ID: 1172666744 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:36605603-36605625 |
Sequence | CATCCGCCGGGCTCGCGGTA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 18 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 0, 4: 17} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1172666744_1172666751 | 24 | Left | 1172666744 | 20:36605603-36605625 | CCTTACCGCGAGCCCGGCGGATG | 0: 1 1: 0 2: 0 3: 0 4: 17 |
||
Right | 1172666751 | 20:36605650-36605672 | GCGCGCTTGCGCCAAGGCGCCGG | 0: 1 1: 0 2: 1 3: 1 4: 25 |
||||
1172666744_1172666750 | 18 | Left | 1172666744 | 20:36605603-36605625 | CCTTACCGCGAGCCCGGCGGATG | 0: 1 1: 0 2: 0 3: 0 4: 17 |
||
Right | 1172666750 | 20:36605644-36605666 | CGAGTAGCGCGCTTGCGCCAAGG | 0: 1 1: 0 2: 0 3: 0 4: 18 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1172666744 | Original CRISPR | CATCCGCCGGGCTCGCGGTA AGG (reversed) | Intronic | ||