ID: 1172670222

View in Genome Browser
Species Human (GRCh38)
Location 20:36630043-36630065
Sequence GGTCAGCCCCAAGAATATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 73}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172670222_1172670227 -2 Left 1172670222 20:36630043-36630065 CCACTATATTCTTGGGGCTGACC 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1172670227 20:36630064-36630086 CCCAGGCCAGAGAATGGGCCAGG 0: 1
1: 0
2: 2
3: 43
4: 391
1172670222_1172670230 0 Left 1172670222 20:36630043-36630065 CCACTATATTCTTGGGGCTGACC 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1172670230 20:36630066-36630088 CAGGCCAGAGAATGGGCCAGGGG 0: 1
1: 0
2: 5
3: 80
4: 463
1172670222_1172670231 3 Left 1172670222 20:36630043-36630065 CCACTATATTCTTGGGGCTGACC 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1172670231 20:36630069-36630091 GCCAGAGAATGGGCCAGGGGAGG 0: 1
1: 0
2: 2
3: 65
4: 646
1172670222_1172670229 -1 Left 1172670222 20:36630043-36630065 CCACTATATTCTTGGGGCTGACC 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1172670229 20:36630065-36630087 CCAGGCCAGAGAATGGGCCAGGG 0: 1
1: 2
2: 2
3: 42
4: 369
1172670222_1172670225 -7 Left 1172670222 20:36630043-36630065 CCACTATATTCTTGGGGCTGACC 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1172670225 20:36630059-36630081 GCTGACCCAGGCCAGAGAATGGG 0: 1
1: 0
2: 2
3: 17
4: 215
1172670222_1172670224 -8 Left 1172670222 20:36630043-36630065 CCACTATATTCTTGGGGCTGACC 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1172670224 20:36630058-36630080 GGCTGACCCAGGCCAGAGAATGG 0: 1
1: 0
2: 0
3: 47
4: 324
1172670222_1172670234 5 Left 1172670222 20:36630043-36630065 CCACTATATTCTTGGGGCTGACC 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1172670234 20:36630071-36630093 CAGAGAATGGGCCAGGGGAGGGG 0: 1
1: 0
2: 5
3: 74
4: 682
1172670222_1172670233 4 Left 1172670222 20:36630043-36630065 CCACTATATTCTTGGGGCTGACC 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1172670233 20:36630070-36630092 CCAGAGAATGGGCCAGGGGAGGG 0: 1
1: 0
2: 6
3: 56
4: 530

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172670222 Original CRISPR GGTCAGCCCCAAGAATATAG TGG (reversed) Intronic
902788364 1:18747558-18747580 GGTCAGCCCCAAAGAGATGGAGG - Intronic
903086060 1:20860269-20860291 GAACAGCCCAAAGAATAGAGTGG - Intronic
910193627 1:84619681-84619703 GGACAGCCCCAAGAGTAGATGGG + Intergenic
917366761 1:174240123-174240145 GGACAACCCCAGGAATAAAGAGG - Intronic
918021136 1:180692281-180692303 GGTTAACCCCAAGAATGAAGTGG + Intronic
1065052411 10:21809118-21809140 GCCCTACCCCAAGAATATAGAGG - Intronic
1068287696 10:54961718-54961740 GGTCATCCCAAAGAGTACAGAGG - Intronic
1068287713 10:54961827-54961849 GGTCATCCCAAAGAGTGTAGAGG - Intronic
1069570836 10:69493347-69493369 AGTCAGCCCCAAGAGAAGAGAGG - Intronic
1076827562 10:132976976-132976998 GGTCATCCCCAAGACTGCAGGGG - Intergenic
1076827579 10:132977036-132977058 GGTCATCCCCAAGACTTCAGGGG - Intergenic
1077670223 11:4150812-4150834 TGTCAGACCCATGGATATAGAGG + Intergenic
1077927201 11:6693604-6693626 GGTCAGCAGGAAGAATTTAGAGG + Intergenic
1082677659 11:56127673-56127695 GGTCACCACCAAGAAGAGAGAGG - Intergenic
1088371252 11:109090674-109090696 AGTCACCCCCTAGAATTTAGAGG - Intergenic
1094423621 12:30297236-30297258 TGTCAGCCCCAAGAAGATGTAGG + Intergenic
1098228055 12:68345224-68345246 CCTATGCCCCAAGAATATAGAGG - Intergenic
1102699298 12:114825309-114825331 GGCCAGCCTCAACAACATAGTGG + Intergenic
1106682168 13:32019167-32019189 GGTGAGCACCAGGTATATAGAGG - Intergenic
1107168757 13:37315125-37315147 GGTAAGCCCCAAAATAATAGTGG - Intergenic
1107169078 13:37317821-37317843 GGTAAGCCCCAAAATAATAGTGG + Intergenic
1108431568 13:50358968-50358990 GGTCAGCCCACAGACTATGGGGG + Intronic
1113213058 13:108004425-108004447 GCTTAGCACCAAAAATATAGTGG - Intergenic
1117754466 14:58959393-58959415 GAGCAGCCCCTAGAATATTGTGG - Intergenic
1119889975 14:78175246-78175268 GGTCAGCCCCAAGAAGGGAGAGG - Intergenic
1123953127 15:25304404-25304426 GATTTGCCCCAAGAATATAAAGG - Intergenic
1134046225 16:11103171-11103193 GGTCAGATCCAAGAATATGCTGG + Intronic
1138109480 16:54312133-54312155 GGTGCACCCCAAGAATATAAGGG - Intergenic
1144008047 17:11119026-11119048 GGCCAGCCTCAAGAACTTAGAGG - Intergenic
1146143872 17:30392989-30393011 GCTCAGCCTCAAGTTTATAGTGG - Intronic
1165998438 19:39862491-39862513 GTTCAGCAGCAAGAAAATAGGGG - Intergenic
1167797035 19:51716299-51716321 GGTCATCCCCAAAAGTACAGTGG + Exonic
929115537 2:38440996-38441018 GGACAGCCCCAAGAAAGGAGTGG + Intergenic
930080760 2:47446688-47446710 GGTGAGCCCGTTGAATATAGTGG + Intronic
930236475 2:48893629-48893651 GCTCAGCACCAAGCATATGGAGG + Intergenic
930970207 2:57385963-57385985 GGTCAGCCACAGGAAAGTAGAGG + Intergenic
932451850 2:71815782-71815804 GCTCAGCCTAAAGAATAAAGAGG + Intergenic
938794221 2:134704854-134704876 GGCCAGCACCAAGCAGATAGAGG - Intronic
941457632 2:165728637-165728659 GACCAGCCTCAACAATATAGTGG - Intergenic
946116467 2:217466916-217466938 GTGCAGCCCCAAGAAGAGAGAGG + Intronic
946386098 2:219385459-219385481 GCTGAGCCCCAAGGACATAGTGG - Exonic
1172670222 20:36630043-36630065 GGTCAGCCCCAAGAATATAGTGG - Intronic
1173340486 20:42148613-42148635 GGTCAGCTCCCAGAATTCAGGGG - Intronic
1184819602 22:46899635-46899657 GGTCAAAGCCAAGCATATAGAGG - Intronic
949102887 3:167250-167272 GGGCAGCTCCAGGAATGTAGTGG + Intergenic
954383230 3:50230653-50230675 GGTGAGCCCCAAGACTATTCTGG + Intronic
954751949 3:52818829-52818851 AGTCAGCCTCTAGAGTATAGTGG + Exonic
965492996 3:169362808-169362830 GCAAAGCCCCAAGAATAAAGGGG - Intronic
974023175 4:56709755-56709777 TGTGAACCCCCAGAATATAGTGG + Intergenic
976796629 4:88941060-88941082 GGGCAGAACCAAGAATCTAGAGG + Intronic
978054094 4:104241351-104241373 CATAAGCCCCAAGAATCTAGAGG - Intergenic
978405487 4:108374236-108374258 TGCCAGCCCTAAGAAAATAGTGG + Intergenic
980739651 4:136932525-136932547 GTGCAGCCCCAAGAATAAACTGG - Intergenic
980886690 4:138770123-138770145 GAGCAGCACCAAGAACATAGTGG + Intergenic
980930589 4:139178926-139178948 ACTCACCCCCAAGAAAATAGAGG - Intergenic
985916199 5:2920728-2920750 GGTCATCCTGAAGAATGTAGAGG - Intergenic
985916238 5:2921003-2921025 GGTCATCCCAAAGAGTGTAGTGG - Intergenic
991446817 5:66709162-66709184 GGAAAGCACCAAGAATATTGCGG + Intronic
1005294972 6:24416754-24416776 GGTCAGTCCCTTGAATATAAAGG - Intronic
1005950120 6:30625684-30625706 GGTCATCTCCAAGAAGAGAGTGG + Exonic
1011448459 6:87468082-87468104 GGTCATCCCCATGAGAATAGGGG + Intronic
1018514536 6:164564005-164564027 TTTCAGCCCCAACAATAGAGTGG - Intergenic
1024134192 7:46389979-46390001 GGTCAGCCCAAAGCACAGAGTGG - Intergenic
1028868478 7:95738973-95738995 GCTCAGCCCCAGGAAGGTAGGGG - Intergenic
1030207536 7:106965537-106965559 GGGCAGGCCAAATAATATAGTGG + Intergenic
1031964335 7:128016836-128016858 GGTCAGACACAAGAAAATAATGG - Intronic
1038536025 8:28353262-28353284 GGCCAGCCCCAAGTATTTGGGGG - Exonic
1042175603 8:66034714-66034736 GGTCATCTCAAAGAATATGGTGG + Intronic
1042855436 8:73261919-73261941 GATCAACCCCAAGAATAGAGAGG - Intergenic
1044099547 8:88116641-88116663 GGTCAGCCGGAGGAATAGAGCGG + Exonic
1046034856 8:108828354-108828376 GGTCATCCCAAAGACTATACTGG - Intergenic
1046681121 8:117171355-117171377 AGTCAGCCCCAAGAATGTCGTGG - Intronic
1047025761 8:120822591-120822613 AGTCAAACCCAAGAAGATAGAGG + Intergenic
1189980537 X:46505997-46506019 GCTCAGCTCCAAGAAAATAAAGG + Intronic
1194725151 X:97387199-97387221 GGAAAGCCCTAAGAAAATAGAGG + Intronic
1195017108 X:100790940-100790962 GGCAAGCCCCGAGAAAATAGAGG + Intergenic
1202090062 Y:21179777-21179799 GCTGTGCCCCAAAAATATAGTGG + Intergenic