ID: 1172666783

View in Genome Browser
Species Human (GRCh38)
Location 20:36605821-36605843
Sequence ACCGCAGCGCGCCGCAGGAC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 50}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172666779_1172666783 4 Left 1172666779 20:36605794-36605816 CCGGGTAGCTTGGCCAGGTTGTG 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1172666783 20:36605821-36605843 ACCGCAGCGCGCCGCAGGACCGG 0: 1
1: 0
2: 0
3: 3
4: 50
1172666773_1172666783 27 Left 1172666773 20:36605771-36605793 CCTGCTCTGTAGAGCCGGCGGAA 0: 1
1: 0
2: 0
3: 5
4: 61
Right 1172666783 20:36605821-36605843 ACCGCAGCGCGCCGCAGGACCGG 0: 1
1: 0
2: 0
3: 3
4: 50
1172666777_1172666783 13 Left 1172666777 20:36605785-36605807 CCGGCGGAACCGGGTAGCTTGGC 0: 1
1: 0
2: 0
3: 1
4: 21
Right 1172666783 20:36605821-36605843 ACCGCAGCGCGCCGCAGGACCGG 0: 1
1: 0
2: 0
3: 3
4: 50
1172666781_1172666783 -9 Left 1172666781 20:36605807-36605829 CCAGGTTGTGAGGAACCGCAGCG 0: 1
1: 0
2: 1
3: 2
4: 54
Right 1172666783 20:36605821-36605843 ACCGCAGCGCGCCGCAGGACCGG 0: 1
1: 0
2: 0
3: 3
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172666783 Original CRISPR ACCGCAGCGCGCCGCAGGAC CGG Exonic
901303684 1:8217364-8217386 GCCGGAGGGCGCCGCAGGAAGGG + Intergenic
901482126 1:9532480-9532502 ACCGCACCCGGCCACAGGACGGG + Intergenic
911975290 1:104487354-104487376 ACCCCAGCCCACCCCAGGACAGG + Intergenic
914619326 1:149390855-149390877 ACAGCAGAGCGGCGCAGGGCGGG - Intergenic
918059944 1:181052460-181052482 ACCGCAGTGCTCCACATGACAGG - Exonic
1064424082 10:15214543-15214565 ACTGCAGCTCCCTGCAGGACTGG - Exonic
1065875388 10:29993357-29993379 CCCCCAGCGCTCCCCAGGACAGG + Intergenic
1073076474 10:100828029-100828051 ACCGCAGCGCGGCCCAGCCCCGG + Exonic
1074618679 10:115094165-115094187 ACCTCAGCGCGCGGCGGGAGCGG + Intronic
1076402108 10:130191027-130191049 GCCGCAGGGCGTCGCAGGCCTGG + Intergenic
1077362671 11:2147651-2147673 ACAGCAGCTCACCTCAGGACTGG + Exonic
1091807415 12:3366209-3366231 ACCGCAGCGGGGCGCGGGGCGGG - Intergenic
1095853061 12:46831493-46831515 ACTCCAGCGCGCAGCAGGCCGGG + Intronic
1104854654 12:131896031-131896053 GCCGCAGGGCGCCCCAGGGCAGG + Intronic
1108362245 13:49678312-49678334 GCCGGCGCGCGGCGCAGGACTGG - Intronic
1120813019 14:88824563-88824585 CCCGCAGCGCGCCTGAGAACAGG - Exonic
1139471032 16:67178342-67178364 AGTGCAGCGCGCCACAGGAACGG + Exonic
1142804320 17:2363484-2363506 GCGGCAGCGCGTCGGAGGACAGG + Exonic
1142806169 17:2372326-2372348 ACCGCTGCCCACCGCAGGGCTGG + Exonic
1146183174 17:30709790-30709812 ACCCCAGAGCGGCGCTGGACAGG + Intergenic
1147142330 17:38466618-38466640 CCCGCAGCGCCTCCCAGGACCGG + Exonic
1148755773 17:49972258-49972280 ACCGCAGCGCGATCCAGGAGTGG + Intronic
1149626625 17:58084245-58084267 ACCGCAGCGCTCTGGAGGATGGG + Intronic
1154028204 18:10726506-10726528 AGCGCAGCGCGCCACAGGAACGG - Intronic
1161304207 19:3557788-3557810 CCCCGAGCGCGCCGCAGGAGTGG + Intronic
1162110504 19:8397356-8397378 ACCTCAGGGAGCCTCAGGACAGG - Intronic
1163604061 19:18264659-18264681 CCCGCAGCTCGCCCCGGGACAGG + Exonic
1164551144 19:29213203-29213225 ACGACAGCGCGCCGCCGGAAAGG + Exonic
1166092520 19:40519539-40519561 ACTGCAGGGCGCCGCCGGCCCGG - Exonic
1168688453 19:58362593-58362615 CCCGCCGCGCGGGGCAGGACGGG - Intronic
925139591 2:1540690-1540712 ACCGCAGCGGGCCGCAGCTCAGG + Exonic
937421033 2:121755608-121755630 CTCGCGGCGCGCCGGAGGACGGG - Exonic
938315041 2:130319233-130319255 CCCACAGCACTCCGCAGGACGGG + Intergenic
938386717 2:130872050-130872072 ACCGCAGCGCGGTTCAGGTCAGG + Intronic
1172666783 20:36605821-36605843 ACCGCAGCGCGCCGCAGGACCGG + Exonic
1176106936 20:63393868-63393890 ACCCCAGCACAGCGCAGGACAGG - Intergenic
1178843672 21:36157111-36157133 AGCAGAGCGCGCCGCAGGCCCGG - Intronic
954041069 3:47887590-47887612 AACGCACCACGGCGCAGGACTGG + Intronic
966725071 3:183101282-183101304 AGCGCACGGCGGCGCAGGACTGG + Intronic
975167004 4:71187714-71187736 AGCCCAGCCCGCCGCAGAACTGG - Intronic
980236445 4:130113391-130113413 AGCGCAGCAAGCCACAGGACAGG + Intergenic
985352014 4:189074185-189074207 ACCTCAGCTCTCCACAGGACAGG + Intergenic
992365499 5:76084898-76084920 TCCGCAGTGCGCCGCAGTGCCGG + Intronic
998080888 5:139274122-139274144 TCCGCAGGGCGCAGCAGCACCGG - Exonic
1002429607 5:179195325-179195347 AGCACAGGGCGCAGCAGGACAGG + Intronic
1002533298 5:179862372-179862394 ACCGCAGGGGGCCCCAGGGCTGG - Exonic
1016982297 6:149864288-149864310 CACCCAGCGCGCCGCAGGCCGGG - Intergenic
1019296954 7:282714-282736 CCCCCAGCGCTCAGCAGGACAGG - Intergenic
1028198528 7:87934521-87934543 GCCGCAGCGCGCCGGAGGGCAGG - Exonic
1034956750 7:155339707-155339729 ACTGCGGCGCGCAGCAGGCCTGG - Intergenic
1035012032 7:155727830-155727852 ATCGCAGCTCGCTGCAGGCCCGG + Intronic
1037337003 8:17801371-17801393 CCCGCAGCGAGCCGCTGGAGTGG - Intergenic
1058058627 9:100473498-100473520 AGCGCAGGGAGCCGCAGGCCGGG - Exonic
1200249747 X:154546722-154546744 ACCGCCGCGCGGCGCAGCGCGGG + Intronic