ID: 1172661934

View in Genome Browser
Species Human (GRCh38)
Location 20:36574123-36574145
Sequence CCTGTCCGGCTCGGCGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172661934_1172661952 7 Left 1172661934 20:36574123-36574145 CCCCCGCCGCCGAGCCGGACAGG No data
Right 1172661952 20:36574153-36574175 CGAGAGTGACAGCTGGGGGTGGG No data
1172661934_1172661954 9 Left 1172661934 20:36574123-36574145 CCCCCGCCGCCGAGCCGGACAGG No data
Right 1172661954 20:36574155-36574177 AGAGTGACAGCTGGGGGTGGGGG No data
1172661934_1172661947 1 Left 1172661934 20:36574123-36574145 CCCCCGCCGCCGAGCCGGACAGG No data
Right 1172661947 20:36574147-36574169 GGCGGCCGAGAGTGACAGCTGGG No data
1172661934_1172661957 20 Left 1172661934 20:36574123-36574145 CCCCCGCCGCCGAGCCGGACAGG No data
Right 1172661957 20:36574166-36574188 TGGGGGTGGGGGCCGCGGGAAGG No data
1172661934_1172661953 8 Left 1172661934 20:36574123-36574145 CCCCCGCCGCCGAGCCGGACAGG No data
Right 1172661953 20:36574154-36574176 GAGAGTGACAGCTGGGGGTGGGG No data
1172661934_1172661946 0 Left 1172661934 20:36574123-36574145 CCCCCGCCGCCGAGCCGGACAGG No data
Right 1172661946 20:36574146-36574168 GGGCGGCCGAGAGTGACAGCTGG No data
1172661934_1172661948 2 Left 1172661934 20:36574123-36574145 CCCCCGCCGCCGAGCCGGACAGG No data
Right 1172661948 20:36574148-36574170 GCGGCCGAGAGTGACAGCTGGGG No data
1172661934_1172661956 16 Left 1172661934 20:36574123-36574145 CCCCCGCCGCCGAGCCGGACAGG No data
Right 1172661956 20:36574162-36574184 CAGCTGGGGGTGGGGGCCGCGGG No data
1172661934_1172661955 15 Left 1172661934 20:36574123-36574145 CCCCCGCCGCCGAGCCGGACAGG No data
Right 1172661955 20:36574161-36574183 ACAGCTGGGGGTGGGGGCCGCGG No data
1172661934_1172661958 21 Left 1172661934 20:36574123-36574145 CCCCCGCCGCCGAGCCGGACAGG No data
Right 1172661958 20:36574167-36574189 GGGGGTGGGGGCCGCGGGAAGGG No data
1172661934_1172661949 3 Left 1172661934 20:36574123-36574145 CCCCCGCCGCCGAGCCGGACAGG No data
Right 1172661949 20:36574149-36574171 CGGCCGAGAGTGACAGCTGGGGG No data
1172661934_1172661951 6 Left 1172661934 20:36574123-36574145 CCCCCGCCGCCGAGCCGGACAGG No data
Right 1172661951 20:36574152-36574174 CCGAGAGTGACAGCTGGGGGTGG No data
1172661934_1172661959 26 Left 1172661934 20:36574123-36574145 CCCCCGCCGCCGAGCCGGACAGG No data
Right 1172661959 20:36574172-36574194 TGGGGGCCGCGGGAAGGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172661934 Original CRISPR CCTGTCCGGCTCGGCGGCGG GGG (reversed) Intronic