ID: 1172666751

View in Genome Browser
Species Human (GRCh38)
Location 20:36605650-36605672
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 28
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 25}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172666746_1172666751 12 Left 1172666746 20:36605615-36605637 CCCGGCGGATGCTGACGTCATTT 0: 1
1: 0
2: 0
3: 10
4: 62
Right 1172666751 20:36605650-36605672 GCGCGCTTGCGCCAAGGCGCCGG 0: 1
1: 0
2: 1
3: 1
4: 25
1172666747_1172666751 11 Left 1172666747 20:36605616-36605638 CCGGCGGATGCTGACGTCATTTC 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1172666751 20:36605650-36605672 GCGCGCTTGCGCCAAGGCGCCGG 0: 1
1: 0
2: 1
3: 1
4: 25
1172666744_1172666751 24 Left 1172666744 20:36605603-36605625 CCTTACCGCGAGCCCGGCGGATG 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1172666751 20:36605650-36605672 GCGCGCTTGCGCCAAGGCGCCGG 0: 1
1: 0
2: 1
3: 1
4: 25
1172666745_1172666751 19 Left 1172666745 20:36605608-36605630 CCGCGAGCCCGGCGGATGCTGAC 0: 1
1: 0
2: 0
3: 1
4: 61
Right 1172666751 20:36605650-36605672 GCGCGCTTGCGCCAAGGCGCCGG 0: 1
1: 0
2: 1
3: 1
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type