ID: 1172666746

View in Genome Browser
Species Human (GRCh38)
Location 20:36605615-36605637
Sequence AAATGACGTCAGCATCCGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 62}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172666746_1172666753 28 Left 1172666746 20:36605615-36605637 CCCGGCGGATGCTGACGTCATTT 0: 1
1: 0
2: 0
3: 10
4: 62
Right 1172666753 20:36605666-36605688 GCGCCGGTCGCTGTTTCACTCGG 0: 1
1: 0
2: 0
3: 0
4: 18
1172666746_1172666751 12 Left 1172666746 20:36605615-36605637 CCCGGCGGATGCTGACGTCATTT 0: 1
1: 0
2: 0
3: 10
4: 62
Right 1172666751 20:36605650-36605672 GCGCGCTTGCGCCAAGGCGCCGG 0: 1
1: 0
2: 1
3: 1
4: 25
1172666746_1172666750 6 Left 1172666746 20:36605615-36605637 CCCGGCGGATGCTGACGTCATTT 0: 1
1: 0
2: 0
3: 10
4: 62
Right 1172666750 20:36605644-36605666 CGAGTAGCGCGCTTGCGCCAAGG 0: 1
1: 0
2: 0
3: 0
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172666746 Original CRISPR AAATGACGTCAGCATCCGCC GGG (reversed) Intronic