ID: 1172666744

View in Genome Browser
Species Human (GRCh38)
Location 20:36605603-36605625
Sequence CATCCGCCGGGCTCGCGGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 18
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 17}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172666744_1172666751 24 Left 1172666744 20:36605603-36605625 CCTTACCGCGAGCCCGGCGGATG 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1172666751 20:36605650-36605672 GCGCGCTTGCGCCAAGGCGCCGG 0: 1
1: 0
2: 1
3: 1
4: 25
1172666744_1172666750 18 Left 1172666744 20:36605603-36605625 CCTTACCGCGAGCCCGGCGGATG 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1172666750 20:36605644-36605666 CGAGTAGCGCGCTTGCGCCAAGG 0: 1
1: 0
2: 0
3: 0
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172666744 Original CRISPR CATCCGCCGGGCTCGCGGTA AGG (reversed) Intronic