ID: 1172662420

View in Genome Browser
Species Human (GRCh38)
Location 20:36576269-36576291
Sequence AGCAAGGCCCACCCTCCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 146}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172662420_1172662426 16 Left 1172662420 20:36576269-36576291 CCAAGTGGAGGGTGGGCCTTGCT 0: 1
1: 0
2: 3
3: 16
4: 146
Right 1172662426 20:36576308-36576330 GAGTGGTTGAGTCTAGGACCAGG 0: 1
1: 0
2: 0
3: 9
4: 191
1172662420_1172662429 25 Left 1172662420 20:36576269-36576291 CCAAGTGGAGGGTGGGCCTTGCT 0: 1
1: 0
2: 3
3: 16
4: 146
Right 1172662429 20:36576317-36576339 AGTCTAGGACCAGGCTAAAGGGG 0: 1
1: 0
2: 0
3: 13
4: 91
1172662420_1172662427 23 Left 1172662420 20:36576269-36576291 CCAAGTGGAGGGTGGGCCTTGCT 0: 1
1: 0
2: 3
3: 16
4: 146
Right 1172662427 20:36576315-36576337 TGAGTCTAGGACCAGGCTAAAGG 0: 1
1: 0
2: 1
3: 8
4: 113
1172662420_1172662423 -1 Left 1172662420 20:36576269-36576291 CCAAGTGGAGGGTGGGCCTTGCT 0: 1
1: 0
2: 3
3: 16
4: 146
Right 1172662423 20:36576291-36576313 TCATTCACCTGGATTTTGAGTGG 0: 1
1: 0
2: 3
3: 12
4: 187
1172662420_1172662425 10 Left 1172662420 20:36576269-36576291 CCAAGTGGAGGGTGGGCCTTGCT 0: 1
1: 0
2: 3
3: 16
4: 146
Right 1172662425 20:36576302-36576324 GATTTTGAGTGGTTGAGTCTAGG 0: 1
1: 0
2: 0
3: 15
4: 178
1172662420_1172662428 24 Left 1172662420 20:36576269-36576291 CCAAGTGGAGGGTGGGCCTTGCT 0: 1
1: 0
2: 3
3: 16
4: 146
Right 1172662428 20:36576316-36576338 GAGTCTAGGACCAGGCTAAAGGG 0: 1
1: 0
2: 0
3: 12
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172662420 Original CRISPR AGCAAGGCCCACCCTCCACT TGG (reversed) Intronic
900494967 1:2972146-2972168 AGCAAGGCCAAGCCACCACCTGG - Intergenic
902364043 1:15959214-15959236 GGCATGGCCCACCTTCCACTGGG - Intronic
902977848 1:20101799-20101821 GGCAAGGCACAGCCTCCACTGGG + Intergenic
904748285 1:32724863-32724885 AGGATGGCCCTCTCTCCACTGGG + Intergenic
907335596 1:53697452-53697474 CCCAAGTCCCACCCTCCTCTGGG + Intronic
907592132 1:55685447-55685469 AGAAAAGCCCAAGCTCCACTGGG - Intergenic
911449265 1:98044560-98044582 AGAAAGGCCCATCCTCCAGGGGG + Intergenic
911711873 1:101082926-101082948 TGCAAGGCCCATGCTCCAGTGGG - Intergenic
918820539 1:189249629-189249651 AGGAAGGCCCTCTCCCCACTAGG + Intergenic
920613784 1:207469158-207469180 TGCAAGGCCCACCTTCTAGTCGG + Exonic
920865057 1:209744879-209744901 CTCAAGGACCACCCTCCAGTGGG + Intergenic
922474589 1:225898524-225898546 AACAAGGTCCAGCCACCACTGGG + Intronic
1067079850 10:43206692-43206714 GGCAAGACCCACCATCCACGTGG - Intronic
1069744403 10:70706061-70706083 AGCAGGGCCCACCAGCCACTGGG - Intronic
1069920526 10:71812982-71813004 AGCTAGACCCACCCTCCACTGGG + Intronic
1070414362 10:76175801-76175823 AGGAAGGCCCAACCCCAACTGGG - Intronic
1071291001 10:84189028-84189050 GGCAAGGTCCAGCCACCACTGGG - Intergenic
1071596865 10:86934331-86934353 AGCAAGGCTCACCTGCTACTGGG + Intergenic
1074868031 10:117556128-117556150 AACATGGCCCACCCACCTCTTGG - Intergenic
1075615860 10:123890806-123890828 AGGATGGCACAGCCTCCACTGGG - Intronic
1076354282 10:129840772-129840794 AGCAATGCACACACTCGACTCGG + Intronic
1076563334 10:131381675-131381697 ATCAGGGCCCCCCCTCCACCTGG + Intergenic
1076788429 10:132763355-132763377 AGCAGGGCCCACGCTGGACTGGG + Intronic
1076940381 10:133602732-133602754 AGGAAGACCCACCCTCCATTTGG + Intergenic
1077295364 11:1823903-1823925 GGCTGGGCCCACCCTCCTCTGGG - Intergenic
1077466319 11:2735343-2735365 GCCATGGCCCACCCTCCACCGGG - Intronic
1083311279 11:61785036-61785058 AGCTAGGCCCACCCAGCACAGGG - Intronic
1088687686 11:112298525-112298547 AGGAAGACCCACCCTCAACGGGG - Intergenic
1089387355 11:118077142-118077164 ACCAAGGCCTGCCCTGCACTCGG + Exonic
1090352128 11:126114472-126114494 AGCCAGTCCCTCCCTACACTTGG - Intergenic
1091115634 11:133010145-133010167 AGTGAGCCCAACCCTCCACTTGG + Intronic
1094480178 12:30875233-30875255 AGTAAGGCCCAAACTCAACTTGG + Intergenic
1096457142 12:51796952-51796974 AGGAAGGCCCACCCTCAATGTGG - Intronic
1102234571 12:111286232-111286254 AGCAAGGCCCACCCTGTGCCTGG + Intronic
1102390580 12:112545757-112545779 TGCCAGGCCCACCCTGCCCTGGG - Intergenic
1102622178 12:114204821-114204843 ACCAATTCCCACCATCCACTGGG - Intergenic
1108334134 13:49421613-49421635 ACCAAGGCCTCCCCTCCACATGG + Intronic
1113413199 13:110108104-110108126 CCCAAGGCCCACTCTCCGCTAGG - Intergenic
1113942623 13:114026323-114026345 AACAGGGCCCACCCTCCCCCTGG + Intronic
1115264570 14:31487751-31487773 AGGAAGACCCCACCTCCACTTGG + Intronic
1116106863 14:40519696-40519718 AGGCAGACCCACCCTCCACATGG + Intergenic
1116808900 14:49520464-49520486 CCAAAGGCCAACCCTCCACTTGG - Intergenic
1118303317 14:64633891-64633913 AGCAGGTCCCACTCCCCACTTGG - Intergenic
1119199053 14:72739695-72739717 AGCAATGGCCACCCTGGACTTGG - Intronic
1119322948 14:73742336-73742358 ATCCAGGCCCACCCGCCACGTGG - Intronic
1119647131 14:76355995-76356017 AGCAAGTTCCAACCTCCACTTGG - Intronic
1120687421 14:87554363-87554385 AGGAAGACCCACCCTCAACGTGG + Intergenic
1121432989 14:93900468-93900490 ACCAAACCCCACCCTCCACATGG + Intergenic
1122114245 14:99520023-99520045 ACCACCTCCCACCCTCCACTGGG + Intronic
1122820706 14:104343394-104343416 AGCAAGACCAACCCTCCAGCTGG + Intergenic
1122871299 14:104640280-104640302 AGCGAGCCCCACCCTCGGCTTGG + Intergenic
1125745815 15:41996558-41996580 ACCAAGGCCCACACTCGCCTGGG - Intronic
1127145524 15:56019240-56019262 AGGAAGACCCACCCTCCATGTGG + Intergenic
1127723429 15:61724952-61724974 TGGAAGGCCTTCCCTCCACTTGG - Intergenic
1129293432 15:74585967-74585989 ACCAAGGGCCAGCCTGCACTGGG + Intronic
1129717547 15:77860861-77860883 TGCCTGGCCCACCCTCCTCTGGG - Intergenic
1131158908 15:90091709-90091731 AGCCAGGCCCGCCCTTCACCAGG + Intronic
1131190919 15:90315921-90315943 GGCAAGGACCACCCCACACTGGG - Intergenic
1132597542 16:760305-760327 TGCGAGGCCCACACTGCACTGGG + Intronic
1133997877 16:10761983-10762005 AGCCAGACCCACCCTCCAGCTGG + Intronic
1142765961 17:2064548-2064570 AGCAAAGCCCACTATTCACTGGG + Intronic
1143353469 17:6306968-6306990 AGGAAGGCCCACCCTCAATGTGG + Intergenic
1143633075 17:8149826-8149848 AGCAAGGCTCGCCCTCCTCCAGG + Exonic
1144646869 17:16981088-16981110 AGCCAGGCCCATTCTCCGCTCGG + Intergenic
1148370989 17:47099978-47100000 AGCCAGGCCCCCCGGCCACTCGG + Intergenic
1148454327 17:47802781-47802803 AGCAAGGCCCAACATCCCCAGGG + Intergenic
1150001898 17:61445653-61445675 AGCAAGACCCTATCTCCACTGGG - Intergenic
1154302700 18:13208242-13208264 AGCAAGGCCAACCCTCAATCAGG - Intergenic
1154359481 18:13647381-13647403 ACAGAGGCCCACCCTCCACATGG - Exonic
1155965606 18:32032700-32032722 ACCAAGCCCGGCCCTCCACTGGG - Intronic
1158489225 18:57894947-57894969 AGCAAGGCCCTGCATCCTCTGGG - Intergenic
1160319087 18:77873604-77873626 AGAAAGGCCCACCCTCGATGTGG + Intergenic
1160672866 19:374481-374503 AGCAAGACCCACGCTTCTCTGGG - Intronic
1161768264 19:6218379-6218401 GGCAAGGCCCACCCACCTGTGGG - Intronic
1162789495 19:13055588-13055610 AGCCAAGACCACCCTCCACTTGG + Intronic
1163520573 19:17789199-17789221 ACCAAGGTCCACCCTCCTCCTGG - Intergenic
1163714019 19:18863721-18863743 AGGAGAGCCCACCCTCCCCTAGG - Intronic
1164597565 19:29540171-29540193 AGGAATCCCCACCCCCCACTCGG - Intronic
1164793224 19:31005457-31005479 AGCAGGGCCCACACTCCACCAGG + Intergenic
1165013017 19:32862434-32862456 TGCAGGGCCCACCCTCCCGTGGG + Intronic
1166503223 19:43355887-43355909 AGCCAGGCCCACCCTCCTCTGGG - Intronic
1166507231 19:43378874-43378896 AGCCAGGCCCACCATCCTCTGGG + Intergenic
925932205 2:8717487-8717509 GGCAATGCCAGCCCTCCACTTGG + Intergenic
927332976 2:21887911-21887933 AAGATGGCACACCCTCCACTAGG + Intergenic
928865984 2:35918302-35918324 AGCAAGACCCACCCTCAATGTGG - Intergenic
933675108 2:85048574-85048596 AGCGAGGTGGACCCTCCACTTGG + Intronic
934619677 2:95796588-95796610 AGTAAGGCCCGCCCTCCATTGGG + Intergenic
934641211 2:96027969-96027991 AGTAAGGCCCGCCCTCCATTGGG - Exonic
935328571 2:101960108-101960130 AGAAAGGCCAAGCATCCACTGGG + Intergenic
935650270 2:105375994-105376016 AGCAAAGCCCACAATCCACATGG + Intronic
935758502 2:106297109-106297131 AGCAAGGACCACACTCTAGTAGG - Intergenic
936916012 2:117639718-117639740 AGCAAAGCACAGCCACCACTGGG + Intergenic
938378720 2:130824995-130825017 AGCATGGCCCACCCACCACAAGG - Intergenic
942546755 2:177073414-177073436 AGCTTGGCCCTCCCTTCACTTGG + Intergenic
943100185 2:183478596-183478618 AGCACAGTCCAGCCTCCACTCGG - Intergenic
947831067 2:233142189-233142211 AGCATGACCCACCCTCCACTGGG - Intronic
948606628 2:239139831-239139853 AGCACGGCCCTCCCTCCGCATGG - Intronic
949069987 2:242018623-242018645 AGCCAGAGCCACCCTCCCCTGGG - Intergenic
1170422267 20:16204733-16204755 AGCAAGGCCCACCTTAAGCTGGG - Intergenic
1170503859 20:17003724-17003746 AGCCAGGCCCACCCTCAATTTGG - Intergenic
1171011069 20:21509888-21509910 AGAAAGGCTCATCCTCCAGTTGG + Intergenic
1171363765 20:24609796-24609818 TGCAAGGCCCAACCTCCATCTGG + Intronic
1172010567 20:31843717-31843739 AGCAAAGCCCTCCCACCTCTGGG + Intergenic
1172662420 20:36576269-36576291 AGCAAGGCCCACCCTCCACTTGG - Intronic
1174959957 20:55144655-55144677 AGCAAGGCACCCCCTTCACAAGG - Intergenic
1178244483 21:30937544-30937566 TGCATGGGCCACCCCCCACTAGG - Intergenic
1178328020 21:31660698-31660720 AGCAATACTCACCCTGCACTAGG - Intronic
1178751891 21:35312815-35312837 AGTGAGGCCCTCCCTCCACATGG + Intronic
1180080962 21:45487349-45487371 AGCATGTCCCACCCTCCTCTCGG + Intronic
1180728941 22:17966794-17966816 AGCAAGGCTCAGGCTACACTGGG - Intronic
1182505566 22:30779855-30779877 AGCAAGGACCAGCCTTCACCGGG - Intronic
1183457328 22:37929968-37929990 AGCAGGCCCCATCCTCCTCTGGG + Intronic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
1185371303 22:50462158-50462180 ACCACGGCCCCGCCTCCACTGGG + Intronic
952412718 3:33064048-33064070 AGCCTGGCCCACACTCCCCTAGG + Intronic
953983610 3:47425568-47425590 AGCCAGGGCCAGCCCCCACTTGG + Exonic
954687003 3:52376552-52376574 AGCAAAGCCCAGCCTCCTCCTGG + Intronic
958994887 3:100893012-100893034 AGGCAGACCCACCCTCCATTTGG + Intronic
959762432 3:109982311-109982333 AGGAAGGCCCACCTTCCAGGTGG - Intergenic
964626420 3:158764271-158764293 ACCAAGGGCCTCTCTCCACTTGG - Intronic
966298744 3:178454944-178454966 AGCCAGGCCAGCACTCCACTGGG + Intronic
972738644 4:41869104-41869126 GGCAATGCCCACCATGCACTGGG + Intergenic
975033773 4:69656989-69657011 AGCAGGGCTCACCCTCCACCTGG + Intergenic
978968236 4:114769308-114769330 AGGAAGACCCACCCTCAACCTGG + Intergenic
979475391 4:121150886-121150908 AGCAGGGCACTCTCTCCACTCGG - Intronic
980611264 4:135167096-135167118 ACCAAGGGCCAAACTCCACTCGG - Intergenic
985653174 5:1116314-1116336 GGCCAGGCCCACCATCCACCAGG - Intergenic
987689091 5:21244145-21244167 ACCAGGCCCCACCCTCCACCAGG - Intergenic
997263242 5:132479514-132479536 ATCAAGGACCACTTTCCACTGGG - Intergenic
997353903 5:133249946-133249968 AGCAAGGCCCAGACTCCAATAGG - Intronic
997839068 5:137221901-137221923 AGCAGCGCCCACCCTCCACAGGG + Intronic
997880431 5:137584148-137584170 AGCAAGGCTCGCCCTCGGCTGGG + Intronic
998200267 5:140113486-140113508 AGACAGGCCCACCCGCCACCCGG - Intronic
998931900 5:147190569-147190591 AGCTGGGCCCTCCCTCCACATGG + Intergenic
1004624999 6:17366485-17366507 AACAACACCCACCCCCCACTCGG + Intergenic
1006392164 6:33764858-33764880 AGGAAGCCCCTCCCCCCACTGGG + Intergenic
1014706609 6:124755351-124755373 AGGAAGACCCACCCTCAACGTGG - Intronic
1015364267 6:132379458-132379480 AGCAAGGCACATTCTCCACGTGG + Intronic
1019048010 6:169162863-169162885 AGCCAGTCCCACCCACCACGTGG + Intergenic
1019660184 7:2219767-2219789 CGCAGGGCCCACCCTCCTCCTGG + Intronic
1022648000 7:32249389-32249411 AGTAAGGTCCAACCTTCACTTGG + Intronic
1027955746 7:84876914-84876936 AAAAAGGCACACACTCCACTTGG - Intergenic
1029953319 7:104610269-104610291 AGCAAGGCCAACCCTTCTTTAGG + Intronic
1030499853 7:110346302-110346324 AGCATGGTCAATCCTCCACTTGG - Intergenic
1031763316 7:125741880-125741902 AGCAAGGGAAAACCTCCACTGGG - Intergenic
1036295086 8:7528803-7528825 AGAAAGGCGCCCCCTGCACTGGG - Intergenic
1036327477 8:7792188-7792210 AGAAAGGCGCCCCCTGCACTGGG + Intergenic
1044027477 8:87191388-87191410 AGGAAGACCCACCCTCAATTTGG - Intronic
1048003036 8:130395235-130395257 AACAAGGCCCACCATGCACCAGG + Intronic
1049433568 8:142576170-142576192 AGCAAGGCCCACCCAGTCCTGGG - Intergenic
1055479604 9:76696712-76696734 CGCCACGCCCAGCCTCCACTAGG + Intronic
1055511171 9:76997013-76997035 AGCAAGGCCCATCACCAACTGGG - Intergenic
1056253303 9:84772716-84772738 AGCAGAGTCCACCCTCCAGTGGG + Intronic
1056571909 9:87824385-87824407 AGCCAGGCCCACCTTCTACATGG - Intergenic
1059312591 9:113398878-113398900 AGCAAAACCCACCCTGCATTTGG - Intronic
1060224306 9:121781984-121782006 AGCAAGGCCCAGCCTACTCCTGG - Intronic
1061467263 9:130791496-130791518 AGGAAGACCCACCCTCAACGTGG + Intronic
1062437282 9:136551892-136551914 AGGATGGCCCAGGCTCCACTTGG - Intergenic
1188647606 X:32590492-32590514 AGGAAGGCCCACCCTCAATGTGG + Intronic
1189160321 X:38803899-38803921 TGCCAGCCCCACCCTCCAGTCGG + Exonic
1192996474 X:76518081-76518103 AGGAAGGCCCACCCTCAATCTGG + Intergenic
1194161424 X:90457595-90457617 AGGAAGACCCACCCTCAATTTGG - Intergenic
1194666922 X:96685436-96685458 AGAAAGGCCCAGCCCCAACTTGG + Intronic
1199068713 X:143451272-143451294 AGGAAGACCCACCCTCGAATTGG + Intergenic
1200025327 X:153252909-153252931 AGCCACGCCCCCCCCCCACTGGG + Intergenic
1200080126 X:153572154-153572176 ACCAGCGCCCACCCTCTACTTGG + Intronic