ID: 1172666747

View in Genome Browser
Species Human (GRCh38)
Location 20:36605616-36605638
Sequence GAAATGACGTCAGCATCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 42}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172666747_1172666753 27 Left 1172666747 20:36605616-36605638 CCGGCGGATGCTGACGTCATTTC 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1172666753 20:36605666-36605688 GCGCCGGTCGCTGTTTCACTCGG 0: 1
1: 0
2: 0
3: 0
4: 18
1172666747_1172666750 5 Left 1172666747 20:36605616-36605638 CCGGCGGATGCTGACGTCATTTC 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1172666750 20:36605644-36605666 CGAGTAGCGCGCTTGCGCCAAGG 0: 1
1: 0
2: 0
3: 0
4: 18
1172666747_1172666751 11 Left 1172666747 20:36605616-36605638 CCGGCGGATGCTGACGTCATTTC 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1172666751 20:36605650-36605672 GCGCGCTTGCGCCAAGGCGCCGG 0: 1
1: 0
2: 1
3: 1
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172666747 Original CRISPR GAAATGACGTCAGCATCCGC CGG (reversed) Intronic