ID: 1172669484

View in Genome Browser
Species Human (GRCh38)
Location 20:36625054-36625076
Sequence CATGCTGGACACTCTGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 272}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172669478_1172669484 22 Left 1172669478 20:36625009-36625031 CCTGCTCATTCATTTATTCAGTA 0: 1
1: 0
2: 8
3: 106
4: 699
Right 1172669484 20:36625054-36625076 CATGCTGGACACTCTGCTCTGGG 0: 1
1: 0
2: 0
3: 18
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172669484 Original CRISPR CATGCTGGACACTCTGCTCT GGG Intronic
901701606 1:11047362-11047384 CAGGCAGGACAGGCTGCTCTGGG + Intergenic
901808679 1:11753464-11753486 CATGTTGGCCAGGCTGCTCTTGG + Intronic
903210484 1:21815355-21815377 CATGCTGGCTGCTCTGCGCTGGG + Intronic
903397791 1:23015232-23015254 CATGTTGGCCAGTCTGGTCTGGG - Intronic
903463098 1:23532878-23532900 CATGTTGGCCACGCTGGTCTCGG + Intergenic
903709756 1:25314705-25314727 CATGTTGGACAGGCTGATCTTGG + Intronic
903803821 1:25989973-25989995 CATCCAGGCCACTCTGCTCTAGG + Intronic
903996103 1:27306415-27306437 CTGGCTGGACCCTCTGCCCTGGG + Exonic
904418882 1:30378880-30378902 CCTGCTGGACACTGGGCTCCAGG + Intergenic
904541719 1:31238341-31238363 CATGCTGGACTCCTTGTTCTGGG - Intronic
905335812 1:37243865-37243887 CATGATGGCCACTCAGCCCTCGG - Intergenic
905729305 1:40285306-40285328 CATGTTGGTCAGTCTGGTCTCGG + Intronic
908228826 1:62084050-62084072 CATGCTGGCCAGGCTGGTCTCGG - Intronic
909287556 1:73838915-73838937 TGTGATGGACACTCTGCTCCAGG + Intergenic
913074321 1:115328561-115328583 AATGTTAGACTCTCTGCTCTGGG + Intronic
913595328 1:120370467-120370489 CATGGTGGACCTTCTGTTCTGGG - Intergenic
914091945 1:144508506-144508528 CATGGTGGACCTTCTGTTCTGGG + Intergenic
914306591 1:146425358-146425380 CATGGTGGACCTTCTGTTCTGGG - Intergenic
914421132 1:147529297-147529319 CATGTTGGCCAGGCTGCTCTTGG - Intergenic
914595458 1:149147442-149147464 CATGGTGGACCTTCTGTTCTGGG + Intergenic
915470034 1:156120400-156120422 CAGCCTGGAAACTCTGCTCTGGG + Intronic
916586539 1:166154470-166154492 CAGGCTGGACTCTCTGCTCCTGG + Intronic
916814235 1:168336464-168336486 CATGTTGGACAAGCTGGTCTTGG + Intergenic
916860325 1:168796928-168796950 CATGCTGGCCAGGCTGGTCTCGG - Intergenic
918179341 1:182072694-182072716 AATGCTGGGCACTCTGCCCAAGG - Intergenic
919631358 1:199963134-199963156 CATGCTGGCCAGGCTGGTCTCGG - Intergenic
920846922 1:209601512-209601534 CATGCTGGAGACACAGGTCTAGG + Intronic
921163475 1:212489159-212489181 CATGTGGGCCACTCTGGTCTGGG - Intergenic
921925485 1:220707183-220707205 CTTTCTGAACACTCTGCTCCAGG - Intergenic
922297630 1:224265300-224265322 CATGCTGGCCAGCCTGGTCTCGG - Intronic
922512649 1:226182410-226182432 CATGTTGGCCAGTCTGGTCTTGG - Intronic
923050690 1:230389372-230389394 CATGTTGGCCAGTCTGGTCTCGG + Intronic
924409097 1:243784678-243784700 CACGCTGGACACTGCTCTCTGGG + Intronic
1064246522 10:13671974-13671996 CCTGCTGGGCACTCAGCCCTGGG - Intronic
1065487944 10:26252857-26252879 CATGCTGGTCAGGCTGCTCTCGG + Intronic
1066215135 10:33279256-33279278 CTTGCTGGATTCTCTGCTCAGGG + Intronic
1066699655 10:38113522-38113544 CATGCAGGCCATGCTGCTCTTGG - Intronic
1067138198 10:43630336-43630358 CAAGCTGGGAACTCTGCTCAGGG - Intergenic
1067202371 10:44184563-44184585 CATGGTGAAGACTCTGCTCTGGG - Intergenic
1067291485 10:44946635-44946657 CCTTATGGAAACTCTGCTCTAGG - Intergenic
1067376608 10:45733122-45733144 CCTCCTGGACCCTCTGCACTAGG + Intronic
1067884302 10:50073813-50073835 CCTCCTGGACCCTCTGCACTAGG + Intronic
1070319053 10:75340802-75340824 CATGTTGGTCACGCTGGTCTCGG + Intergenic
1070638105 10:78145465-78145487 CATGCTGGAGACAGTCCTCTGGG + Intergenic
1071562440 10:86654878-86654900 CAGGCTGGAGATGCTGCTCTGGG - Exonic
1071888675 10:89978697-89978719 CATGATGGTCACTACGCTCTCGG - Intergenic
1074051969 10:109888300-109888322 CATCCTGCACACCCAGCTCTGGG - Intronic
1074110218 10:110417570-110417592 CTTGCTGGGCACTCTTCTCAGGG - Intergenic
1075158131 10:119997716-119997738 TTTGCTGGACACTTTGCTCAGGG + Intergenic
1076798751 10:132811137-132811159 CACGCTGGCCACTCAGCTCCGGG + Intronic
1077096010 11:799450-799472 CCTGCCGGTCACTCTGCTCCAGG + Exonic
1080690024 11:34548761-34548783 CATGCCGCACACTCTGCTTCAGG + Intergenic
1080943637 11:36947137-36947159 CATGCTGGCCAGGCTGGTCTTGG - Intergenic
1081491757 11:43574987-43575009 CAAGCCGGACACTCCCCTCTGGG + Intronic
1083236221 11:61352456-61352478 CATGCTGGGCAGGCTGGTCTCGG - Intronic
1083262914 11:61532818-61532840 CATGGTGGCCACTCGGCGCTTGG - Intronic
1083811781 11:65110516-65110538 CTTGCTGGAGTCGCTGCTCTGGG - Exonic
1083854862 11:65387961-65387983 CATGTTGGTCAGGCTGCTCTTGG - Intronic
1086398533 11:86441865-86441887 CAGCCTGGACACTGTTCTCTGGG + Intronic
1088644231 11:111903857-111903879 CATGCTTGCCCCTCTGCCCTAGG - Intergenic
1089227357 11:116936852-116936874 CATGCTGTACACTTTGCTCAGGG + Intronic
1089313972 11:117578031-117578053 CATGCTGGTCAGGCTGGTCTCGG - Intronic
1090077948 11:123591205-123591227 CATGCTGGGCATGCAGCTCTAGG + Intronic
1090263718 11:125341153-125341175 CATGCTGGCCAGGCTGGTCTCGG - Intronic
1090417393 11:126549960-126549982 CATGCTGGACACTCCTCTCCTGG + Intronic
1091331110 11:134731512-134731534 CCTGCTGGACTGTCGGCTCTGGG + Intergenic
1092247656 12:6872592-6872614 CATGCGTGCCCCTCTGCTCTAGG + Exonic
1094558695 12:31528957-31528979 CATGTTGGCCAGGCTGCTCTTGG - Intronic
1095131006 12:38542461-38542483 AAAGCTGGAGACTCTCCTCTGGG - Intergenic
1096057991 12:48671061-48671083 CATGTTGGCCAGGCTGCTCTCGG - Intronic
1096815421 12:54198877-54198899 CTTGCTGGCTATTCTGCTCTGGG - Intergenic
1098358713 12:69634843-69634865 CATGCTGGCCAGGCTGGTCTTGG + Intergenic
1101746108 12:107543132-107543154 CATGTTGGCCAGGCTGCTCTTGG - Intronic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1103155255 12:118679360-118679382 CATGTTGGCCAGTCTGGTCTTGG + Intergenic
1105967380 13:25397078-25397100 CTTGCTGGACATCCTGTTCTAGG + Intronic
1106406990 13:29483065-29483087 CATGGTGGACTCTCCACTCTTGG + Intronic
1106409639 13:29502479-29502501 CCTGCTGGAAATGCTGCTCTAGG - Intronic
1106543963 13:30714627-30714649 CAGGCTGGAGACTATGCGCTAGG - Intronic
1107292082 13:38866291-38866313 CATGTTGGTCAGGCTGCTCTTGG - Intronic
1108223499 13:48263423-48263445 CATGCTGGAAACTGTGGTCTTGG + Exonic
1108971987 13:56388113-56388135 CGTGCTTGAAACTCTGCGCTTGG + Intergenic
1109145079 13:58769421-58769443 CATGCTGCCCAGTCTGGTCTTGG + Intergenic
1110062469 13:71060487-71060509 CATGCTGGCCAGGCTGGTCTCGG - Intergenic
1112308020 13:98292856-98292878 CCTGCTGGTAACTCTGGTCTAGG + Intronic
1113561694 13:111286662-111286684 CTTGCTGGTCTCTCTGCTGTTGG + Intronic
1113892571 13:113744084-113744106 CATGCTGGAGAATCTACTGTGGG + Intergenic
1118043175 14:61938931-61938953 CATGCTGGCCAGGCTGGTCTCGG - Intergenic
1118280439 14:64423595-64423617 CATGCTGGCCAGGCTGGTCTCGG + Intronic
1119176848 14:72574798-72574820 CACACTGCACACTCTGCTCATGG - Intergenic
1119394826 14:74318611-74318633 CATGCTGGCCAGGCTGGTCTCGG + Intronic
1119514527 14:75237528-75237550 CAGGCTCGACACTCTGCCATCGG - Intergenic
1119625517 14:76171371-76171393 CATGTTGGCCACGCTGGTCTTGG - Intronic
1121085968 14:91146368-91146390 CATGCTGGAAATTGTGCTCAGGG - Intronic
1121466637 14:94119723-94119745 CAGGGTGGTGACTCTGCTCTGGG - Intergenic
1121922056 14:97891098-97891120 CATGTTGGCCAGTCTGGTCTTGG + Intergenic
1122171194 14:99877113-99877135 CATGCTGGCCCCCCTGGTCTCGG - Intronic
1125804076 15:42477686-42477708 CATGTTGGTCACGCTGGTCTTGG - Intronic
1127324605 15:57883057-57883079 CATTATGAACACTCTGCTGTGGG + Intergenic
1128477761 15:68012037-68012059 CATGTTGGCCAGTCTGGTCTCGG + Intergenic
1129804622 15:78445337-78445359 CATGCTGGCCAGGCTGGTCTCGG + Intronic
1130091453 15:80824489-80824511 GATGCTGGAGACTGTCCTCTTGG - Intronic
1133129395 16:3667183-3667205 CAGCCTGGACACCCTTCTCTGGG - Intronic
1133277534 16:4647881-4647903 CATGCTGGGCACCTGGCTCTGGG + Intronic
1135130173 16:19847167-19847189 GATGCTGGACACTAGGCTCAGGG - Intronic
1135682602 16:24471001-24471023 CATGCTGGCCAGGCTGGTCTTGG - Intergenic
1135990720 16:27217079-27217101 CATGGTAGACACTCAGCTCTGGG - Intronic
1136233353 16:28900610-28900632 CATGCTGGACCCTCCGCGCAAGG + Exonic
1137551367 16:49439901-49439923 CATGCTGGTGGCTCTGCTCCTGG + Intergenic
1137569090 16:49552970-49552992 CCTGCTGGTGACTCTGCCCTGGG - Intronic
1137797253 16:51232450-51232472 CATGTTGGCCAGTCTGGTCTTGG + Intergenic
1138519411 16:57562575-57562597 CATGCCTGACACTAGGCTCTGGG + Intronic
1139869101 16:70089674-70089696 CATGTTGGCCACGCTGGTCTTGG + Intergenic
1141080586 16:81048191-81048213 CAACCTGGACCCACTGCTCTAGG + Intergenic
1141661171 16:85442390-85442412 CCTGCTGGACACCCAGCGCTGGG - Intergenic
1142192732 16:88725370-88725392 CATGCTGGACACGGGGCCCTGGG + Intronic
1142914335 17:3123507-3123529 CATGTTGGACAGGCTGGTCTTGG - Intergenic
1143050333 17:4120153-4120175 CATGTTGGCCAGGCTGCTCTTGG - Intronic
1143641883 17:8203636-8203658 CATGTTGGCCAGGCTGCTCTCGG - Intergenic
1143809294 17:9457819-9457841 CATGAAGGAAAATCTGCTCTAGG - Intronic
1144479624 17:15618124-15618146 CATGCTGGCCAGGCTGGTCTCGG - Intronic
1144662984 17:17083403-17083425 CCTCCTGGACACTCTCCTATAGG - Intronic
1144918679 17:18745615-18745637 CATGCTGGCCAGGCTGGTCTCGG + Intronic
1144934525 17:18887437-18887459 CATGCTGGCCAGGCTGGTCTTGG + Intronic
1148098926 17:45075280-45075302 CATGTTGGCCAGTCTGGTCTTGG - Intronic
1148800210 17:50220468-50220490 CATTCTGGACACTGTCCTTTAGG - Intergenic
1150583707 17:66498598-66498620 CTTCCTGGACATTCTGCTGTGGG + Intronic
1151960152 17:77401542-77401564 CATGTTGGTCAGTCTGGTCTCGG - Intronic
1152459322 17:80432949-80432971 CATCCTGGACACCAGGCTCTGGG - Intronic
1152730094 17:81965908-81965930 CAAGCTGGCCACTCCGCTCACGG - Intergenic
1152792492 17:82288989-82289011 CATCCTGGACACTCAGTCCTCGG - Intergenic
1160542076 18:79629325-79629347 AATGCCGGACACTGTTCTCTGGG - Intergenic
1160679714 19:407137-407159 CAAGCGGGACACGCTGCTCGGGG - Exonic
1163606787 19:18280233-18280255 CAAGCTGGACCCCCTGCTCCCGG - Exonic
1163638235 19:18447475-18447497 CATCATGGACACTTTGCTCATGG - Intronic
1163791545 19:19309281-19309303 CATGTTGGTCACGCTGGTCTTGG - Intronic
1163877717 19:19888263-19888285 CATGTTGGCCACGCTGGTCTTGG + Intronic
1164258289 19:23548416-23548438 CATGCTGGACATAGAGCTCTGGG + Intronic
1164842236 19:31401217-31401239 CATGGTGTAGACTCTGTTCTGGG + Intergenic
1165412271 19:35669461-35669483 CATGTTGGCCAGTCTGGTCTTGG - Intronic
1167941741 19:52952460-52952482 CATGCTGACCATTCTGCTCAGGG + Intronic
1168020183 19:53603456-53603478 CATGCTGGGGATTCTGCTTTGGG + Exonic
925604015 2:5639827-5639849 CATGGTGGACCTTCTGTTCTGGG - Intergenic
926751112 2:16199245-16199267 CATACTGAACAATGTGCTCTGGG - Intergenic
926792539 2:16589105-16589127 GATGCTGGGCACTGTGTTCTTGG + Intronic
927157910 2:20232225-20232247 CATGTTGGCCAGGCTGCTCTTGG + Intergenic
927937287 2:27083001-27083023 CATGCGGGCAGCTCTGCTCTGGG + Exonic
928195519 2:29214039-29214061 CATGCTGGACCTTCTGCACGTGG - Exonic
929214841 2:39401295-39401317 CTTTCTGGTGACTCTGCTCTAGG - Intronic
930082798 2:47467644-47467666 CATGTTGGACAGGCTGGTCTCGG + Intronic
930728936 2:54709366-54709388 CCTGCTGCTCACTCTGATCTCGG + Intergenic
932424690 2:71621860-71621882 CATGTTGGCCAGTCTGGTCTCGG + Intronic
934852713 2:97711683-97711705 CATGCTGGACGCTCATTTCTTGG - Intergenic
934956652 2:98627575-98627597 CATGCTGGCCAGGCTGGTCTTGG + Intronic
936573061 2:113632497-113632519 CATGTTGGCCAGGCTGCTCTCGG + Intronic
936968064 2:118146665-118146687 CATGCTGGAACCTCGGCCCTTGG + Intergenic
937373548 2:121319546-121319568 CAGGCTGGAGACTGAGCTCTGGG - Intergenic
938198322 2:129352397-129352419 CATGCTACTGACTCTGCTCTGGG + Intergenic
938211157 2:129466642-129466664 CATGGTGGACACGCTCCTGTGGG - Intergenic
939586800 2:144015535-144015557 CATGCTGGGCTCTCTGTTATTGG + Intronic
939772332 2:146336602-146336624 CATGATGGAAACTCTATTCTAGG - Intergenic
941944168 2:171076405-171076427 GATGCTTGACACCATGCTCTTGG + Intronic
944678530 2:202054781-202054803 CATGCAGGGCACACAGCTCTTGG - Intergenic
944790794 2:203123533-203123555 CATGTTGGACAGACTGGTCTCGG + Intronic
945880543 2:215320780-215320802 CATGTTGGTCAGGCTGCTCTTGG + Intronic
945963157 2:216157034-216157056 GTTGCTGGGCACACTGCTCTCGG - Intronic
946472734 2:219977705-219977727 CATTCTGGCCACTCTGCTGGAGG + Intergenic
947467942 2:230370847-230370869 CATGCTGGTCGCTCTGCTCCCGG - Intronic
948415055 2:237797069-237797091 AAGGCTGGACACTCTCCCCTGGG - Intronic
1169483937 20:6010475-6010497 CCTGCAGAATACTCTGCTCTGGG + Intronic
1169611855 20:7389941-7389963 CATGCTGGAATCTGTGATCTAGG - Intergenic
1172049903 20:32109581-32109603 CCTGCTCGACAGTCTGGTCTGGG - Exonic
1172669484 20:36625054-36625076 CATGCTGGACACTCTGCTCTGGG + Intronic
1172731626 20:37093840-37093862 CATGCTGGCCAGGCTGGTCTTGG + Intronic
1172802300 20:37584717-37584739 CATGCACCACATTCTGCTCTGGG - Intergenic
1173137252 20:40449450-40449472 CAATCTGGAAACACTGCTCTAGG - Intergenic
1173589809 20:44215948-44215970 CATGTTGGCCAGGCTGCTCTCGG + Intergenic
1173721780 20:45264970-45264992 TATGCTGGACACTGTGCTAAAGG + Intergenic
1173775824 20:45705356-45705378 CATGCTGGGTATTCTGCTCATGG - Intronic
1174785799 20:53431253-53431275 CATGCTGGCCAGGCTGGTCTAGG - Intronic
1178283949 21:31309254-31309276 CATGTTGGCCACGCTGGTCTTGG - Intronic
1178923085 21:36752326-36752348 TATTCTGGACACTCTGCTTTGGG - Exonic
1180995713 22:19964275-19964297 CCTGCCGGACACGCTTCTCTTGG + Exonic
1181475085 22:23163110-23163132 CATGTTGGTCAGGCTGCTCTCGG + Exonic
949736264 3:7175462-7175484 CATGCTCTATACTCTGCTTTAGG - Intronic
950615558 3:14155164-14155186 CATGCTGGACCCTCTCTTCAGGG - Intronic
951962162 3:28339177-28339199 CATGTTGGCCAGTCTGGTCTTGG + Intronic
952613044 3:35234356-35234378 CATGTTGGCCAGTCTGGTCTCGG - Intergenic
952998496 3:38908364-38908386 CATACTGGACACTGTGCTAAGGG - Intronic
953122960 3:40063965-40063987 CCTGCTGTACACTCTTCTCATGG - Intronic
955284073 3:57621972-57621994 CATGTTGGCCAGGCTGCTCTTGG - Intergenic
955465891 3:59236955-59236977 CATCCTTGTCACTCTACTCTGGG - Intergenic
955709311 3:61762145-61762167 CATGGTCCACACTCTCCTCTTGG + Intronic
956713298 3:72057203-72057225 CATGCTGGGCACACTGGTATGGG - Intergenic
957572777 3:81969744-81969766 CATGTTGGCCAGACTGCTCTCGG + Intergenic
958878117 3:99638472-99638494 GGAGCTGGACACTCTTCTCTGGG - Exonic
958955600 3:100463092-100463114 CATTCTGGTTACTCTACTCTAGG + Intergenic
961001436 3:123376680-123376702 CACGCCAGCCACTCTGCTCTGGG - Intronic
961040469 3:123674756-123674778 CATGCTGGGCCCTCTTCTCTTGG + Intronic
962644266 3:137420393-137420415 CCTCCTGGACACACTGCTATGGG + Intergenic
963104480 3:141635030-141635052 CATGTTGGTCAGGCTGCTCTCGG + Intergenic
966650662 3:182297200-182297222 CTTGAGGGACAGTCTGCTCTGGG - Intergenic
967353503 3:188541693-188541715 CATGTTGGCCAGTCTGGTCTTGG - Intronic
967887378 3:194342288-194342310 CATGCTGGAGGCTCTGCCCGAGG - Exonic
968149689 3:196327404-196327426 CATGCTGGGAACTGGGCTCTGGG - Exonic
969910821 4:10444040-10444062 CTTCCTGGCCACTCTGCTTTTGG + Exonic
970453009 4:16190538-16190560 CATGTTGGCCAGTCTGGTCTTGG + Intronic
971327156 4:25654135-25654157 CGTGCTGCACACACTGCTGTCGG - Intergenic
972395549 4:38656251-38656273 CAGGGTGTACACTGTGCTCTAGG - Intergenic
974019186 4:56677898-56677920 CACACTGGGCACTCTGTTCTGGG - Intronic
980105362 4:128583209-128583231 CATGTTGGCCAGTCTGGTCTGGG + Intergenic
981456053 4:144954326-144954348 GATGCTGGCCAGCCTGCTCTGGG - Intergenic
981992159 4:150934669-150934691 CATGTTGGCCACACTGGTCTCGG - Intronic
982508643 4:156252106-156252128 CATTCAGGTCACTCTGCTCTGGG + Intergenic
983819360 4:172173422-172173444 CAAGCTGCACCCTCTGGTCTAGG - Intronic
984386210 4:179061180-179061202 CTTGCTTGACATTCTGTTCTTGG - Intergenic
985680528 5:1253508-1253530 TGTGCTGGACACTCAGCCCTTGG + Exonic
985776501 5:1846906-1846928 CAAGCTGGGCCCTCTGCTCGGGG - Intergenic
986830652 5:11573516-11573538 TTTGTTGGACACTCTGCTGTAGG - Intronic
987140196 5:14938054-14938076 CATGTTGGCCACGCTGGTCTTGG - Intergenic
987320409 5:16763941-16763963 CATGCTGGTCAGGCTGGTCTTGG - Intronic
989702334 5:44284736-44284758 TATGCTGGACACTTTGCTAAAGG - Intergenic
990924938 5:61010172-61010194 CAGGCTTCACACTCTGGTCTTGG + Intronic
993744691 5:91582901-91582923 GTTGCTGGACATTCTACTCTAGG - Intergenic
995022860 5:107385476-107385498 CATGCTGGTCATTCTTCTCGTGG + Intronic
996631661 5:125640013-125640035 CAGGCTGCACCCTCTGATCTTGG - Intergenic
997234805 5:132266588-132266610 CATGCTGGCCCCTCTGCCCTGGG - Intronic
997800379 5:136854774-136854796 TTTTCTGGACACTCAGCTCTGGG + Intergenic
999737554 5:154523956-154523978 CCTGCAGGACACCCTGCCCTGGG + Intergenic
999771507 5:154779707-154779729 CATGTTGGTCAGTCTGGTCTCGG + Intronic
1000317587 5:160107797-160107819 CATATTGGCCACGCTGCTCTTGG - Intronic
1000345427 5:160310315-160310337 CACGTTGGCCACTCTGTTCTGGG + Intronic
1001713838 5:173798634-173798656 CATGCTGACCACCCGGCTCTAGG - Intergenic
1002261268 5:177995429-177995451 CATGGTGGACAGTGAGCTCTAGG - Intronic
1002846979 6:955621-955643 CATGCTGGACACTCCTCTGGAGG - Intergenic
1003652678 6:7975834-7975856 CAGGATGGAAACCCTGCTCTGGG + Intronic
1004275039 6:14228659-14228681 CAAGCTGCACACTCTGATGTGGG + Intergenic
1004308725 6:14524524-14524546 CACCCTGGACACACTGCTTTTGG + Intergenic
1005497945 6:26405208-26405230 CATGCAGGACACTCTTCACTGGG - Intronic
1008176916 6:48279663-48279685 GATGTTGGACACGCTGCTGTGGG + Intergenic
1008911925 6:56743761-56743783 CAAACTGCACTCTCTGCTCTTGG - Intronic
1011858239 6:91722196-91722218 GATTCTCAACACTCTGCTCTTGG + Intergenic
1012089042 6:94868783-94868805 CATTGAGGACACTCTTCTCTTGG - Intergenic
1012178151 6:96115621-96115643 CATACTGGAAACTCTGCTCCAGG + Intronic
1014342209 6:120224418-120224440 CATGTTGGCCAGGCTGCTCTAGG - Intergenic
1016449785 6:144170278-144170300 CATGGTGGAGAATCTGCTATTGG + Intronic
1017110262 6:150925371-150925393 AATGCTGGACTCTTTCCTCTGGG - Intronic
1017187140 6:151613200-151613222 CATGCTGGCCAGGCTGGTCTTGG - Intronic
1018077652 6:160231002-160231024 CATGATGGACACTGAGCTTTGGG + Intronic
1019553109 7:1613559-1613581 CATGTTGGACAGGCTGGTCTTGG - Intergenic
1021503775 7:21358154-21358176 CATGTTGGACAGGCTGGTCTCGG - Intergenic
1023738044 7:43251934-43251956 CAAGCTGGACCCAGTGCTCTGGG + Intronic
1023843831 7:44110322-44110344 GATGCTGGAGTCTCTGCCCTGGG - Exonic
1023970830 7:44989606-44989628 CATGTTGGCCACGCTGGTCTTGG - Intergenic
1025836726 7:65101301-65101323 CATGTTGGACAGGCTGGTCTCGG + Intergenic
1027461645 7:78461708-78461730 CATGTTGGTCAGGCTGCTCTCGG - Intronic
1029368545 7:100132482-100132504 CATGCTGGCCAGGCTGGTCTCGG - Intergenic
1029421794 7:100475834-100475856 CACCCTGGACTCTCTGTTCTTGG - Intronic
1030222204 7:107108967-107108989 CACTCTGCCCACTCTGCTCTGGG - Intronic
1031981721 7:128131445-128131467 CATGCTGAGCACTCAGGTCTTGG + Intergenic
1032465464 7:132141644-132141666 CATTCTGGACACTGCCCTCTGGG - Intronic
1034077615 7:148247853-148247875 CATGCTGGCCAGGCTGGTCTCGG + Intronic
1039247139 8:35621348-35621370 CATGCTAGGTACTCTGCTATGGG - Intronic
1039768950 8:40663212-40663234 CATGCTGATCTCTCCGCTCTAGG + Intronic
1040346301 8:46501051-46501073 CATGTTGGAAACACTGTTCTTGG - Intergenic
1045020939 8:98043909-98043931 CATGCTGGCCAGGCTGGTCTCGG - Intronic
1045660713 8:104434724-104434746 CATGCTAGGTACTGTGCTCTAGG - Intronic
1046651421 8:116840442-116840464 TCTGCTGTACACTCTGCTCAAGG + Intronic
1048076369 8:131075723-131075745 CATGGTGGACACTCAACTCATGG - Intergenic
1051357565 9:16253747-16253769 CAGGCTGGGCTCTGTGCTCTGGG + Intronic
1054772333 9:69094511-69094533 CATGCTGGCCAGGCTGGTCTCGG + Intronic
1056258392 9:84823833-84823855 CTGGCTGGACATTCTGCTCGTGG + Intronic
1056379804 9:86047016-86047038 CCTGCTGGACACCCTGCCCTCGG + Intronic
1056644870 9:88402192-88402214 CATGTTGGCCATTCTGGTCTGGG + Intronic
1056723237 9:89089436-89089458 AAAGCTGGACACTCTGCCCCAGG - Intronic
1057605020 9:96492856-96492878 CAGGCTGGACACACTGCTGCCGG + Intronic
1057833972 9:98429340-98429362 CATGCTGGCCAGGCTGGTCTTGG + Intronic
1059924415 9:119193980-119194002 CAGTCTGGCCACTCTGCTGTAGG + Intronic
1060181465 9:121537369-121537391 CATGTTGCACAGTCTGTTCTTGG + Intergenic
1060644015 9:125262375-125262397 CAAGCTGGACACACGGGTCTGGG + Intronic
1062290111 9:135790604-135790626 CATGCTGGTCCCTCTGCAGTGGG - Intronic
1062321216 9:135991259-135991281 CATGCAGGTCCCTCTGTTCTGGG + Intergenic
1189433883 X:40973731-40973753 CATGATGGACACTCTACTGCAGG - Intergenic
1191584294 X:62804234-62804256 CATGTTGGAAACACTGCTTTTGG - Intergenic
1194823573 X:98533518-98533540 CATGTTGGCCAGGCTGCTCTCGG + Intergenic
1195065138 X:101233325-101233347 CATGCTGGGTCCTCTGCACTGGG - Intronic
1197722291 X:129753439-129753461 CATGTTGGCCAGGCTGCTCTCGG - Intronic
1198655351 X:138907683-138907705 CATGCTTGGCTCTCTGATCTAGG + Intronic
1199723786 X:150562846-150562868 CAACCTGTACACTCTGCTCCTGG - Intergenic
1200316478 X:155137603-155137625 CATGTTGGTCAGGCTGCTCTCGG + Intronic
1201365366 Y:13199842-13199864 CATGCTAGATATTCTGCTTTAGG - Intergenic