ID: 1172666751

View in Genome Browser
Species Human (GRCh38)
Location 20:36605650-36605672
Sequence GCGCGCTTGCGCCAAGGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 28
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 25}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172666747_1172666751 11 Left 1172666747 20:36605616-36605638 CCGGCGGATGCTGACGTCATTTC 0: 1
1: 0
2: 0
3: 4
4: 42
Right 1172666751 20:36605650-36605672 GCGCGCTTGCGCCAAGGCGCCGG 0: 1
1: 0
2: 1
3: 1
4: 25
1172666744_1172666751 24 Left 1172666744 20:36605603-36605625 CCTTACCGCGAGCCCGGCGGATG 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1172666751 20:36605650-36605672 GCGCGCTTGCGCCAAGGCGCCGG 0: 1
1: 0
2: 1
3: 1
4: 25
1172666746_1172666751 12 Left 1172666746 20:36605615-36605637 CCCGGCGGATGCTGACGTCATTT 0: 1
1: 0
2: 0
3: 10
4: 62
Right 1172666751 20:36605650-36605672 GCGCGCTTGCGCCAAGGCGCCGG 0: 1
1: 0
2: 1
3: 1
4: 25
1172666745_1172666751 19 Left 1172666745 20:36605608-36605630 CCGCGAGCCCGGCGGATGCTGAC 0: 1
1: 0
2: 0
3: 1
4: 61
Right 1172666751 20:36605650-36605672 GCGCGCTTGCGCCAAGGCGCCGG 0: 1
1: 0
2: 1
3: 1
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172666751 Original CRISPR GCGCGCTTGCGCCAAGGCGC CGG Intronic
904533004 1:31181628-31181650 GCGAGCTCGGGCCAAGGCGCAGG - Exonic
1066419693 10:35253334-35253356 GCTCGCTTGAGCCCAGGAGCTGG - Intronic
1071857983 10:89645090-89645112 GCGCGCCGGCCCCACGGCGCCGG + Exonic
1074371766 10:112906192-112906214 GCACACTTGCCCCAAAGCGCAGG + Intergenic
1082928718 11:58578425-58578447 GTGCGCATGCGCCAAGAGGCGGG + Intergenic
1105916627 13:24922903-24922925 GCGCGTCTGCGCTAAAGCGCAGG + Intergenic
1132552811 16:560357-560379 GCGCGCGTGCGCCTGGGCTCCGG - Intergenic
1142209783 16:88803620-88803642 GCGCGCATGCGCCGACGTGCGGG - Exonic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1156088762 18:33440601-33440623 GGGCGCTTGTGCCTCGGCGCGGG - Intronic
1156088766 18:33440621-33440643 GGGCGCTTGTGCCTCGGCGCGGG - Intronic
1163329679 19:16628332-16628354 GCGCGCTTGCGCGGAGGCGCGGG - Intronic
1163743919 19:19033608-19033630 GCGCGCTTGCGCAAGAGAGCCGG - Exonic
936279176 2:111122737-111122759 GCGGGCTGGCGGGAAGGCGCGGG + Intronic
945492885 2:210476659-210476681 GCGCACTTGCTTCAAGTCGCGGG - Exonic
1171473572 20:25390662-25390684 GCGCTCATGCTCCAAGGCGACGG + Exonic
1172666751 20:36605650-36605672 GCGCGCTTGCGCCAAGGCGCCGG + Intronic
1173613636 20:44388791-44388813 CCGCGGTTGCCCCAGGGCGCAGG - Intronic
1176015545 20:62929359-62929381 GCGCGCCTGGGCCTCGGCGCTGG + Intronic
962319937 3:134382030-134382052 GGGCGCTTGCGCCAGGAAGCTGG + Intergenic
963038303 3:141051151-141051173 GCGCCCCTGTGCCAAGGCGGCGG - Intergenic
968756142 4:2417543-2417565 GCGCGCTCGCCCCAAGGGCCGGG + Intronic
992663679 5:78985208-78985230 GCGAGCTTGCCCCGAGGCCCCGG - Exonic
994075703 5:95646980-95647002 GCGGGCTTCCGCCCAGGCACAGG + Exonic
1002351940 5:178589737-178589759 GCACGTCTGCGCCAAGGCGGAGG - Intronic
1015843136 6:137493978-137494000 GCGGGCTGGCGCCAAGGCCGCGG - Exonic
1026116965 7:67503723-67503745 GGGCGCTTGAGCCAAGCCGTGGG + Intergenic
1057228650 9:93305635-93305657 CCGAGCTTGGGCCAAGGAGCTGG + Intronic