ID: 1172662802

View in Genome Browser
Species Human (GRCh38)
Location 20:36578961-36578983
Sequence CTGCAAGTAAGGAGGGGATC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 199}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172662792_1172662802 28 Left 1172662792 20:36578910-36578932 CCCTCAGAGCAGGAGAAGCTGAG 0: 1
1: 0
2: 4
3: 34
4: 330
Right 1172662802 20:36578961-36578983 CTGCAAGTAAGGAGGGGATCTGG 0: 1
1: 0
2: 0
3: 12
4: 199
1172662795_1172662802 5 Left 1172662795 20:36578933-36578955 CCTTTCTGGACAGACCAACCTGT 0: 1
1: 1
2: 0
3: 5
4: 125
Right 1172662802 20:36578961-36578983 CTGCAAGTAAGGAGGGGATCTGG 0: 1
1: 0
2: 0
3: 12
4: 199
1172662791_1172662802 29 Left 1172662791 20:36578909-36578931 CCCCTCAGAGCAGGAGAAGCTGA 0: 1
1: 0
2: 3
3: 40
4: 309
Right 1172662802 20:36578961-36578983 CTGCAAGTAAGGAGGGGATCTGG 0: 1
1: 0
2: 0
3: 12
4: 199
1172662793_1172662802 27 Left 1172662793 20:36578911-36578933 CCTCAGAGCAGGAGAAGCTGAGC 0: 1
1: 0
2: 7
3: 50
4: 387
Right 1172662802 20:36578961-36578983 CTGCAAGTAAGGAGGGGATCTGG 0: 1
1: 0
2: 0
3: 12
4: 199
1172662796_1172662802 -9 Left 1172662796 20:36578947-36578969 CCAACCTGTCAGTGCTGCAAGTA 0: 1
1: 0
2: 0
3: 11
4: 98
Right 1172662802 20:36578961-36578983 CTGCAAGTAAGGAGGGGATCTGG 0: 1
1: 0
2: 0
3: 12
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172662802 Original CRISPR CTGCAAGTAAGGAGGGGATC TGG Exonic
901328103 1:8381275-8381297 CTGCAAGTGAACAGGGGATGTGG + Intronic
901758099 1:11453617-11453639 CTGCACACAAGGAGGGGAGCTGG + Intergenic
902601544 1:17543045-17543067 CTGCAAGGAAGGAGCTGAGCTGG - Intronic
902932531 1:19741619-19741641 GGGCAAGGAAGGAGGGGATGAGG - Intronic
903499966 1:23795326-23795348 CTGCAGGGAAGGAGGGTAACGGG - Exonic
904758002 1:32779817-32779839 CTACTAGTAAGGAGTGGAGCAGG - Intronic
906707809 1:47907537-47907559 CTGTAAATAGGGAGGGGAACTGG + Intronic
906708954 1:47915150-47915172 CTGCAAGGAATGAGGAGATTAGG + Intronic
908181086 1:61606674-61606696 ATGGAAGAAAGGAGGGGAACTGG + Intergenic
908860067 1:68474606-68474628 CTACAAGTAAAGAGGGGATGGGG - Exonic
909301007 1:74013360-74013382 GTGGAAGTAGGGAGAGGATCAGG - Intergenic
911386654 1:97183897-97183919 GTGCAAGGAGGGAGAGGATCAGG - Intronic
911450175 1:98052512-98052534 CTCCAAGTAAAGAGGGGATTTGG + Intergenic
913259789 1:116987766-116987788 CTGCAAGGAAGGGGAGGATGGGG + Exonic
914443926 1:147733355-147733377 ATGGGAGTAGGGAGGGGATCAGG + Intergenic
915934567 1:160083147-160083169 CTGCAAATGGGGAGGGGAACTGG - Intronic
916054168 1:161056407-161056429 CGGTAAGTGAGCAGGGGATCCGG + Exonic
917715057 1:177726584-177726606 GTGGAAGGAAGGAGAGGATCAGG + Intergenic
919587487 1:199456864-199456886 CTGGGAGTAAGGAGGAGAGCAGG + Intergenic
919721832 1:200845394-200845416 CAGCAAGTAAGGAGGACACCGGG + Intronic
921394227 1:214651317-214651339 ATGCAAGTCCGGAGGGGATTTGG + Intronic
921600575 1:217102273-217102295 CAGCAAGTAAGTGTGGGATCTGG + Intronic
1064292776 10:14050939-14050961 CTGAAACTGAGGAGGGGATGTGG + Intronic
1069047670 10:63760314-63760336 CTGATAGTATGCAGGGGATCTGG - Intergenic
1070330449 10:75412887-75412909 ATGCAAGGAAGGAGGGGAAAGGG - Intergenic
1072540620 10:96395528-96395550 CTGCAAGTAAGGAGTGAACTAGG - Intronic
1073414667 10:103370703-103370725 CTGGGAGAAAGGAGGGGCTCAGG - Intronic
1083708162 11:64530829-64530851 CTGAGAGCAAGGAGGGGCTCTGG - Intergenic
1083988554 11:66232785-66232807 CTGCCAGTAAGGAGGGGGTGGGG - Intronic
1084290399 11:68161873-68161895 CTGTAAGTTAGGAGCGGGTCTGG - Intronic
1084999787 11:73021568-73021590 CTAGAAGGAAGGAGAGGATCAGG + Intronic
1086060226 11:82692730-82692752 ATGCAAGAAATGAGGGCATCAGG + Intergenic
1087237036 11:95731558-95731580 ATGCAAGTAAGGTGGTGATTAGG - Intergenic
1087270680 11:96108467-96108489 CTACTAGTAAGTAGGGGAGCTGG - Intronic
1087416627 11:97864539-97864561 GTGGGAGTAAGGAGAGGATCAGG + Intergenic
1088692623 11:112340876-112340898 CTACATTCAAGGAGGGGATCTGG - Intergenic
1090007452 11:123015667-123015689 CTGCTAGTGAGTAGGGGAGCAGG - Intergenic
1091388364 12:109600-109622 ATGCAAGTGAGAAGGGGATGTGG - Intronic
1091584883 12:1810438-1810460 CTGCAGGGAAGGAGGGCATTTGG + Intronic
1092063540 12:5570567-5570589 CTGCAAGTGAGGACAGGATGAGG - Intronic
1093012457 12:14123292-14123314 CAGGAATTAAGGAGGGGATGGGG + Intergenic
1094499194 12:31007607-31007629 CTGGAAGCAAAGAGGGGATGAGG - Intergenic
1096324678 12:50648698-50648720 TTGCAAGTAAGGAGGGGGGGGGG - Intronic
1097062496 12:56296037-56296059 CTGCAAAGTAGGATGGGATCTGG - Intronic
1099201143 12:79678751-79678773 CTCCAAGTGAAGAGGGGAACAGG - Intronic
1101319175 12:103658143-103658165 CTGCAAGTAAAGTGGGGAAAGGG + Intronic
1105280720 13:18961089-18961111 GTGCCAGCAAGGAGGGGATCAGG - Intergenic
1108865419 13:54917536-54917558 CTGCAACTGAGGAGGGGAAGGGG + Intergenic
1110808769 13:79789464-79789486 CAGTAAGGAAGAAGGGGATCAGG - Intergenic
1113916544 13:113877377-113877399 CTGCAAGGAGGAAGGGGCTCAGG + Intergenic
1115127128 14:30009198-30009220 ATGCAAGTAGAGAGGGGATGGGG + Intronic
1116129080 14:40829893-40829915 GTGCAAGAAGGGAGAGGATCAGG + Intergenic
1119278954 14:73387226-73387248 CTACAATTCAAGAGGGGATCAGG - Intronic
1120858405 14:89232983-89233005 CTGAAAGGAAGGAGGGGAGGTGG - Intronic
1121445167 14:93974042-93974064 CTGCAGGTGAGGAGGGGCTATGG - Intronic
1121976274 14:98406843-98406865 CTGAAAGTAAGGATGTGCTCAGG + Intergenic
1122119977 14:99547359-99547381 GTGCAGGCAAGGAGGGGATAGGG + Intronic
1122463347 14:101914602-101914624 CTGCAAGGACGGGGGGCATCAGG - Intronic
1122533538 14:102445783-102445805 CTGAAAATAAGGAGGAGAACAGG - Intronic
1123771799 15:23536688-23536710 CTGCAAGGACTGAGGGGATTTGG - Intergenic
1123890346 15:24772376-24772398 ATTCAAGTAAGGAGGGGTTTAGG - Intergenic
1127554373 15:60073143-60073165 CAGGAAGTAAGCAGGGGGTCAGG - Intergenic
1127667723 15:61165358-61165380 CTGGAAATAAAGAGGGGAGCTGG - Intronic
1129039990 15:72677456-72677478 CTGCATGTAAATAGGGGGTCTGG + Intronic
1130136139 15:81183407-81183429 CTGCAGGAAGGTAGGGGATCTGG - Intronic
1136772042 16:32848581-32848603 CTGCAAGAAAAGATGGTATCTGG - Intergenic
1136898569 16:34012940-34012962 CTGCAAGAAAAGATGGTATCTGG + Intergenic
1137377333 16:47963779-47963801 CTGCAAGCAAGGGAGGGATGTGG + Intergenic
1203074463 16_KI270728v1_random:1110670-1110692 CTGCAAGAAAAGATGGTATCTGG - Intergenic
1145775311 17:27523916-27523938 CTGCAAGGAAGGATGGAAACGGG + Intronic
1146080692 17:29777854-29777876 CTGCAAGGCAGGATGGGATGTGG - Intronic
1146089211 17:29859428-29859450 GTGCAAAGAAGGAGGGGATCAGG - Intronic
1146624571 17:34425410-34425432 CTGCAAGTCAGGCTGGGGTCTGG - Intergenic
1146967009 17:37040555-37040577 CAGCAAGTAAGTAGTGGAACAGG + Intronic
1147367717 17:39970313-39970335 CTGCCAGTAAGCATGAGATCTGG + Intronic
1150532556 17:65999700-65999722 ATGGAAGGAAGGAGAGGATCGGG - Intronic
1152095968 17:78271779-78271801 CTGCAAATGAGGCGGGGGTCAGG + Intergenic
1153549179 18:6242734-6242756 GTGCAAGTGAGGTGGGGATGTGG - Intronic
1157305734 18:46516155-46516177 CAGCAAGTAAGTAGGGGAACTGG - Intronic
1159925010 18:74261494-74261516 CTGGAAACAAGGATGGGATCAGG + Intronic
1161068328 19:2248840-2248862 CAGCCAGCTAGGAGGGGATCTGG + Intergenic
1164515675 19:28933352-28933374 CAGCAAGTAAGGAGGACATCAGG - Intergenic
1164921967 19:32095054-32095076 TTGGAAGTAAGGAGGAGAGCTGG + Intergenic
1165854407 19:38870993-38871015 CTGGAAGTGAGGAGGGCATTCGG + Intronic
1165998852 19:39865424-39865446 CTGGAAGGAAGGAGGGGAAAAGG + Intronic
1166125912 19:40715234-40715256 CTGGAATTAAGGTGGGCATCGGG + Intronic
1166762806 19:45235343-45235365 CTGTGACTGAGGAGGGGATCTGG + Intronic
925684723 2:6459006-6459028 CTGCAATGACGGAGGGGATGTGG + Intergenic
926566887 2:14485744-14485766 GTGAAAGGAAGGAGAGGATCAGG + Intergenic
927311806 2:21639914-21639936 CTCCATGAAAGGAGGGGATATGG - Intergenic
932295417 2:70620349-70620371 CTGCAAATAGAGAGGGGCTCTGG - Intronic
932850734 2:75182295-75182317 CTGCAAGGAAGGCTGGGATGTGG + Intronic
933856356 2:86418237-86418259 CTGAAAGGAAGGAGGGGTTATGG + Intergenic
936496483 2:113026335-113026357 CAGCATGTAAGGTGGGGTTCAGG + Intronic
941182320 2:162274484-162274506 CTGCATCTAGGGAGGGGAGCTGG + Intronic
941403591 2:165061681-165061703 CTGCAAGCAATGGGGGGCTCTGG - Intergenic
942751013 2:179287346-179287368 GTGGGAGTAAGGAGAGGATCAGG + Intergenic
945431330 2:209769654-209769676 CTGGGAGTAGGGAGAGGATCAGG - Intergenic
948397960 2:237661465-237661487 CTGGAAGGAAGGAGGGAGTCTGG - Intronic
1172325081 20:34028351-34028373 CTACAAGGAAGAAGGGGAACAGG + Intronic
1172662802 20:36578961-36578983 CTGCAAGTAAGGAGGGGATCTGG + Exonic
1172883844 20:38218422-38218444 CTGCAAGGAAGTGGGGGAGCTGG - Intronic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1173179734 20:40796773-40796795 CTGTAGGAAAGAAGGGGATCTGG - Intergenic
1173526703 20:43738369-43738391 CTTCAAGTAAGGAAGTGATGTGG + Intergenic
1175504311 20:59470883-59470905 CTGCAGGTAAGGCCGGGGTCTGG + Intergenic
1180118782 21:45731267-45731289 CAGCAAGTAAGGAGGACACCAGG + Intronic
1181172937 22:21020355-21020377 GTGCATGTAAGGGAGGGATCAGG - Intronic
1181797463 22:25320428-25320450 CTGCAAGGAAGAAGGGGAGGAGG - Intergenic
1182150312 22:28022960-28022982 TGGCAATTAAGGAGGGGAACAGG - Intronic
1183108804 22:35633146-35633168 CTGCCAGGAAGAAGGGGATGGGG - Intronic
1184986940 22:48142195-48142217 CTGCAGGTCAGGAGGGGCTGGGG + Intergenic
949699237 3:6736922-6736944 CTTCAAGTAAGGAAGACATCTGG + Intergenic
949875780 3:8625203-8625225 GTGGAAGGAAGGAGGGGATGAGG + Intronic
950872854 3:16244356-16244378 CTGCCAGGAAGGAGAGGAACAGG + Intergenic
951602607 3:24393307-24393329 CTGCAAGGAGTGATGGGATCTGG - Intronic
952075804 3:29696186-29696208 CTGCTAGTAAGGGGCAGATCTGG - Intronic
952283741 3:31947944-31947966 CTGCCAGGAAGCAGGGGATTGGG + Intronic
953030049 3:39173724-39173746 GTGGAAGGAAGGAGGGAATCAGG - Intergenic
956725085 3:72150418-72150440 CTGGAACTATGGAGGGGAACTGG - Intergenic
961214273 3:125147563-125147585 CTGCGGATGAGGAGGGGATCCGG - Intronic
962263468 3:133929261-133929283 CTGCAGGCAAGGAGGAGATGGGG - Exonic
963628545 3:147704522-147704544 CTGGGAGGAAGGAGAGGATCAGG + Intergenic
964309171 3:155374107-155374129 CTTGTAGTCAGGAGGGGATCTGG - Intergenic
964492843 3:157255372-157255394 GTGGAAGGAAGGAGAGGATCAGG + Intergenic
969339341 4:6530466-6530488 CAGCAAGTAAGGAGGACACCAGG - Intronic
970292267 4:14586083-14586105 GTGGAAGGAAGGAGAGGATCAGG + Intergenic
970391628 4:15617818-15617840 GTGGGAGTAAGGAGAGGATCAGG + Intronic
974817690 4:67026532-67026554 CTGCAAGCAAGGAGGGGTAAAGG - Intergenic
975088426 4:70371543-70371565 CTGCAAGTAATGAGGTGAGGTGG - Intronic
975185995 4:71403539-71403561 TAGCCAGTAAGGAGAGGATCTGG + Intronic
975594323 4:76033493-76033515 CTCCAAGTAAGAAGGGGGTTTGG + Intronic
976259571 4:83133256-83133278 CTGAAAGAGAGGATGGGATCAGG + Intronic
977217943 4:94305235-94305257 CAGCTAGTAAGAAGGGAATCAGG + Intronic
977955595 4:103021909-103021931 CTTCAAGAATGGAGAGGATCTGG - Intronic
978588829 4:110302278-110302300 CTGGAGGCAAGGAGGGGATTGGG - Intergenic
979906009 4:126294562-126294584 CTGGGAGGAAGGAGAGGATCAGG - Intergenic
982405013 4:155009687-155009709 CTGCAAATGAGGTGGGTATCCGG - Intergenic
983042360 4:162944739-162944761 CTGAAAGTAATGAGGTCATCAGG - Intergenic
984478669 4:180270443-180270465 CAGGAATTAAGGAGGGGATGAGG + Intergenic
986709198 5:10475699-10475721 CTGCAACTAAGTATGGGATTTGG + Intergenic
987314661 5:16713197-16713219 CTGGGAGAAAAGAGGGGATCAGG - Intronic
987646975 5:20686014-20686036 GTGCAAGGAGGGAGAGGATCAGG + Intergenic
988515049 5:31897051-31897073 CTGGATGTAGGGTGGGGATCTGG + Intronic
989558852 5:42828207-42828229 GTGGAAGGAAGGAGAGGATCAGG - Intronic
990561557 5:56988515-56988537 CTGCAAGTCAGGGAGGTATCAGG - Intergenic
993639060 5:90380510-90380532 CTGAAATTGAGGAGGGGCTCAGG - Intergenic
997741119 5:136255831-136255853 CTGCTAGGAAGCAGGAGATCTGG + Intronic
998440110 5:142152548-142152570 CTGGGAGTAAGGAGAGGATTAGG + Exonic
1000840735 5:166214518-166214540 CAGCAAGTAAGTCGGGAATCTGG - Intergenic
1001150411 5:169222748-169222770 CTGCATGAAAGGACTGGATCTGG - Intronic
1001555055 5:172631499-172631521 CTGCAAGTAAGAAGGAGAGTTGG + Intergenic
1005713508 6:28524941-28524963 GTGGAAGGAGGGAGGGGATCAGG + Intronic
1006327398 6:33364928-33364950 CTGCAGGGAAGGAGGGTAACGGG + Intergenic
1007252867 6:40508252-40508274 CTGCAGGTAAGGGGCAGATCAGG + Intronic
1007695221 6:43727903-43727925 CTGAAAGTAAGGAAGGGGTCTGG + Intergenic
1011108449 6:83809691-83809713 CTGCAAGCAAGTAGTGGAGCTGG - Intergenic
1012183912 6:96189802-96189824 CTGCAAGTGAGATGGGGCTCCGG + Intronic
1012211457 6:96522698-96522720 CTGCAAGCAGGCAGGGGATGTGG - Intronic
1013672131 6:112416101-112416123 CTGCTAGTAAGTAGCAGATCTGG - Intergenic
1017676899 6:156823428-156823450 CAGCAAGGAAGTAGGGGCTCTGG - Intronic
1017768750 6:157628604-157628626 CTGGAAGTGAGGAGGGGAAAGGG - Intronic
1021668761 7:23014024-23014046 CTGCTAGGAAGAAGGGGAGCAGG - Exonic
1021827273 7:24567860-24567882 CTGCAAGAAAGAAGGGGATGGGG + Intergenic
1024009005 7:45252169-45252191 CTGCATGTGAGCAGGGGATGCGG - Intergenic
1024603967 7:51010177-51010199 CTGAAAGCAAGGAGAGCATCGGG - Intergenic
1025230819 7:57202334-57202356 ATCCAAGTCAGGAGGGGAACAGG + Intergenic
1025929137 7:65980914-65980936 ATCCAAGTCAGGAGGGGAACAGG + Intronic
1026276865 7:68887241-68887263 CTGCAAGTAAAGATGAGATTTGG - Intergenic
1029248134 7:99217441-99217463 CTGCCAGGAAGGAGGGGTTCAGG + Intergenic
1030757338 7:113303430-113303452 GTGAGAGTAAGGAGAGGATCAGG - Intergenic
1030791439 7:113733961-113733983 CTCCAAGGAAGGAGGGGGACTGG + Intergenic
1030818389 7:114065262-114065284 CTGCAAGTAACAGGGGGATGGGG - Intronic
1031954569 7:127929307-127929329 CTGCAAGCAAGAAGGTGATAAGG - Exonic
1031975662 7:128092049-128092071 CAGCCGCTAAGGAGGGGATCGGG + Exonic
1032650434 7:133872115-133872137 CTGGAGGAAAGGTGGGGATCAGG + Intronic
1033637068 7:143221895-143221917 ATGCAAATAATGAGAGGATCTGG - Intergenic
1033711991 7:143956840-143956862 CTGAGAGTAAGGAGGAGATGGGG + Intergenic
1033822317 7:145149174-145149196 ATGCAAGGAAGGATGGGATCTGG - Intergenic
1034891538 7:154843791-154843813 CTGTAAGTAAAGAAGGGGTCAGG - Intronic
1037246318 8:16839634-16839656 GTGGGAGGAAGGAGGGGATCAGG + Intergenic
1037669303 8:21000602-21000624 CTGAAAGTGAGGAGGGGTTTGGG + Intergenic
1039008377 8:33066334-33066356 CCGTAAGTAAGCAGGGGACCAGG - Intergenic
1040629950 8:49198835-49198857 CTGAACATAAGGAGGGGCTCCGG + Intergenic
1045718834 8:105081588-105081610 CTAGAAGGAAGGAGAGGATCAGG + Intronic
1045949683 8:107837837-107837859 CTGCCAGAAAGAAGGGGATGTGG - Intergenic
1046436331 8:114194157-114194179 CTGAAAGGAGGGAGAGGATCAGG + Intergenic
1047068216 8:121311330-121311352 CTGGGAGGAAGGAGAGGATCAGG - Intergenic
1047399442 8:124533534-124533556 CTGCAAAAAAGGAGGGGAGCTGG + Intronic
1048089673 8:131225444-131225466 CTGGGAGGAAGGAGAGGATCAGG + Intergenic
1048351355 8:133619205-133619227 GTGCAAGTCAGGAGGGGCTTGGG - Intergenic
1049550665 8:143257138-143257160 CTGGAAGTCAGGAGAGGAGCTGG + Intronic
1049741042 8:144241032-144241054 CTTCAAGTAAGGAGGTGGTGAGG + Exonic
1050245815 9:3688846-3688868 CTGCCAGTAGTGATGGGATCCGG + Intergenic
1050981917 9:12030054-12030076 CAGCAAGTAAGGAAAGAATCGGG - Intergenic
1051252566 9:15176484-15176506 CTGTCAGGAAGAAGGGGATCAGG + Intronic
1052180748 9:25524489-25524511 GTGGGAGTAAGGAGAGGATCAGG - Intergenic
1058006327 9:99919150-99919172 GGGCAAGTATAGAGGGGATCTGG + Intronic
1058937022 9:109779258-109779280 CTGGATGTAAGAAGTGGATCAGG - Intronic
1059820035 9:117962291-117962313 CAGTTAGTAATGAGGGGATCAGG + Intergenic
1060950603 9:127599753-127599775 GTGCAAGTAAGGAGGGCACTGGG - Intergenic
1061454279 9:130686016-130686038 CTGCAAGGCAGGAGGGAAGCTGG - Intergenic
1187940062 X:24372658-24372680 CTGGAAGTAAGAAGGGGAAGGGG + Intergenic
1189333281 X:40155624-40155646 CTGGAAGTAGGGAGGGGGTGTGG + Intronic
1190280487 X:48926051-48926073 CTGCAAGGAGGGAGAGGAACAGG + Intronic
1192420981 X:71030277-71030299 TTGCAAGTAAGGATGGGAAAAGG - Intergenic
1195615860 X:106911420-106911442 CTGGAAGTAAGGGGGAGAGCAGG - Intronic
1197418599 X:126207974-126207996 CTCCGAGGAGGGAGGGGATCAGG + Intergenic
1197603331 X:128556507-128556529 GTGGAAGGAAGGAGAGGATCAGG + Intergenic
1197764455 X:130050910-130050932 CTGCAGGGAAGGATGGGTTCAGG - Intronic
1198720366 X:139611798-139611820 GTGCAGGGAAGGAGGAGATCTGG + Intronic
1201618479 Y:15928277-15928299 CTGCAAGTCAGGATGAGATTTGG + Intergenic