ID: 1172668038

View in Genome Browser
Species Human (GRCh38)
Location 20:36614227-36614249
Sequence ACCCCTGGGAAGCCACAACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172668038_1172668043 -4 Left 1172668038 20:36614227-36614249 CCGGGTTGTGGCTTCCCAGGGGT 0: 1
1: 0
2: 0
3: 11
4: 151
Right 1172668043 20:36614246-36614268 GGGTGGGTCCTTCTAACTCTTGG 0: 1
1: 0
2: 1
3: 11
4: 80
1172668038_1172668045 17 Left 1172668038 20:36614227-36614249 CCGGGTTGTGGCTTCCCAGGGGT 0: 1
1: 0
2: 0
3: 11
4: 151
Right 1172668045 20:36614267-36614289 GGTCCTGCTTTCATGTTTCCAGG 0: 1
1: 0
2: 2
3: 18
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172668038 Original CRISPR ACCCCTGGGAAGCCACAACC CGG (reversed) Intronic
900130977 1:1087138-1087160 ACCCCCGGGCGGCCACATCCTGG - Exonic
900463186 1:2811040-2811062 ACCTCTGGGCAGCCACCTCCAGG + Intergenic
900603157 1:3511794-3511816 ACCCGTGGGAAGCAGCAACATGG + Intronic
901180048 1:7335523-7335545 AGCACTGGGAAGCCTCAAGCTGG - Intronic
901533815 1:9869955-9869977 ACACCTGGGCAGACACACCCAGG + Intronic
901664246 1:10817381-10817403 TTCCCTGGGAAGCCACAGCAGGG - Intergenic
906275654 1:44513286-44513308 ACCCCAGGGACGCCACACCCTGG - Intronic
910493704 1:87801887-87801909 ACTCCTGGGAAGCCACTATCAGG - Intergenic
913960044 1:143332517-143332539 GCTCCTGGCAAGGCACAACCAGG - Intergenic
914054399 1:144158090-144158112 GCTCCTGGCAAGGCACAACCAGG - Intergenic
914124747 1:144808271-144808293 GCTCCTGGCAAGGCACAACCAGG + Intergenic
914846448 1:151286406-151286428 GGCCCAGGGAAGCCAGAACCAGG + Exonic
915008278 1:152661006-152661028 TCCCCTGGGAAACCAGAACTGGG - Intergenic
915009562 1:152672877-152672899 TCCCCTGGGAAACCAGAACTGGG - Intergenic
918575928 1:186060243-186060265 ACCCCTGGGAAACCAGACCCAGG + Intronic
919075723 1:192810215-192810237 ACTCCTGGGAAGCCCAAAACCGG + Exonic
919439377 1:197610952-197610974 ACCGGTCGGAATCCACAACCTGG + Intronic
920674931 1:208032049-208032071 ACCCATGGGAAGCCCGGACCCGG - Intronic
922475740 1:225905906-225905928 ACCCCTGGACAGCCACAGACTGG + Intronic
922734513 1:227972036-227972058 ACCCCTGGGAGGCAACAGCTGGG + Intergenic
922734795 1:227973167-227973189 ACCCCTGGGAGGCAACAGCGGGG + Intergenic
923001161 1:230007421-230007443 TCCCCAGGGGAGTCACAACCAGG + Intergenic
1063817292 10:9790174-9790196 ACCCCTGGGGATTCACACCCTGG - Intergenic
1066733052 10:38450846-38450868 ACCCCTGGGAGGCAACAGCGGGG + Intergenic
1067028450 10:42864569-42864591 GCTCCTGGCAAGGCACAACCAGG - Intergenic
1069779320 10:70944855-70944877 AGCCCTGGAGATCCACAACCTGG + Intergenic
1074156981 10:110807924-110807946 ATCGCCGGGAAGCCACACCCCGG - Intronic
1074428605 10:113373844-113373866 AGCCCTGGGAGGCCCCTACCAGG + Intergenic
1076425034 10:130361621-130361643 TCCCCAGGGCAGCCACATCCAGG - Intergenic
1076629301 10:131842777-131842799 ACACCACGGAAGTCACAACCAGG - Intergenic
1077466196 11:2734857-2734879 GGGCCTGGGAAGCCACAGCCAGG - Intronic
1077473655 11:2776450-2776472 AGCCCTGGGAAGACACTGCCTGG + Intronic
1082754777 11:57063456-57063478 ACCCCTGAGTAGCCCCAACTGGG + Intergenic
1083293574 11:61703234-61703256 TCCCCTGAGAAGCCACACCCTGG + Intronic
1083820740 11:65170073-65170095 AACCCTGGGGAGCCACAGCTGGG + Intergenic
1083886959 11:65577607-65577629 CCTCCTGGGAAGCTGCAACCTGG - Intronic
1083934898 11:65865047-65865069 ACCCCTGGGAACCCTGAATCAGG + Exonic
1084474001 11:69378474-69378496 ACCCATGGGGAGGCACAGCCTGG + Intergenic
1089660539 11:119982565-119982587 ACCCCGGGGTAGGCACAGCCTGG - Intergenic
1090420498 11:126572074-126572096 ACCCCTGGGGAGGCTCAGCCTGG + Intronic
1091280101 11:134376822-134376844 CCCCCTGGGCAGCCACACACGGG - Intronic
1092190052 12:6512635-6512657 GCCACTGGGGAGCCACAAGCAGG + Intronic
1095978201 12:47954183-47954205 ACGCCTGGGAAGCCAAGCCCAGG + Intergenic
1096676209 12:53227478-53227500 GCCCCTGGGTAGCCAGATCCAGG + Exonic
1097073795 12:56377102-56377124 TCCCCTGGGAAGCATCTACCTGG + Intergenic
1097360942 12:58656821-58656843 ACAGCTGGGAAGCCACAGCTGGG - Intronic
1097966785 12:65590147-65590169 ACCTCTGGGAAGGCCCAGCCTGG + Intergenic
1101781705 12:107843993-107844015 ACCCCTGTGCCGCCACAGCCCGG + Intergenic
1102620678 12:114192232-114192254 ACCCCTGGGAAGGCACTTCATGG - Intergenic
1103945399 12:124523352-124523374 GCTCCTGGGAACCCACACCCCGG + Intronic
1104780813 12:131419044-131419066 ACCTCTGGGCAGCCACATCCTGG + Intergenic
1111303361 13:86373638-86373660 AGCCCTTGGAAACCACTACCTGG + Intergenic
1112399488 13:99063404-99063426 ACACCTGGGTACCCACACCCAGG - Intronic
1120234618 14:81876197-81876219 ACCACATGGAAGCCACAACTTGG - Intergenic
1120850209 14:89162907-89162929 ACCACTGGGGAGCCACAAGATGG + Exonic
1121403469 14:93703218-93703240 AGTCCTGGGAAGCCAGAACAAGG - Intronic
1122080401 14:99263090-99263112 GACCCTGGGAAGGCACAGCCAGG + Intronic
1122833896 14:104421652-104421674 ACCCCGGGGAAGCCAGGCCCAGG + Intergenic
1126782509 15:52150683-52150705 ACCCATGGGAGGCCACAGCTGGG - Intronic
1127181767 15:56427130-56427152 ACCTCTGTGAACCCACAAACTGG + Intronic
1127368579 15:58313930-58313952 CCCCCAGGGAAGCAACATCCAGG - Intronic
1127378032 15:58402941-58402963 AACCCTGGGAGCCCAGAACCTGG + Intronic
1127525969 15:59792218-59792240 ACCCCTTGGCACCTACAACCTGG - Intergenic
1128603733 15:69018763-69018785 TGCCCTGGGGAGCCACATCCCGG + Intronic
1129193851 15:73952864-73952886 ACCTCTGGGATGCCACAGCCAGG - Intergenic
1129206310 15:74038929-74038951 ACCCCAGGTACTCCACAACCAGG - Intronic
1129360506 15:75021154-75021176 ACCCTTGGGAAGCCTGATCCCGG + Exonic
1129922605 15:79332717-79332739 ATCCATGGGAAATCACAACCAGG - Intronic
1130196070 15:81781397-81781419 ACCCCAGGCCAGCCACATCCTGG + Intergenic
1131179274 15:90228995-90229017 ACCCCTGGGAGGCCATGAACTGG - Exonic
1131213830 15:90520539-90520561 GCCCCTGGAAAGCCCCTACCTGG - Intergenic
1133981406 16:10635710-10635732 ACCCCTGGGAATCCAGGAACGGG - Intronic
1137619419 16:49866729-49866751 GCCCCTGGGAAGCCAGGCCCTGG - Intergenic
1141630121 16:85283156-85283178 ACCCCTTGGATGGCCCAACCTGG + Intergenic
1143175671 17:4953555-4953577 AGCCCTGGGAACCCCCACCCCGG - Intronic
1143783398 17:9240797-9240819 ACCCCTGAGAAGCCCAAGCCGGG + Exonic
1144862674 17:18315330-18315352 GCTCCTAGGACGCCACAACCCGG - Exonic
1145063845 17:19748796-19748818 AACCCTGGGGAGCCACAGGCTGG + Intronic
1148547418 17:48528795-48528817 GCCCCCAGCAAGCCACAACCAGG - Exonic
1151545704 17:74791630-74791652 GCCACTGGGAAGCCACGCCCAGG - Intronic
1152211984 17:79007596-79007618 ACACCTCGAAAGCCACATCCAGG + Intronic
1153707133 18:7757526-7757548 ACCCCTGGGCAGCCAGCAGCAGG + Intronic
1153953610 18:10077110-10077132 ACCCCTGAGATGCCTCACCCTGG + Intergenic
1160686436 19:439015-439037 ACCCCAGGGAAGCCATCAACCGG - Exonic
1160961090 19:1721190-1721212 ACCCATGGGAAGACAGAGCCAGG + Intergenic
1164720178 19:30426113-30426135 ACCCCTGAGGAGCTACAAACAGG + Intronic
1165278396 19:34774304-34774326 CCCCCAGGGAAGCCAGAACCAGG + Intergenic
1166874326 19:45888086-45888108 GCCCCTGAGAAGCCCCAGCCTGG + Intergenic
1168079558 19:53999551-53999573 ACCCATAGGAACCCAGAACCAGG - Intronic
1168471291 19:56643039-56643061 ACCCCCGGGAAGCCTGCACCTGG - Intergenic
1202693878 1_KI270712v1_random:110768-110790 GCTCCTGGCAAGGCACAACCAGG - Intergenic
927677516 2:25117210-25117232 ACACCTGGGAAGCCACGCCTGGG - Intronic
929614224 2:43295874-43295896 ACCCCAGGGAGGCCACCATCTGG + Intronic
932736932 2:74260797-74260819 ACCCCTGGGAAGCTTGAAGCAGG - Intronic
933952683 2:87343807-87343829 GCTCCTGGCAAGGCACAACCAGG + Intergenic
934236925 2:90240153-90240175 GCTCCTGGCAAGGCACAACCAGG + Intergenic
936155078 2:110042015-110042037 GCCCCAGGAAAGCCACACCCGGG - Intergenic
936189604 2:110329399-110329421 GCCCCAGGAAAGCCACACCCGGG + Intergenic
938247505 2:129790377-129790399 AGCCCTGGAAAGCCAGAACTCGG - Intergenic
938717271 2:134032092-134032114 TCTCCTGGGAAGCCACACACTGG + Intergenic
946197268 2:218041797-218041819 ATCCCTGAGAAGACAAAACCAGG - Intronic
948155593 2:235778545-235778567 CTCCCTGGGAAGCCAGAAGCTGG - Intronic
949060669 2:241955258-241955280 AGCCCTGGGAAGCCACCCCGAGG - Intergenic
1171438393 20:25141502-25141524 TCCCCTGGGAAGCCACTCCAGGG + Intergenic
1172668038 20:36614227-36614249 ACCCCTGGGAAGCCACAACCCGG - Intronic
1176139166 20:63537600-63537622 ACCCCCAAGAAGCCCCAACCGGG - Intergenic
1178370339 21:32021820-32021842 GCTCCTGGGCAGACACAACCGGG + Intronic
1179178693 21:39027114-39027136 ACCCCAGGGGAGCCACAGCAGGG + Intergenic
1181711916 22:24696445-24696467 ACCTCTGGGAAGCCCCAAGGAGG - Intergenic
1181784998 22:25220654-25220676 ACCCCTGGGGAAACACAGCCTGG + Intronic
1185417855 22:50720039-50720061 ACCCCGGGGAAGCCACCGTCCGG - Intergenic
951143325 3:19195150-19195172 ACTCCTGGCAAGCCTCAAGCTGG - Intronic
953330199 3:42046394-42046416 ACCCTTAGGAGGCCATAACCTGG + Intronic
954449143 3:50562368-50562390 AGCCCTGGGGAGCCACAGGCAGG - Intronic
959675665 3:109032456-109032478 ACCCATGGGAGACCACAACCTGG - Intronic
961944246 3:130670054-130670076 ACCTCTGAGAAGCCTCCACCTGG + Intronic
962828447 3:139119595-139119617 ACCCCTGGGGCACCAGAACCAGG - Intronic
968759061 4:2432792-2432814 ACCCTTGGGCAGCCACAGGCCGG + Intronic
979787993 4:124740711-124740733 GCCCCTGGCATGCCACACCCTGG - Intergenic
980591754 4:134898578-134898600 ACCACTGGCAATCCCCAACCAGG + Intergenic
982460874 4:155667546-155667568 AGCCCTGGGAAGCCAGCATCGGG + Intronic
986409857 5:7466622-7466644 CCCCCTAGGAAGCCACAGACTGG + Intronic
986468304 5:8049333-8049355 ACCCCTGAGTAACCACAGCCAGG - Intergenic
997206524 5:132053547-132053569 ACCCCAGGGAAGCTGCCACCTGG - Intergenic
997402131 5:133611738-133611760 ACCCCGGGGAAGCCAGGGCCAGG + Intronic
998265513 5:140664971-140664993 ACTCCATGGAAGCCCCAACCCGG + Exonic
999499222 5:152130123-152130145 ACCCTTGGGAAGCTTCTACCTGG - Intergenic
1000308810 5:160021181-160021203 ACACCTGTGAGGCAACAACCAGG + Intronic
1004127726 6:12889882-12889904 CCACCTGGGAAACCACATCCTGG + Intronic
1004579772 6:16938928-16938950 ACCCCTGGCCAGCCATGACCAGG - Intergenic
1007163725 6:39813044-39813066 ACCCCTCACAAACCACAACCGGG + Intronic
1018524286 6:164690405-164690427 ACATGTGGGAACCCACAACCTGG + Intergenic
1018617865 6:165704961-165704983 ACTCCTGGGAGGACACAACAGGG - Intronic
1018952092 6:168385899-168385921 ACCCGTGGGAAGCCAGACCATGG + Intergenic
1019811881 7:3170990-3171012 CCCAGTGGGAAGCCAAAACCAGG - Intronic
1023059762 7:36315993-36316015 ACCCCTGGGAAGCAAGAGCAAGG - Intergenic
1024455688 7:49604563-49604585 TCCCCAGGGAAGCCACTTCCGGG + Intergenic
1025129299 7:56367417-56367439 GCCCCTGGGAGGCCACAGCGGGG - Intergenic
1033213748 7:139479626-139479648 CCCCCTGCTAAGCCACACCCAGG - Exonic
1033725975 7:144118942-144118964 ACACCCAGGAAGCCACAGCCAGG + Intergenic
1033726984 7:144129538-144129560 ACACCCAGGAAGCCACAGCCAGG - Exonic
1034349483 7:150406827-150406849 CCCCCTGGGAGCCCACACCCTGG + Intronic
1034899222 7:154897200-154897222 ACCCCTGGGGAGCCCCAGCAGGG - Intergenic
1034990781 7:155546877-155546899 TCCACTGGGCAGCCACAGCCTGG - Intergenic
1035045829 7:155964736-155964758 AGCCCTGGGAAGCCACCACTGGG - Exonic
1039581676 8:38671873-38671895 AGCCCTGAGAAGCCACATCCTGG - Intergenic
1039828613 8:41195300-41195322 ACCCCCGGGAAGCCCCAGCCTGG + Intergenic
1041393805 8:57372170-57372192 TCCCCTGGCAACCCACCACCAGG + Intergenic
1041735415 8:61105953-61105975 ATCCCTTGGAAGCCAGAAGCCGG + Intronic
1045498819 8:102729682-102729704 AGCCCTGGGAGGCCCCACCCTGG - Intergenic
1048335412 8:133498762-133498784 ACCCCTGGGACCCCACAGCAGGG - Intronic
1049362509 8:142219132-142219154 ACCCCAGGGAAGCACCACCCAGG - Intronic
1049949606 9:631330-631352 CCCCCTGGGCAGCCTTAACCAGG + Intronic
1051811643 9:21055946-21055968 ATCCTTGGGAATCCAGAACCGGG + Intergenic
1057273676 9:93665037-93665059 ACCCCTGGGAAGGCAAAGGCTGG + Intronic
1060817328 9:126642020-126642042 ACCCCTTCGAAGCCCCCACCTGG + Intronic
1061878472 9:133556685-133556707 ACACCTGGGCAGTCACAGCCAGG + Intronic
1061914015 9:133739677-133739699 ACCCCAGGTAAGCCTCAAACTGG - Exonic
1062429786 9:136521812-136521834 CCCCCTTGGAAGCCCCAAGCTGG - Intronic
1188132167 X:26449541-26449563 TCCCCTGGGAACCCACATACAGG - Intergenic
1189516247 X:41715920-41715942 AGCCCTGGGAGGCCACAAATGGG + Intronic
1199947642 X:152681117-152681139 AGCCCTGGGAGGCCACAGGCAGG + Intergenic
1199962037 X:152787337-152787359 AGCCCTGGGAGGCCACAGGCAGG - Intergenic