002936855 6:1681480-1681502 GGACAAGATGGAAATCAGTGTGG + Intronic
1003366180 6:5476930-5476952 GTGCCAGTTAGGCATCAGTGTGG + Intronic
1003409481 6:5850351-5850373 GTGGCAGAAGGGGATCAGAGAGG - Intergenic
1003578036 6:7315326-7315348 GGGCCAGGCGGGGGGCAGTGAGG + Intronic
1005967879 6:30740714-30740736 GGTCAACATGGGCATCAGTGTGG - Exonic
1006383393 6:33714539-33714561 GGGACAGATGTGGACCAGTCAGG - Intergenic
1006782135 6:36639235-36639257 AGGCCAGATGGGGAACACGGAGG + Intergenic
1006898460 6:37485057-37485079 GGGCCTGATGGGGAAGGGTGGGG + Intronic
1007775982 6:44224598-44224620 GGGCCAGCTGAGGTTCAGAGGGG - Intronic
1010035026 6:71315199-71315221 TGGCAAGCTGGGGTTCAGTGAGG + Intergenic
1012034033 6:94108757-94108779 GGGACAGATGGCAACCAGTGTGG + Intergenic
1012446235 6:99310004-99310026 GGGCCAGATGGGGTTCAGAAGGG - Intronic
1015617518 6:135092894-135092916 GAGTTAGAGGGGGATCAGTGGGG - Intronic
1016356808 6:143227387-143227409 GGGCCAAATGGGGATGAAGGAGG - Intronic
1018911537 6:168103186-168103208 GGGCCCCATGGAGATCAGAGTGG - Intergenic
1019504652 7:1384977-1384999 GGGGCAGAAGGTGGTCAGTGAGG - Intergenic
1020506288 7:8993004-8993026 GGGCCAGATAGTTCTCAGTGAGG + Intergenic
1020596434 7:10213088-10213110 AGGCCACATGTGGATAAGTGTGG - Intergenic
1023349674 7:39308294-39308316 GGCACGGATGGGGATCAATGTGG + Intronic
1023849016 7:44140184-44140206 GGTCCAGGTGGGGTTCAGTTAGG + Intronic
1025173984 7:56787592-56787614 GGGGCAGATGGGGAGCGGTCGGG - Intergenic
1025698116 7:63790363-63790385 GGGGCAGATGGGGAGCGGTCGGG + Intergenic
1026512313 7:71037638-71037660 GGGCCAGCTGGAGTTCAGGGTGG + Intergenic
1029978755 7:104858594-104858616 GGGGCTGTTGGGGTTCAGTGAGG - Intronic
1030322770 7:108186848-108186870 GTGCCACATGGAAATCAGTGGGG - Intronic
1031248767 7:119351470-119351492 GGGCCAGGTGTGGAGCAATGAGG - Intergenic
1031986834 7:128168814-128168836 GGGCCAGGTGGGGAGCTGTCCGG - Intergenic
1037838835 8:22230121-22230143 GGGACAGGTGTGGAGCAGTGGGG + Intronic
1039069145 8:33634150-33634172 GGGCCAGCTGGAGTTCCGTGTGG - Intergenic
1040319854 8:46287026-46287048 GGCCCACATGGGCAACAGTGGGG - Intergenic
1042675776 8:71320019-71320041 GGGATAGATGGGGATAAGGGAGG - Intronic
1046909612 8:119611472-119611494 GGGCCAGAAGGAGGTGAGTGAGG + Intronic
1049013114 8:139900903-139900925 AAGCCAGATGGGAATCTGTGAGG + Intronic
1051291949 9:15553516-15553538 GCGCCGGATGGGGACCAGAGGGG + Intronic
1051527678 9:18065184-18065206 GGGTAAGATGTGAATCAGTGTGG - Intergenic
1053055286 9:34990063-34990085 GGACCAGATTGGGTTCTGTGGGG + Intronic
1053613054 9:39734660-39734682 GGGTCTGATGGAGTTCAGTGTGG - Intergenic
1053871096 9:42492602-42492624 GGGTCTGATGGAGTTCAGTGTGG - Intergenic
1054240461 9:62607742-62607764 GGGTCTGATGGAGTTCAGTGTGG + Intergenic
1054554594 9:66642264-66642286 GGGTCTGATGGAGTTCAGTGTGG + Intergenic
1055432437 9:76257715-76257737 TGGCCAAAGGGTGATCAGTGAGG - Intronic
1056288317 9:85114083-85114105 GGGAAATATGGGGGTCAGTGGGG - Intergenic
1057101891 9:92369188-92369210 GGGCCACATGAGGAGCACTGGGG + Intronic
1059342002 9:113602544-113602566 GGGGCAGATGGTGCTCTGTGGGG + Intergenic
1059457762 9:114410579-114410601 GGTCGAGATGGGGATATGTGTGG - Intronic
1059705325 9:116817447-116817469 GGGACAAATGGGAGTCAGTGGGG + Intronic
1062153164 9:135031907-135031929 GGGCTAGATGGGGATTAGATGGG + Intergenic
1062285890 9:135772333-135772355 GGGCCAGGTGGGGAGCAGCTGGG - Intronic
1062479534 9:136744936-136744958 GGGCCATGTGGGGAGCTGTGTGG - Intronic
1062479546 9:136744975-136744997 GGGCCACATGGGGAGCTGTGTGG - Intronic
1062479557 9:136745013-136745035 GGGCCATGTGGGGAGCTGTGTGG - Intronic
1186256967 X:7732509-7732531 GGGCCAGATGATGCTCCGTGGGG + Intergenic
1187243993 X:17537898-17537920 TGAGCAGATGGGGATCAGAGGGG + Intronic
1188332475 X:28892317-28892339 GGGTCAGAAGGTGCTCAGTGGGG + Intronic
1188333333 X:28897911-28897933 GGGTCAGAAGGTGCTCAGTGGGG + Intronic
1191093142 X:56645766-56645788 GGTCCTGCTGGGGGTCAGTGGGG - Intergenic
1193482542 X:82044914-82044936 GGGCCAGATGTGGAATGGTGTGG + Intergenic
1193954675 X:87844843-87844865 TGGGCAGATGGGGAGAAGTGAGG - Intergenic
1195129481 X:101839404-101839426 GGGCCAGCCAGGGAGCAGTGAGG - Intronic
1195176757 X:102320425-102320447 GGGCCAGCCAGGGAGCAGTGAGG + Intronic
1195182107 X:102366668-102366690 GGGCCAGCCAGGGAGCAGTGAGG - Intronic
1196862610 X:120041967-120041989 GGGCCACAAGGTGCTCAGTGGGG - Intergenic
1196880492 X:120194377-120194399 GGGCCACAAGGTGCTCAGTGGGG + Intergenic
1200824330 Y:7622535-7622557 GGGCCAGCTGGGGTTCCGGGTGG - Intergenic
1201233509 Y:11888682-11888704 GGGTCAGAGGGTGATCAGAGGGG + Intergenic
1202235725 Y:22708552-22708574 GGGCCAGCTGGGGTTCCGGGTGG + Intergenic
1202563367 Y:26182970-26182992 GGGCCAGCTGGGGTTCCGGGTGG + Intergenic