ID: 1172664834

View in Genome Browser
Species Human (GRCh38)
Location 20:36591791-36591813
Sequence GAAACAGCACAGGGGCAGCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 1, 2: 3, 3: 27, 4: 296}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172664834_1172664839 -6 Left 1172664834 20:36591791-36591813 CCAAGCTGCCCCTGTGCTGTTTC 0: 1
1: 1
2: 3
3: 27
4: 296
Right 1172664839 20:36591808-36591830 TGTTTCTGTCAAGCCAGGTGTGG 0: 1
1: 0
2: 3
3: 19
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172664834 Original CRISPR GAAACAGCACAGGGGCAGCT TGG (reversed) Exonic
900111280 1:1006637-1006659 GAAACCCCACAGGGGCACCATGG - Intergenic
900131804 1:1090405-1090427 CACACAGCACTCGGGCAGCTGGG + Exonic
900558381 1:3291351-3291373 GAAGCAACACAGGGGCAGAAGGG - Intronic
900583286 1:3419820-3419842 GACACAGCCCTGGGGCAGCCGGG - Intronic
900616957 1:3569761-3569783 CAGGCAGCACAGGGGCAGTTGGG + Intronic
900648967 1:3721871-3721893 GATTCAGCAGAGGGGCTGCTTGG + Intronic
902517808 1:16999083-16999105 GAAACAGCTCAGATGCAGCCAGG + Intronic
902605642 1:17567774-17567796 TAGTCAGCACAGGGCCAGCTTGG - Intronic
903192830 1:21666446-21666468 GAGACAGCAAAGGAGCAGCCTGG + Intronic
903261733 1:22135274-22135296 GCAACAGCACAGGGCTGGCTAGG + Intronic
903890447 1:26566783-26566805 GAAACAACACAGAGGGAGCCTGG - Intronic
904120154 1:28192935-28192957 GAAGCAGCACTGAGACAGCTGGG + Intronic
904359913 1:29964457-29964479 GAAACTGCTTAGGGGCACCTGGG + Intergenic
906193562 1:43914703-43914725 GAGAAAGCACAGGGGCTGCTCGG - Intronic
907471150 1:54674264-54674286 AAACCAGCACAGGGCCAGATGGG + Intronic
909611948 1:77560522-77560544 GAGACAGCAGAGGGGCAGAAAGG + Intergenic
909917578 1:81338790-81338812 GAAACTGAACCCGGGCAGCTTGG + Intronic
911779098 1:101852915-101852937 GAAGCAGCACAGTGGCAGCTGGG - Intronic
913270912 1:117092698-117092720 AAAAAAGGACAGGAGCAGCTGGG - Intronic
915030124 1:152872008-152872030 GAACAAGCACAGGGCCATCTCGG - Intergenic
915535187 1:156531085-156531107 GAAACAGCAGCGGTGCAGGTGGG + Intronic
916059599 1:161089511-161089533 GAAGCAGCTCTGGGGGAGCTCGG - Exonic
916436218 1:164780273-164780295 GAAGCAGCACTGGAGCAGATGGG - Intronic
916573902 1:166050580-166050602 AAAAGAACACAGGGCCAGCTGGG + Intergenic
918093918 1:181318844-181318866 GAAAGAGCACAGAGGAAGCCAGG + Intergenic
920354406 1:205359952-205359974 AAAGCAGCCCAGAGGCAGCTGGG + Intergenic
923617628 1:235550964-235550986 GACACAGCACTGGGCCCGCTGGG - Exonic
924477446 1:244394600-244394622 GAAGCAGCACAGGGGCAGCTTGG + Intergenic
1062934302 10:1374709-1374731 GATACCGCACAGGGGAAGCCGGG - Intronic
1063396732 10:5694823-5694845 AAAACCACAAAGGGGCAGCTGGG - Intronic
1063484883 10:6410555-6410577 GGAAATGCACAGGGGCATCTGGG + Intergenic
1064639837 10:17404453-17404475 GAAAAAGAACTGGGGTAGCTTGG - Intronic
1065123408 10:22550105-22550127 GGACTAGCACAGGGGCAGCTTGG - Intronic
1066491499 10:35899248-35899270 GACACAGCCCAGGGGCAGCATGG + Intergenic
1066585751 10:36932887-36932909 GAGCTAGCACAGGGGCAGGTTGG + Intergenic
1066928546 10:41728151-41728173 GAATCAGCAAAGGGGCATATGGG + Intergenic
1067687149 10:48472647-48472669 GAAGCAGCACAGAGGCAGATGGG - Intronic
1067918178 10:50423168-50423190 GGAAAGCCACAGGGGCAGCTGGG + Intronic
1068558392 10:58483582-58483604 GAAATAGCTGAGTGGCAGCTTGG - Intergenic
1069957552 10:72061291-72061313 GGAACAGGACAGGTGCAGCCGGG - Exonic
1070081537 10:73193526-73193548 GAAACAGCAGAAGGGGATCTAGG - Exonic
1070227192 10:74521753-74521775 GAAATAGCAAAGCAGCAGCTTGG + Intronic
1070288649 10:75100728-75100750 GCAGCAGCACAGGAGCAGCCAGG - Intronic
1070844438 10:79510336-79510358 GAGGCAGCCCAGGGACAGCTAGG - Intergenic
1070929359 10:80249972-80249994 GAGGCAGCCCAGGGACAGCTAGG + Intergenic
1070940337 10:80339744-80339766 GAATCAGCTCAGGGTCAGTTAGG - Intronic
1072622644 10:97090209-97090231 GAAACAGAACAGGAGCAGGATGG + Intronic
1072746845 10:97946268-97946290 GGAACAGCAAAAGTGCAGCTAGG + Intronic
1073564294 10:104522020-104522042 GAAACAGAACAGAGCCAGCTAGG - Intergenic
1074996770 10:118763934-118763956 GTCACACCAGAGGGGCAGCTTGG - Intergenic
1076007040 10:126956126-126956148 GCAACTGCACAGTGGCAGCCTGG - Intronic
1077228383 11:1448147-1448169 GACACAGCACAGGGGCTGGCAGG - Intronic
1077236219 11:1483222-1483244 CCAGCAGCACAGGGGGAGCTGGG - Intronic
1078053944 11:7991864-7991886 AAAACTGCAGAGGGACAGCTTGG - Intronic
1078187742 11:9066562-9066584 GAAGCAGCACAGGGCCTGCTGGG + Intronic
1079193329 11:18301158-18301180 GAAAAAGAAAAGGGTCAGCTGGG + Intronic
1079441145 11:20516130-20516152 CACACAGCAGAAGGGCAGCTGGG + Intergenic
1083912205 11:65716820-65716842 GACAGGGCACAGGGACAGCTTGG - Intronic
1085760753 11:79239134-79239156 GAAACATCACAGGGCCCTCTAGG + Intronic
1085928781 11:81055725-81055747 GGAAAAGGACAGGGGCAGCGGGG - Intergenic
1086900393 11:92361087-92361109 GAAACAGCACTGTGGCAGACTGG + Intronic
1089997461 11:122922514-122922536 TAAACAGCAGAGGGGAGGCTGGG + Intronic
1090838700 11:130471967-130471989 GAGACAGCAAGTGGGCAGCTGGG + Intronic
1090920129 11:131199478-131199500 GAAACAGCTCACAGGCAGCAAGG + Intergenic
1090934324 11:131328470-131328492 GAAACAGGATAGAGGCAGGTGGG - Intergenic
1091407230 12:216686-216708 GAAACAGCCCAGTCTCAGCTAGG - Intergenic
1094829608 12:34294068-34294090 GATCCCACACAGGGGCAGCTGGG + Intergenic
1094834851 12:34317509-34317531 GACTCTGCACAGGGGCTGCTGGG + Intergenic
1094837024 12:34326852-34326874 GACACAGCGCAGGGGCTGCTGGG + Intergenic
1097131946 12:56817953-56817975 GAAAAGGCACAGGGAAAGCTAGG + Intergenic
1097280137 12:57840186-57840208 GAATCAGCGCATGGGCAGGTGGG - Intronic
1097791345 12:63818460-63818482 GTAACAGCACAGCCACAGCTGGG + Intergenic
1099500169 12:83404039-83404061 GAAACAACACTGGAACAGCTTGG - Intergenic
1100591161 12:96030767-96030789 GAAAGTACCCAGGGGCAGCTGGG - Intronic
1101174572 12:102136000-102136022 GAAACAGTACAGGGACATCAAGG - Intronic
1103842878 12:123879636-123879658 ACAACAGCACATAGGCAGCTTGG + Exonic
1103888060 12:124217501-124217523 GCTGCAGCACAGGGGCAGCCCGG + Intronic
1104489946 12:129184924-129184946 GACTCAGCTCTGGGGCAGCTGGG - Intronic
1104802719 12:131565668-131565690 GGAACAGCAAAGGGGCAGCCAGG + Intergenic
1104928739 12:132327440-132327462 GTAACACCACGAGGGCAGCTCGG - Intronic
1105511001 13:21051661-21051683 GAAAAAGCACAGGGCAGGCTGGG + Intronic
1109029840 13:57178046-57178068 GCAACATCACAGGGTCAGCAGGG - Intergenic
1112372406 13:98805218-98805240 GAAACAGCACAATGGGAGATTGG + Intronic
1113258151 13:108529899-108529921 GTTACAGCACAGGGGCAGAGTGG + Intergenic
1113858146 13:113460749-113460771 GAGACAACACGGGGGCTGCTGGG + Intronic
1118466036 14:66032179-66032201 GAAACAGCAAGGTGGCAGCGAGG - Intergenic
1119781463 14:77279010-77279032 GAAACTGGAGAGGAGCAGCTGGG + Intronic
1119859213 14:77924432-77924454 GAAAGAGAAGAGGGGCAGGTGGG - Intronic
1119878189 14:78078060-78078082 GAAACAGCCCTGGGGGAGGTGGG - Intergenic
1121161293 14:91743762-91743784 GCAACAACACAGGGCCATCTTGG + Intronic
1121776301 14:96593198-96593220 GAAAGAGCAGAGGGGCCGGTGGG + Intergenic
1121929570 14:97960218-97960240 GTTACAGCACAGGGGCAGCTTGG - Intronic
1122607934 14:102960236-102960258 TCAAAACCACAGGGGCAGCTGGG + Intronic
1122644977 14:103188152-103188174 GAAACAGTACTGGGGCAGAGGGG + Intergenic
1123082234 14:105700948-105700970 CAACCAGCCCAGGGTCAGCTAGG - Intergenic
1123790459 15:23714476-23714498 CAAACAGCAAAGCGGCAGCGAGG + Intergenic
1124693220 15:31843084-31843106 GACAGAGCACAAGGGCAGCCAGG - Intronic
1125983599 15:44027491-44027513 GATTCAGGTCAGGGGCAGCTTGG + Intronic
1128193823 15:65732100-65732122 GTTACAGCACAAGAGCAGCTGGG - Intronic
1128417211 15:67457874-67457896 GGAGAAGGACAGGGGCAGCTTGG - Intronic
1128911519 15:71519804-71519826 GAAACAGCAAAGGGGGAGAGTGG + Intronic
1129198917 15:73987018-73987040 AAAGCAGCACAGAGGCAGGTGGG + Intronic
1129453755 15:75665002-75665024 GAGGCAGCAGAAGGGCAGCTTGG - Intergenic
1129737362 15:77973806-77973828 GAGTCAGCACTGGGGCAGCCAGG + Intergenic
1129848710 15:78779819-78779841 GAGTCAGCACTGGGGCAGCCAGG - Intronic
1129889926 15:79065328-79065350 GGAAGAGCATGGGGGCAGCTTGG + Intronic
1130025845 15:80269754-80269776 GATACAGCAGAGGGAGAGCTGGG - Intergenic
1130253209 15:82314127-82314149 GAGTCAGCACTGGGGCAGCCAGG + Intergenic
1130856723 15:87845789-87845811 AAAACAGCACAGGGGCTTCCTGG + Intergenic
1131870369 15:96757458-96757480 GAAACAGCAGAAGGGGATCTAGG - Intergenic
1132463227 16:65868-65890 GAAACAGCAGTGAGGCGGCTCGG + Intronic
1132800190 16:1748217-1748239 GGGAGAGCACAGGGGCACCTGGG - Intronic
1134181372 16:12050550-12050572 GAATCAGTGCTGGGGCAGCTCGG + Intronic
1135774700 16:25246719-25246741 GAAACAAGACAGGGGCACCATGG + Exonic
1136160024 16:28413912-28413934 GGAACTGGACAGGGGCTGCTGGG + Intergenic
1136203064 16:28701380-28701402 GGAACTGGACAGGGGCTGCTGGG - Intronic
1136226768 16:28865144-28865166 AAAACATCACAGGGAGAGCTGGG - Intronic
1136504693 16:30695438-30695460 CACACAGCACAGGGCCAGATAGG + Intergenic
1137506484 16:49058190-49058212 GAAACGGCACAGGGCACGCTGGG + Intergenic
1139462589 16:67134360-67134382 GAAACAGCTCAGAGGCATCATGG - Exonic
1141900679 16:86988445-86988467 AAAATAGCACAGGGGCAACTCGG - Intergenic
1142746821 17:1963523-1963545 GACACAGCCCAGAGGCAGCAGGG - Intronic
1143537390 17:7549356-7549378 GAGACTGCAGAGGGGCCGCTGGG + Intronic
1143738719 17:8935535-8935557 GGAACAGCTCCGGGGAAGCTTGG - Intronic
1144640946 17:16936127-16936149 GACACAGCACAGAGGCTGCAGGG + Intronic
1144667603 17:17112524-17112546 TACAGAGGACAGGGGCAGCTGGG - Intronic
1144874138 17:18388391-18388413 GACACAGCACAGAGGCAGCAGGG - Intronic
1145158084 17:20556025-20556047 GAGACAGCACAGAGGCCGCAGGG + Intergenic
1145809853 17:27758033-27758055 GAAACAGCCCAGGGAACGCTGGG - Intronic
1146061349 17:29609052-29609074 GGAACAGCACAGGGGGATCAGGG - Intronic
1148491714 17:48027690-48027712 GAGACAGCACAGGCTCATCTCGG + Intronic
1151283210 17:73091957-73091979 GAAACAGCACTAGGGCTGCTGGG + Intronic
1151545305 17:74789236-74789258 GAAAGAACACAGGGGCCGGTGGG + Intronic
1154004352 18:10514129-10514151 CCAACAGCACAGGGAAAGCTGGG - Intergenic
1154096108 18:11416681-11416703 GAAACATCACAGTGGGAGCAGGG + Intergenic
1155500436 18:26482122-26482144 CAATCACCACAGGGGCAGCATGG - Intronic
1156309226 18:35907515-35907537 TAAAGAACACAGAGGCAGCTAGG + Intergenic
1158320941 18:56263972-56263994 AAAACAGCACACGGGGAGCGAGG - Intergenic
1158639136 18:59188404-59188426 GAGTAAGCACTGGGGCAGCTAGG + Intergenic
1159130082 18:64271457-64271479 GAGAGAGCTCACGGGCAGCTGGG - Intergenic
1159527826 18:69616388-69616410 GAAGGAGCACAGGGCCAGCTAGG - Intronic
1160078989 18:75704709-75704731 GAGACAGCACAGAGGCGTCTAGG - Intergenic
1160310537 18:77786065-77786087 CATTCAGCCCAGGGGCAGCTGGG - Intergenic
1160856490 19:1220267-1220289 CAAACACCACAGGCCCAGCTGGG - Intronic
1161613101 19:5254617-5254639 GAAAAAGCCCAGGGGAACCTTGG - Intronic
1161693943 19:5754773-5754795 GAGACAGCACAAGGGCGGCCAGG - Intronic
1163638732 19:18450025-18450047 GAGGCAGCACAGGTGCAGATGGG - Intronic
1163809051 19:19419015-19419037 GAGACAGCCCAGGCCCAGCTAGG - Intronic
1166169811 19:41019703-41019725 GAAACAGCTCACAGGCAGCAAGG + Intergenic
1167674519 19:50876038-50876060 GAAACAGCAGAGAGGAAGCCAGG - Intronic
1167799376 19:51730296-51730318 GATACAGCACACAGGCAGCATGG + Intergenic
1168549463 19:57280857-57280879 GAAATAGCACAGCAGCAGCAAGG - Intronic
926722377 2:15970716-15970738 GAAAGAGCATCGGGGCAGCAAGG - Intergenic
927124569 2:20002201-20002223 GAAACAAGGGAGGGGCAGCTGGG + Intronic
929754974 2:44756781-44756803 GAAACAACACAGGGGCTACATGG + Intronic
931452469 2:62379744-62379766 AACACAGCACACAGGCAGCTGGG + Intergenic
935984432 2:108659059-108659081 GTAACAGGACTGGGGCATCTTGG + Intronic
936136869 2:109902707-109902729 GTAACAGGACTGGGGCATCTTGG + Intergenic
936207828 2:110468778-110468800 GTAACAGGACTGGGGCATCTTGG - Intronic
937150850 2:119684687-119684709 GAAACAGGACAGGGTCGGATAGG - Intronic
937362651 2:121239656-121239678 GAGAGAGCACAGGGCGAGCTGGG + Intronic
939997134 2:148930444-148930466 GAAACTGCACAGAGGAAGTTTGG + Intronic
940446613 2:153785110-153785132 GAAACAGCAAAGATGGAGCTTGG - Intergenic
944071661 2:195676652-195676674 GAACTAGCACAGGGGTAGATAGG - Intronic
945328335 2:208509817-208509839 GAAGCAGCACAGGTGCAGTTTGG - Intronic
947991758 2:234493955-234493977 GAAAAAGCAGATGGGCTGCTAGG + Exonic
948655885 2:239476480-239476502 GAGACAGCCCTGGGTCAGCTGGG + Intergenic
1169690127 20:8321305-8321327 GAAACAGCAAAAGGGCTGCCTGG - Intronic
1170910822 20:20566120-20566142 GCAGCAGCACAGGGGGATCTGGG - Intronic
1170968641 20:21099370-21099392 GAAACAGCACAGTGGAAAGTTGG + Intergenic
1171155141 20:22865074-22865096 GAAATGGAACAGGGGCAGCAGGG + Intergenic
1171245839 20:23608840-23608862 CAATCATCAAAGGGGCAGCTCGG + Intergenic
1171376095 20:24694994-24695016 GACACAGCTCAGGGACAGCATGG - Intergenic
1172438090 20:34944395-34944417 GAAACAGCTCAGGGGCAAGGTGG + Intronic
1172664834 20:36591791-36591813 GAAACAGCACAGGGGCAGCTTGG - Exonic
1172708287 20:36899681-36899703 GAAACAGCTCAGAGGCAGAGAGG + Intronic
1173295384 20:41750778-41750800 GACAGGGCAGAGGGGCAGCTTGG - Intergenic
1175211077 20:57355746-57355768 CCTACAGCACAGGGGCAGCAGGG + Intronic
1175724730 20:61310141-61310163 GAACCAGCCCAGAGCCAGCTGGG + Intronic
1178517879 21:33264152-33264174 GAAATATCACAGGGCCAGCCAGG - Exonic
1178670985 21:34591484-34591506 CAAACAGCACGGTGGCAGATGGG + Intronic
1179028113 21:37697212-37697234 GAAACAGAACAGGGGCCAATGGG + Intronic
1179183100 21:39061984-39062006 GAAACTGCCCAGGGGCACATGGG - Intergenic
1180176739 21:46094199-46094221 CCAACACCACAGGGGCTGCTGGG + Intergenic
1180595992 22:16973773-16973795 GGAAGAGCACAGGGTCTGCTGGG - Intronic
1180718650 22:17890280-17890302 AAAGCAGCACAGGGACAGCGCGG - Intronic
1180996783 22:19969775-19969797 GACACAGCAGATGGGCACCTGGG + Exonic
1181149888 22:20875613-20875635 GTAAAAGCACAGGGGAAGCCGGG + Intronic
1182787170 22:32917631-32917653 GAAAGTGCACAGGGTCAGCGGGG + Intronic
1183166128 22:36148632-36148654 GAAACACCCCAGGGTCAGCTGGG + Intronic
1183172569 22:36198903-36198925 GAAACACCCCAGGGTCAGCCAGG + Intronic
1183180676 22:36257797-36257819 GAAACACCCCAGGGTCAGCTTGG - Intronic
1183278049 22:36913750-36913772 GAAAAAGGACAGGGGGAGCCTGG + Intronic
1183549040 22:38470494-38470516 GGAACAGAAAAAGGGCAGCTGGG + Intronic
1184242934 22:43220981-43221003 GAAACAGCGGAGGGCAAGCTTGG - Intronic
1184321765 22:43747380-43747402 GGAACAGCACTGGAGAAGCTGGG + Intronic
1184722322 22:46322230-46322252 GCAACAGCACAGCTGCTGCTGGG - Intronic
1185050143 22:48550159-48550181 GAAACAGGGCAGGGCCACCTCGG - Intronic
1185148036 22:49149854-49149876 AACACAGGGCAGGGGCAGCTGGG + Intergenic
950801494 3:15555265-15555287 GAAACAGCACAAGCAAAGCTGGG + Intergenic
954218160 3:49135794-49135816 GACACAGCACAGTAGCAACTAGG + Intergenic
954459368 3:50617575-50617597 GAAACAGCAGAGGAGCAGGGGGG + Exonic
954688867 3:52385270-52385292 GAGAGAGCACAGGGCCTGCTGGG - Intronic
957826165 3:85447660-85447682 GTCACAGCACAGGGGCACGTAGG - Intronic
958880587 3:99664819-99664841 GAAGCAGCACTGGGGCTGCATGG - Intronic
959449321 3:106480186-106480208 AATAGGGCACAGGGGCAGCTTGG + Intergenic
959980149 3:112507066-112507088 GCAATAACACAGGGGCAGGTGGG - Intergenic
960545238 3:118906524-118906546 GGAGCAGCCCAGGGGAAGCTTGG + Intronic
961004825 3:123397908-123397930 GACACAGCACAGAGGCTGCTGGG + Intronic
961528825 3:127526948-127526970 GCAACTGCTCAGGGGCAGATGGG - Intergenic
965103797 3:164335080-164335102 GAACCAGTAGTGGGGCAGCTCGG + Intergenic
965537168 3:169835471-169835493 GGAGCATCACAGGGGCAACTGGG + Intronic
968403251 4:316767-316789 GGAACAGCACAGGGCCAGGGTGG + Intergenic
969392601 4:6901382-6901404 GGAACAGGACAGGGGAAGCTTGG + Intergenic
969544332 4:7814772-7814794 GAAAGAGCACAGGGGCTGGGGGG + Intronic
971402930 4:26293336-26293358 AAGACAGCACAGAGTCAGCTTGG + Intronic
972254438 4:37337940-37337962 CAACCAGAACAGTGGCAGCTTGG - Intronic
972696869 4:41455351-41455373 GAAACAGTCCAGGGGCAGAGAGG + Intronic
978592949 4:110346164-110346186 TAAACAGCACCGGGGCACTTAGG - Intergenic
980178016 4:129370679-129370701 AAATCAGCACAGAGGCAACTGGG - Intergenic
981018573 4:140001508-140001530 GACCCAGGACAGGGCCAGCTCGG - Intronic
981746840 4:148060536-148060558 GAACCAGCACAGTAGCTGCTTGG - Intronic
982465006 4:155719311-155719333 GAAACATCACAGAGGCAGAGTGG + Intronic
983193683 4:164781834-164781856 AAAACAGCACAGTGGCTGCCAGG + Intergenic
985827506 5:2203942-2203964 GATGCAGCACAGGGCCTGCTGGG - Intergenic
986407943 5:7445298-7445320 TAAACTGCACTGGGCCAGCTGGG - Intronic
989183603 5:38601889-38601911 GAGACAGAACAGAGTCAGCTTGG - Intronic
995145396 5:108782838-108782860 CAAACAGTACAGGGGCAATTAGG - Intronic
996847750 5:127919493-127919515 GAGACAGGACAGGAGAAGCTGGG - Intergenic
997431081 5:133841682-133841704 CACACAGCACAGGGCCAGCAGGG + Intergenic
998208096 5:140173748-140173770 GGAACAGGACAGAGGCAGCCAGG - Intergenic
998332774 5:141344264-141344286 GAATCCGCAAAGCGGCAGCTTGG + Exonic
998337118 5:141383130-141383152 GAACCAGCGCAGCGGCAGCTTGG + Exonic
998342529 5:141430990-141431012 GAATCCGCGCAGCGGCAGCTTGG + Exonic
998549831 5:143066835-143066857 GAGCCAGCACAGGGGCAGCTGGG + Intronic
999682413 5:154072570-154072592 GGAACAGCAGGGGGGCACCTAGG + Intronic
1001035404 5:168292823-168292845 AGAACAGCACAGGGGCAGCCAGG + Intronic
1001530642 5:172459123-172459145 GACAAGGCACAGTGGCAGCTGGG - Intergenic
1001764462 5:174234500-174234522 GACCCAGCCCAGAGGCAGCTGGG - Intronic
1002670934 5:180866552-180866574 AAGACAGAACAGGGACAGCTGGG + Intergenic
1002856253 6:1040565-1040587 TAGACAGGGCAGGGGCAGCTGGG + Intergenic
1003537058 6:6984639-6984661 GAAACAGCACACGCGCAGAGAGG + Intergenic
1004498682 6:16189365-16189387 GATGCAACACAGTGGCAGCTGGG - Intergenic
1005643485 6:27818899-27818921 GAAATAGCACAGAGGCATTTGGG + Intergenic
1006774095 6:36578445-36578467 GAGAGAGCACACGGGGAGCTGGG + Intergenic
1006930545 6:37685464-37685486 CAAACAGCAGTGGGGCTGCTTGG + Intronic
1011211894 6:84964435-84964457 GATACAGCAGAGAGACAGCTTGG + Intergenic
1017212908 6:151876606-151876628 GAAAAAGAACAAGGGAAGCTTGG + Intronic
1018306954 6:162467831-162467853 GACACAGCATAGCGGGAGCTCGG - Intronic
1019116138 6:169764119-169764141 GGAAGAGCACAAGGTCAGCTGGG - Intronic
1019352489 7:561543-561565 CAAACGGCAGAGGGACAGCTCGG - Intronic
1019747936 7:2710928-2710950 TAACAGGCACAGGGGCAGCTTGG + Intronic
1020009895 7:4802042-4802064 GACACAGCACTCGGGCAACTGGG + Intronic
1020257547 7:6510503-6510525 GAAGCAGCACAGGGACGCCTTGG + Intronic
1020792839 7:12647442-12647464 GTGACAGCACATGGGCAGATTGG - Intronic
1022200610 7:28113353-28113375 GAGAGAGGACAGGAGCAGCTGGG - Intronic
1023121518 7:36914046-36914068 GAAACTGGCCAGTGGCAGCTAGG + Intronic
1023195620 7:37635656-37635678 CAGAGAGCACATGGGCAGCTTGG - Intergenic
1025532614 7:61908216-61908238 GAAAGAGCAAAGGGGCATTTGGG + Intergenic
1028127274 7:87127759-87127781 GAATCAGAATAGGGTCAGCTTGG + Intergenic
1028159732 7:87472168-87472190 TATACAGCACAGGTGCAGCAAGG + Intronic
1028606325 7:92660339-92660361 GAAAGATGACAGAGGCAGCTGGG + Intronic
1029668297 7:102010097-102010119 GAAACAGCAAGGGTGCAGCTGGG + Intronic
1031528947 7:122853384-122853406 GCTACAGCACAGGAGCTGCTTGG - Intronic
1031546238 7:123053939-123053961 GACCCAGCACATGCGCAGCTTGG - Intergenic
1031942555 7:127804588-127804610 GAAACAGCACAGAGGTAGAAAGG - Intronic
1033500623 7:141945465-141945487 GTATCAGCACAGGGGCTGCTAGG + Intronic
1034470683 7:151252773-151252795 GAAGCAGCATGGGGGCAGCCAGG - Intronic
1034889292 7:154825690-154825712 GAAACAGCAGTGTGGCAGTTGGG - Intronic
1035241931 7:157537860-157537882 CAAACACCACATGGGCAGCGGGG - Intergenic
1035466514 7:159083124-159083146 GAGTCAGGACAGGGGCAGGTAGG - Intronic
1036218831 8:6903603-6903625 GAAGGAGCCCAGGGGCAGCAGGG + Intergenic
1036497489 8:9282745-9282767 CAAAAAGCAGAGGGGCAGCTTGG + Intergenic
1037026087 8:14040062-14040084 GAAACAGCAAGGGGGCAGTGTGG + Intergenic
1037629222 8:20637822-20637844 GAGACAGCACATGGGGAGCAAGG - Intergenic
1037928636 8:22864821-22864843 AAAACACCACGGGGGCCGCTGGG + Intronic
1038205371 8:25459486-25459508 GAAACAGCCCCGTGGCAGCGCGG - Intronic
1040124548 8:43722149-43722171 GAAACTGCAAAGGGGCATTTGGG + Intergenic
1040133479 8:43825352-43825374 GAAACAGCAAAGGGACATCTGGG + Intergenic
1040278575 8:46026208-46026230 GACCCAGCACAGGGGCTGCCGGG + Intergenic
1040286926 8:46105213-46105235 GGGACAGCCCAGGGGCATCTGGG + Intergenic
1040321723 8:46312939-46312961 GAAACTGCACAGGGACATGTTGG - Intergenic
1040324762 8:46336087-46336109 GAGACAGCCCTGGGGCATCTGGG - Intergenic
1040531880 8:48272556-48272578 GAAGCAGCCCAGGAGCAGCTGGG + Intergenic
1042837498 8:73091829-73091851 CAAACAGCACAGAGGCAGGAGGG + Intronic
1043135143 8:76513579-76513601 GAAACAGCATAGTTGCAGATTGG + Intergenic
1043791220 8:84469737-84469759 CAAACTGCAAGGGGGCAGCTAGG - Intronic
1044204117 8:89471772-89471794 AAAACAGGACAGGAGCAGCAGGG - Intergenic
1046625944 8:116577140-116577162 AAAACATCAAAGGGGCACCTAGG - Intergenic
1046707079 8:117466833-117466855 GAGAAAGCACAGAGGCAGTTGGG - Intergenic
1046722017 8:117631151-117631173 GACACAAAACAGGAGCAGCTAGG + Intergenic
1047219089 8:122904210-122904232 GAATCAGGAAAGGGGCAGCCTGG + Intronic
1048386086 8:133913749-133913771 GGAATAGCGCAGGGGCAGGTGGG + Intergenic
1048879029 8:138858100-138858122 CAAACAGAACAGAGGCAGCAAGG - Intronic
1048948559 8:139473697-139473719 GAACCAGCTCAAAGGCAGCTCGG + Intergenic
1049673728 8:143880613-143880635 GGAGCAGCCCAGGGGCAGCGTGG - Intergenic
1051755798 9:20398841-20398863 AAAATAACACAGGGGCAGCAAGG - Intronic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1056381833 9:86063026-86063048 GGAAGAGCTGAGGGGCAGCTTGG - Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056932457 9:90890280-90890302 GAATCAGGATAGGGGCTGCTGGG + Intronic
1057032168 9:91784157-91784179 GAATCAGCACTGTTGCAGCTGGG - Intronic
1057162386 9:92897343-92897365 GACACAGCACAGAGGCTGCAGGG + Intergenic
1057210688 9:93199439-93199461 GACACAGGACAGGGCCAGATAGG - Intronic
1057226318 9:93295130-93295152 TGAGCAGCCCAGGGGCAGCTTGG + Intronic
1057311917 9:93948292-93948314 GAAACCGAGCAGGGCCAGCTAGG - Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057678742 9:97155491-97155513 GACACAGCACAGAGGCTGCAGGG + Intergenic
1057909328 9:99005506-99005528 GAGACAGCACAGGGACAGACTGG - Intronic
1058754610 9:108072857-108072879 GAATCATCTCAGGGGCAGCTGGG - Intergenic
1060475618 9:123984408-123984430 GCATCTCCACAGGGGCAGCTGGG + Intergenic
1061762103 9:132858132-132858154 GAAGCAGCACGGGAGCAACTGGG - Intronic
1062320900 9:135990183-135990205 GAGGCAGCAGAGGGGCTGCTGGG + Intergenic
1062590553 9:137272677-137272699 CAAGCACCACAAGGGCAGCTTGG - Intronic
1186047385 X:5551354-5551376 AAAACAGGACAGGGGGAGCTGGG - Intergenic
1186397505 X:9224733-9224755 GGAGCAGCCCAGGGGAAGCTTGG - Intergenic
1187502715 X:19853266-19853288 GACACAGCCCTGGGGCACCTGGG - Intronic
1190302567 X:49065204-49065226 GAAGCAGCACAGGAGGGGCTGGG - Intronic
1191249961 X:58255549-58255571 GGCCCAGCACAGGGGCTGCTGGG + Intergenic
1191251915 X:58263891-58263913 GGCCCAGCACAGGGGCTGCTGGG - Intergenic
1192208821 X:69113952-69113974 GAAAGAGCTGAGAGGCAGCTGGG - Intergenic
1197884203 X:131201055-131201077 GGAACAGCACAGAAGCAGCCTGG - Intergenic
1198334279 X:135651817-135651839 GCCATAGCCCAGGGGCAGCTGGG - Intergenic
1198370410 X:135984123-135984145 GAATACACACAGGGGCAGCTTGG + Intergenic
1200431813 Y:3091975-3091997 GAGACAGCACCGTTGCAGCTTGG + Intergenic
1200846933 Y:7839819-7839841 GAAACAGTAGTGGGGCAGCTTGG - Intergenic