ID: 1172661923

View in Genome Browser
Species Human (GRCh38)
Location 20:36574050-36574072
Sequence GACCTGAGTGAGCGCGCGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172661912_1172661923 4 Left 1172661912 20:36574023-36574045 CCCCAGGAGAGGGCCGATCCTGC No data
Right 1172661923 20:36574050-36574072 GACCTGAGTGAGCGCGCGGGGGG No data
1172661914_1172661923 2 Left 1172661914 20:36574025-36574047 CCAGGAGAGGGCCGATCCTGCAC No data
Right 1172661923 20:36574050-36574072 GACCTGAGTGAGCGCGCGGGGGG No data
1172661913_1172661923 3 Left 1172661913 20:36574024-36574046 CCCAGGAGAGGGCCGATCCTGCA No data
Right 1172661923 20:36574050-36574072 GACCTGAGTGAGCGCGCGGGGGG No data
1172661906_1172661923 23 Left 1172661906 20:36574004-36574026 CCAGCTTCATAGGATCCCACCCC No data
Right 1172661923 20:36574050-36574072 GACCTGAGTGAGCGCGCGGGGGG No data
1172661916_1172661923 -9 Left 1172661916 20:36574036-36574058 CCGATCCTGCACCGGACCTGAGT No data
Right 1172661923 20:36574050-36574072 GACCTGAGTGAGCGCGCGGGGGG No data
1172661910_1172661923 8 Left 1172661910 20:36574019-36574041 CCCACCCCAGGAGAGGGCCGATC No data
Right 1172661923 20:36574050-36574072 GACCTGAGTGAGCGCGCGGGGGG No data
1172661905_1172661923 24 Left 1172661905 20:36574003-36574025 CCCAGCTTCATAGGATCCCACCC No data
Right 1172661923 20:36574050-36574072 GACCTGAGTGAGCGCGCGGGGGG No data
1172661911_1172661923 7 Left 1172661911 20:36574020-36574042 CCACCCCAGGAGAGGGCCGATCC No data
Right 1172661923 20:36574050-36574072 GACCTGAGTGAGCGCGCGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172661923 Original CRISPR GACCTGAGTGAGCGCGCGGG GGG Intronic