ID: 1172666745 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:36605608-36605630 |
| Sequence | GTCAGCATCCGCCGGGCTCG CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 63 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 1, 4: 61} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1172666745_1172666751 | 19 | Left | 1172666745 | 20:36605608-36605630 | CCGCGAGCCCGGCGGATGCTGAC | 0: 1 1: 0 2: 0 3: 1 4: 61 |
||
| Right | 1172666751 | 20:36605650-36605672 | GCGCGCTTGCGCCAAGGCGCCGG | 0: 1 1: 0 2: 1 3: 1 4: 25 |
||||
| 1172666745_1172666750 | 13 | Left | 1172666745 | 20:36605608-36605630 | CCGCGAGCCCGGCGGATGCTGAC | 0: 1 1: 0 2: 0 3: 1 4: 61 |
||
| Right | 1172666750 | 20:36605644-36605666 | CGAGTAGCGCGCTTGCGCCAAGG | 0: 1 1: 0 2: 0 3: 0 4: 18 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1172666745 | Original CRISPR | GTCAGCATCCGCCGGGCTCG CGG (reversed) | Intronic | ||