ID: 1172668108

View in Genome Browser
Species Human (GRCh38)
Location 20:36614592-36614614
Sequence GATGTAGTCAAAGGTCTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 134}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172668101_1172668108 26 Left 1172668101 20:36614543-36614565 CCAAAGAGTGATAGGACATGAGC 0: 1
1: 0
2: 0
3: 5
4: 94
Right 1172668108 20:36614592-36614614 GATGTAGTCAAAGGTCTTTCTGG 0: 1
1: 0
2: 0
3: 7
4: 134
1172668104_1172668108 4 Left 1172668104 20:36614565-36614587 CCCCAAGCTATTGGTTTCATGGA 0: 1
1: 0
2: 1
3: 11
4: 146
Right 1172668108 20:36614592-36614614 GATGTAGTCAAAGGTCTTTCTGG 0: 1
1: 0
2: 0
3: 7
4: 134
1172668105_1172668108 3 Left 1172668105 20:36614566-36614588 CCCAAGCTATTGGTTTCATGGAG 0: 1
1: 0
2: 0
3: 6
4: 141
Right 1172668108 20:36614592-36614614 GATGTAGTCAAAGGTCTTTCTGG 0: 1
1: 0
2: 0
3: 7
4: 134
1172668106_1172668108 2 Left 1172668106 20:36614567-36614589 CCAAGCTATTGGTTTCATGGAGA 0: 1
1: 0
2: 1
3: 9
4: 145
Right 1172668108 20:36614592-36614614 GATGTAGTCAAAGGTCTTTCTGG 0: 1
1: 0
2: 0
3: 7
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172668108 Original CRISPR GATGTAGTCAAAGGTCTTTC TGG Intronic
900793763 1:4695333-4695355 GAAGTGGTCAAAGGTTTTGCGGG + Intronic
902788750 1:18750633-18750655 GATGCACACAAAGGTCTTTGGGG - Intergenic
908887733 1:68809565-68809587 GATGTAAACAAAGGACTTTAGGG - Intergenic
911546806 1:99226982-99227004 GATGAAGTCAAAGGAAATTCAGG - Intergenic
914676158 1:149908947-149908969 GATGTGGTCCAAGGTCCTCCTGG - Intronic
915863564 1:159473732-159473754 GATGTAGTCATATTTCTTTGTGG + Intergenic
918146657 1:181762590-181762612 GATGAAGTCAAAGATATTCCAGG - Exonic
1063915667 10:10879536-10879558 GATTTAATCACAGGACTTTCTGG - Intergenic
1065707755 10:28486757-28486779 TATCTCATCAAAGGTCTTTCAGG + Intergenic
1065851693 10:29795526-29795548 GTTATAGTCAAAAGTCTTTCTGG + Intergenic
1072463994 10:95646374-95646396 CAGGTAGTCAAGGGTCATTCTGG + Intronic
1072793934 10:98339789-98339811 GATGTCTTACAAGGTCTTTCAGG - Intergenic
1073532660 10:104246215-104246237 GATGTGTTCAGAGTTCTTTCTGG - Intronic
1075103965 10:119524896-119524918 GGTTTATTCAAAGGCCTTTCCGG - Intronic
1077759717 11:5080126-5080148 TATGTAACCAATGGTCTTTCAGG - Intergenic
1078626363 11:12962419-12962441 GATGTGGGCAAAGGGCGTTCAGG + Intergenic
1081444446 11:43116947-43116969 GATGTAGACCAAGCTCTATCCGG - Intergenic
1084261439 11:67981346-67981368 GGTGATGTCAAGGGTCTTTCTGG + Intergenic
1087834578 11:102859888-102859910 GATGTAGCTAAAGGGATTTCAGG - Intergenic
1088819891 11:113448074-113448096 AATGTAGTCAGAGGACCTTCAGG + Intronic
1088908670 11:114173750-114173772 GATGTAATCAAAGGACTTTTTGG + Intronic
1098733363 12:74066189-74066211 GATGTAGCCAAAGGTTTCGCTGG + Intergenic
1103852838 12:123944295-123944317 GGTGAAGTCATGGGTCTTTCTGG + Exonic
1104269923 12:127273795-127273817 GATTTAGACTAAGGTGTTTCTGG + Intergenic
1104829927 12:131743477-131743499 CATGGAGTCAAAGGTCATTTTGG - Intronic
1106897563 13:34321056-34321078 GATGTAGTATAAGGTGTTTTGGG - Intergenic
1110529956 13:76585279-76585301 AATATTGTCAAATGTCTTTCTGG - Intergenic
1114526795 14:23371574-23371596 GATGAAGTCAAAGGGCAATCTGG - Intergenic
1114827209 14:26095344-26095366 GATGTATGCAAAGTTCTTGCTGG - Intergenic
1115962473 14:38851182-38851204 GATGTTGTCAAATATTTTTCTGG - Intergenic
1116433021 14:44868029-44868051 GAGGTTGTCAAAGGTCTTCTAGG + Intergenic
1117323230 14:54644014-54644036 GAAGCAGTCAAAGGTCATTTGGG + Intronic
1120026026 14:79585253-79585275 GGTGAAGACAAAGATCTTTCTGG - Intronic
1120072141 14:80115710-80115732 GATGTACTCAAAGAACTTTTGGG + Intergenic
1121036324 14:90706712-90706734 GATGTAGGTAAAGGTGTTCCAGG + Intronic
1121986536 14:98512231-98512253 GAGGTAGTCATATTTCTTTCTGG + Intergenic
1122074331 14:99226182-99226204 CATGTAGGAAAAGGGCTTTCAGG - Intronic
1124027968 15:25984190-25984212 GATGAATTCAAAGGTCCTTTTGG + Intergenic
1127975732 15:63995947-63995969 GAGGTAGACAAACATCTTTCTGG - Intronic
1130314172 15:82781082-82781104 CATGTAGTAAATGGTCTTTTGGG + Intronic
1130509586 15:84578134-84578156 CATGTAGTCAAAGACCTTGCTGG + Intergenic
1134139626 16:11706739-11706761 GATGGAGTTTCAGGTCTTTCAGG - Intronic
1138754372 16:59465374-59465396 GATGCAGTCTAAGCTCTTTATGG - Intergenic
1142534224 17:602688-602710 GATGTAGTCACAGGACTATCTGG + Intronic
1144064499 17:11612359-11612381 GGTCTGGTCAAAGGTCTTTCTGG + Intronic
1151547978 17:74805139-74805161 GAGGTAGTAAAAGGTCTCCCGGG + Intronic
1155820353 18:30367971-30367993 GAAGTATTCAAAAGGCTTTCAGG - Intergenic
1156854285 18:41764419-41764441 GATGAAGTCACAGGGCTTTGAGG + Intergenic
1158675099 18:59511370-59511392 GATGTGGGCAAGGGCCTTTCAGG - Intronic
1158821707 18:61166982-61167004 GATGTAGTCAAAACACTTTTGGG - Intergenic
1158925259 18:62251242-62251264 GCTGTAGTCAAAGGTCCGTTGGG + Intronic
1164367280 19:27599529-27599551 AATTTTGTCAAAGGTCTTTTCGG - Intergenic
1164548051 19:29185469-29185491 GGTGGTTTCAAAGGTCTTTCTGG - Intergenic
925537931 2:4936240-4936262 GATCCAATCAAAGGTCTTTAGGG - Intergenic
925788726 2:7459442-7459464 AATGTAATCAAAGGACTTTGGGG + Intergenic
928684744 2:33737029-33737051 AGTGTAGTCAAGTGTCTTTCTGG + Intergenic
929734661 2:44534623-44534645 CATTTAGTCAATGGTCATTCAGG - Intronic
935454788 2:103254698-103254720 CAAGTATTCAAAGGGCTTTCAGG + Intergenic
935469396 2:103438849-103438871 GATGTTGTCAAAGGAATTCCTGG + Intergenic
936002454 2:108847164-108847186 GATGTAGGCAAAGGTTGTTATGG - Intronic
936617430 2:114062204-114062226 CATTTAGTAAAAGGTGTTTCTGG + Intergenic
936846337 2:116839559-116839581 CATGTAGTAACAGTTCTTTCTGG + Intergenic
938754537 2:134367654-134367676 GATCTCATCAGAGGTCTTTCAGG + Intronic
940837693 2:158543021-158543043 AATGTAGTAAAAAATCTTTCAGG + Intronic
943504891 2:188742532-188742554 AATGTAGTTACAGGTTTTTCTGG - Intronic
944748764 2:202685865-202685887 GGAGTAGGCAAAGGTCTTTTAGG + Intronic
945509355 2:210681808-210681830 TATGTAATGAAAGGTCTTTGTGG - Intergenic
946629562 2:221652262-221652284 GATGCAGTCAAGAGTGTTTCTGG - Intergenic
947779925 2:232750296-232750318 GCTGTAGCCAAAGGTCTTCCTGG + Intronic
1169763658 20:9125066-9125088 GATGGAGTCAAGCGTATTTCAGG - Intronic
1172668108 20:36614592-36614614 GATGTAGTCAAAGGTCTTTCTGG + Intronic
1177913253 21:27056770-27056792 GCTGTAGTCAATGGTTTGTCTGG + Intergenic
1179076895 21:38130669-38130691 GATGTCGCCAAAAGCCTTTCTGG - Intronic
1180685615 22:17664305-17664327 CATGGAGTCAAAGGTCATTTTGG - Intronic
1182249431 22:28988401-28988423 CCTGGAGCCAAAGGTCTTTCAGG - Intronic
952664042 3:35882508-35882530 GATGTAGGCAAAGGACAATCAGG - Intergenic
954569018 3:51625081-51625103 TATGTAGTCAAGTGTCTTTGGGG - Intronic
960024108 3:112988785-112988807 GATGTTGTGACAGGACTTTCTGG - Intergenic
961662720 3:128478429-128478451 AATGTAGTCACTGGTGTTTCTGG - Intergenic
963736933 3:149028505-149028527 TAGCTAGTCAGAGGTCTTTCTGG + Intergenic
963773614 3:149415921-149415943 AATGTAGATAAAGGTCTTCCTGG + Intergenic
965166469 3:165198677-165198699 GATGTTGCCCAATGTCTTTCAGG - Intergenic
965696114 3:171410098-171410120 GATGTTATCAAAGTTCTTTTAGG - Intronic
966018030 3:175167355-175167377 TATGTAGTCAGAAGTCATTCAGG - Intronic
966209360 3:177436802-177436824 GAAGTAGTCAGAGCTCTTCCTGG + Intergenic
969430572 4:7151507-7151529 GATGAAACCACAGGTCTTTCTGG + Intergenic
972704487 4:41528553-41528575 GATGTATTCAGAAGTATTTCAGG - Intronic
973062971 4:45752500-45752522 GAAGTAGTCAGTAGTCTTTCAGG + Intergenic
975679117 4:76858110-76858132 GTTGTATTCAGAGGTCTTTATGG - Intergenic
976965031 4:91027531-91027553 GATGAAGTGAAATGTCTTTTTGG + Intronic
977494488 4:97758115-97758137 GAGGTAGTGACAGGTATTTCAGG + Intronic
977805967 4:101298222-101298244 GATGTAGCCCAATGTCATTCAGG + Intronic
979425481 4:120559814-120559836 GAGGTAGTCAAAGATTTTTAAGG + Intergenic
979556959 4:122058781-122058803 GATGTAATCTCAGTTCTTTCTGG + Intergenic
982488346 4:155997166-155997188 GATGCAGCCAAAGGTGTTACAGG + Intergenic
983629015 4:169830438-169830460 TATGTACTCAAAAGTCATTCAGG - Intergenic
986530791 5:8734768-8734790 AATTTTGTCAAAGGTCTTTTTGG - Intergenic
992162795 5:74018674-74018696 GATGAAGTCAAAGGTTGGTCAGG + Intergenic
994422571 5:99539581-99539603 GGTGTAGGCAAAGGTGTTTTGGG - Intergenic
995390697 5:111637666-111637688 CATCTAGTCAAAGGTATTCCTGG + Intergenic
995672021 5:114615837-114615859 TATTTAGTCAAAAGTCATTCAGG - Intergenic
995732230 5:115257760-115257782 GATGTAGTCATAGGCCCATCTGG - Intronic
997404517 5:133634263-133634285 GATGGGGTCACAGGTCTTTCTGG + Intergenic
997499796 5:134364460-134364482 GAAGGAGTCAAAGGTCTCTGAGG - Intronic
997820047 5:137056963-137056985 GATGTAGTAGCAGGTCTTCCTGG - Intronic
1001846518 5:174926730-174926752 CATGTAGTCAAAGACCTTGCTGG + Intergenic
1003938584 6:11001442-11001464 TATGTAGTTTAAGGTCTTTCTGG - Intronic
1004420873 6:15468803-15468825 GATGAAGGCAAAGCTCGTTCTGG + Intronic
1004540138 6:16541934-16541956 GAAGTAACCAAAGGACTTTCTGG + Intronic
1005576306 6:27192797-27192819 GTTGTAGCCACAGGTTTTTCAGG - Intergenic
1015961307 6:138652043-138652065 GATGAAGTGAAAGTTCTTTAAGG - Intronic
1023025724 7:36048126-36048148 GATATTGTCAAAGTTGTTTCAGG - Intergenic
1026390443 7:69896307-69896329 GATGTGGTGAAAAGTGTTTCAGG - Intronic
1029915438 7:104204873-104204895 AATATTGTCAAAGGTCTCTCTGG + Intronic
1030807354 7:113933984-113934006 TATGTACTCAAAAGTCATTCAGG + Intronic
1031281458 7:119806584-119806606 GATATATTCAAAAGTTTTTCAGG + Intergenic
1031509168 7:122626855-122626877 AATTTGGTCACAGGTCTTTCTGG + Intronic
1032603340 7:133323431-133323453 AATTTTGTCAAAGGCCTTTCTGG + Intronic
1032644289 7:133805038-133805060 GATGTAGTGTTAGGTGTTTCAGG + Intronic
1034892992 7:154857123-154857145 AATGTAGTTCAAGCTCTTTCAGG + Intronic
1036143912 8:6235145-6235167 GAAGTAGTCACATGTATTTCAGG - Intergenic
1037390261 8:18385950-18385972 GATGTTCTCAAAAGTCTCTCTGG - Intergenic
1038450492 8:27636175-27636197 GATGTGGTCCAAGACCTTTCTGG - Intronic
1040642958 8:49361950-49361972 GATGTGGGCAAAGATTTTTCAGG - Intergenic
1043025419 8:75061411-75061433 GATGGATTAAAAGGTATTTCTGG - Intergenic
1045701794 8:104875254-104875276 GATGTTGACAAAAGCCTTTCTGG - Intronic
1046608632 8:116399267-116399289 AATGTTGTCAAAGGTTTTTTTGG - Intergenic
1046697012 8:117352366-117352388 CATGTAGTATAATGTCTTTCAGG - Intergenic
1046913929 8:119659526-119659548 GATGTAGTCAAAGTCCTGGCAGG - Intronic
1048193250 8:132309531-132309553 GATGTAGTCCAGGGTGTTTGGGG - Intronic
1049167448 8:141135472-141135494 CAGGTAGTCAAGGGTCTTTAAGG - Intronic
1051981846 9:23029692-23029714 GTTGTTCTCAAAGTTCTTTCAGG + Intergenic
1052277059 9:26688592-26688614 GAAGCAGTCAAAGCTCTTTGGGG - Intergenic
1055675793 9:78659093-78659115 GATGTAGTCCAAGGTTTGTTTGG + Intergenic
1056680252 9:88711268-88711290 GAGGAAGACAAAGGTTTTTCTGG + Intergenic
1057867682 9:98694072-98694094 GGAGAAGTCAAAGCTCTTTCTGG + Intronic
1187944863 X:24416132-24416154 GATGGAGTCAAAGATTATTCTGG + Intergenic
1188052908 X:25509098-25509120 CATGGAGTCAAAGATCATTCTGG - Intergenic
1188820335 X:34767243-34767265 GATGTAATCAAACATATTTCAGG + Intergenic
1189896225 X:45659150-45659172 CATGTAGTCAAAGATCATTTTGG + Intergenic
1191756162 X:64594671-64594693 GATAGAGTCAAAGGTCTCTGAGG - Intergenic
1197269046 X:124406030-124406052 GCTGTTTGCAAAGGTCTTTCAGG - Intronic