ID: 1172666745

View in Genome Browser
Species Human (GRCh38)
Location 20:36605608-36605630
Sequence GTCAGCATCCGCCGGGCTCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 61}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172666745_1172666751 19 Left 1172666745 20:36605608-36605630 CCGCGAGCCCGGCGGATGCTGAC 0: 1
1: 0
2: 0
3: 1
4: 61
Right 1172666751 20:36605650-36605672 GCGCGCTTGCGCCAAGGCGCCGG 0: 1
1: 0
2: 1
3: 1
4: 25
1172666745_1172666750 13 Left 1172666745 20:36605608-36605630 CCGCGAGCCCGGCGGATGCTGAC 0: 1
1: 0
2: 0
3: 1
4: 61
Right 1172666750 20:36605644-36605666 CGAGTAGCGCGCTTGCGCCAAGG 0: 1
1: 0
2: 0
3: 0
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172666745 Original CRISPR GTCAGCATCCGCCGGGCTCG CGG (reversed) Intronic