ID: 1172671747

View in Genome Browser
Species Human (GRCh38)
Location 20:36639276-36639298
Sequence GTCCTGAGTTGACCACAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 96}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172671747_1172671749 0 Left 1172671747 20:36639276-36639298 CCAGACTGTGGTCAACTCAGGAC 0: 1
1: 0
2: 1
3: 8
4: 96
Right 1172671749 20:36639299-36639321 TGCAGCATCAGCTTTTCCCTGGG 0: 1
1: 7
2: 35
3: 125
4: 443
1172671747_1172671748 -1 Left 1172671747 20:36639276-36639298 CCAGACTGTGGTCAACTCAGGAC 0: 1
1: 0
2: 1
3: 8
4: 96
Right 1172671748 20:36639298-36639320 CTGCAGCATCAGCTTTTCCCTGG 0: 1
1: 5
2: 47
3: 157
4: 695

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172671747 Original CRISPR GTCCTGAGTTGACCACAGTC TGG (reversed) Intronic
904438572 1:30515177-30515199 GCCCTGAACTGAACACAGTCAGG + Intergenic
904474310 1:30755057-30755079 GTCCTCAGTTGACTCCAGTGGGG - Intronic
904636935 1:31889317-31889339 CTCCTGAGTAGACCCTAGTCTGG - Intergenic
907601171 1:55771315-55771337 TTCCTGAGCTGACCACATACTGG - Intergenic
908362209 1:63380275-63380297 GTCCTCAGTTCATTACAGTCTGG - Intronic
912526278 1:110285499-110285521 CTCCTGAGATGGGCACAGTCTGG - Intergenic
918773600 1:188598340-188598362 GTCTGTACTTGACCACAGTCTGG + Intergenic
924603125 1:245508820-245508842 GTACTGAGTTCACCTCAGTCTGG + Intronic
1062848010 10:722701-722723 GCGGTGAGGTGACCACAGTCTGG + Intergenic
1062927576 10:1328265-1328287 GCCCTTCGTTGACTACAGTCAGG - Intronic
1064233444 10:13550687-13550709 TTCCTGAGGTGCCTACAGTCAGG + Intergenic
1067152969 10:43751726-43751748 ATCCTGAGTGGGCCACAGGCTGG + Intergenic
1068006411 10:51396608-51396630 ATCCAGGCTTGACCACAGTCTGG + Intronic
1071686625 10:87764762-87764784 GTCCTAAGTTGTCCACAGTCTGG - Intronic
1074410542 10:113224485-113224507 CACCTGAGTTGGCCACACTCAGG - Intergenic
1077036848 11:499472-499494 ATTGTGAGTTGACCACAGCCTGG - Intronic
1077100042 11:818666-818688 GTCCAGAGATGACCTCAGCCTGG + Intergenic
1079979814 11:27138756-27138778 GTACTGAATTGACCAAAGTTTGG + Intergenic
1081666196 11:44918494-44918516 CCCCTGAGTTGACCAGAGCCAGG + Intronic
1084314336 11:68335854-68335876 GGCCTCAGTTGACCTCAGTTTGG + Intronic
1094499104 12:31007290-31007312 TTCCTGAGCAGACCACAGCCCGG + Intergenic
1099498175 12:83378434-83378456 GACCTGAGTAGAGAACAGTCTGG + Intergenic
1100905003 12:99287066-99287088 GTCCTGAGGTGTCCACTGCCTGG - Intronic
1107217054 13:37934350-37934372 GTCCTGAGATGCCCACACTCAGG + Intergenic
1108232419 13:48361802-48361824 GTCTTGAGTTTTCCACAGTGTGG + Intronic
1110136754 13:72077174-72077196 GTTCTGAGGTAACCACAGGCAGG - Intergenic
1110886089 13:80637039-80637061 GTACCGAGTTGGCCACAGTGGGG - Intergenic
1112824138 13:103372559-103372581 GTCCTGTCTTGAACACAGTCAGG + Intergenic
1118748264 14:68789574-68789596 GTCTTGAGTTGTCCAAGGTCGGG + Exonic
1118750143 14:68800637-68800659 ATCCACAATTGACCACAGTCTGG - Intergenic
1118854279 14:69609453-69609475 ATCCTGTGCTGTCCACAGTCCGG - Intergenic
1120281372 14:82442906-82442928 GTCCTGAGTTTCCCTCACTCTGG + Intergenic
1121273402 14:92652234-92652256 GTCCTTAGAAGACCAAAGTCCGG + Exonic
1121729884 14:96179172-96179194 GCCCTGGGTTGGACACAGTCTGG + Intergenic
1122510490 14:102263022-102263044 TGCCTGAGGTGACCTCAGTCAGG - Intronic
1124002411 15:25770243-25770265 TTCCAGACTTGACCACAGTTGGG + Intronic
1126692865 15:51301381-51301403 GTCCTAACTTGACCAGAGGCAGG + Intronic
1127409637 15:58692927-58692949 TGCCTGTGTTGACCAAAGTCAGG + Intronic
1128593915 15:68928057-68928079 GCCTGGAGTTGACCACAGCCCGG - Intronic
1128720458 15:69943815-69943837 ATCCTGATTTCACCCCAGTCTGG - Intergenic
1133603208 16:7360304-7360326 GTTTTCAGTTGACCACAGTTTGG - Intronic
1136344416 16:29665637-29665659 ACCCTGGGTTGACCAGAGTCTGG + Exonic
1138157588 16:54720539-54720561 GTCATGAGGGGCCCACAGTCAGG - Intergenic
1140374036 16:74430488-74430510 GTCTTGAGTTGAAGGCAGTCTGG + Intergenic
1142591081 17:1006393-1006415 GTCCTGAGGCGGCCACAGTCCGG + Intronic
1145278793 17:21453751-21453773 GCTCTGAGTTGAGCACTGTCAGG - Intergenic
1145896768 17:28463003-28463025 GTTCTGGGTTGAGCACTGTCGGG + Intronic
1146907172 17:36625278-36625300 GTCCACAGTTGGCCCCAGTCTGG + Intergenic
1147129987 17:38401954-38401976 GGCCTGAGCTGACCATAGTGAGG - Exonic
1154385956 18:13892075-13892097 GTCCTGAGAGGACCAGAGTCTGG + Intronic
1159684072 18:71394701-71394723 GTCCTGACTTGTCTACAGTATGG - Intergenic
1165012954 19:32862088-32862110 GTCCTGAGATGTCCCGAGTCTGG - Intronic
1168215305 19:54920789-54920811 GTGCTGTGTTGCCCACAGCCGGG - Intergenic
929549506 2:42880421-42880443 GTCCTGGGTTCAAGACAGTCTGG - Intergenic
930248016 2:49004475-49004497 GTCCTGAGTTCATCATATTCAGG - Intronic
932493209 2:72134273-72134295 GTCCTGCGTGGAGCACAGCCGGG + Intronic
938609354 2:132931164-132931186 GTCCTGATTTCACCACTGACTGG + Intronic
942508813 2:176673780-176673802 GCCCTGAGTTGACATCAGGCAGG - Intergenic
944280094 2:197885810-197885832 GTGCTGAATTGACCACGGTGTGG + Intronic
948681938 2:239641015-239641037 GTCCTGTGTGAACCACAGTGTGG + Intergenic
1170043072 20:12058742-12058764 GTCCTGGGGTGAGCACAGTTTGG + Intergenic
1172388689 20:34551495-34551517 TTGCTGTGTTGCCCACAGTCAGG + Intronic
1172671747 20:36639276-36639298 GTCCTGAGTTGACCACAGTCTGG - Intronic
1173689040 20:44945045-44945067 GTTCTGAGTGGATCACAGTTTGG - Intronic
1181635560 22:24172823-24172845 GGCCTGAGCTGAACCCAGTCTGG - Intronic
952990840 3:38829487-38829509 GTCCTGGGCTGAGCACAGACAGG + Intergenic
957037100 3:75303613-75303635 GTCTGGAGATGACCAGAGTCAGG - Intergenic
961001982 3:123380142-123380164 GTCCAGATTTGAACACAGTTTGG + Intronic
961166576 3:124767677-124767699 GTGGGGAGTGGACCACAGTCTGG - Intronic
962869505 3:139475792-139475814 GTCCTGAGTTCACCACAGAGTGG - Intronic
963087418 3:141451165-141451187 GTACTGAATAGACCACAGCCCGG + Intergenic
970042935 4:11817109-11817131 GACTTGAGATGACCACAGCCAGG - Intergenic
973891219 4:55369126-55369148 GACATGAGATGACTACAGTCCGG + Intronic
984112792 4:175641169-175641191 ATCCTGACTTCAGCACAGTCTGG - Intronic
986885564 5:12230567-12230589 GTCCAGGCTTGACGACAGTCTGG - Intergenic
989389354 5:40884343-40884365 GTCCTGAGTTGACCACTTGCTGG - Intergenic
998166950 5:139849583-139849605 GTCCTGAGGTGACAACGGTGGGG - Intronic
999364467 5:151012965-151012987 CTCATGAGTTGACCCCAGGCAGG - Intergenic
1000581675 5:163041481-163041503 GGCCTGAGGCCACCACAGTCTGG - Intergenic
1001009735 5:168086744-168086766 GTCCCGAATTGATCACAGTGAGG + Intronic
1001902724 5:175444745-175444767 GTCCGGCGTTGACCGCAGCCGGG - Intergenic
1002831707 6:827656-827678 GTCTTGAGGTAACCACAGACAGG + Intergenic
1003596192 6:7476241-7476263 ATCCTGAGAAGATCACAGTCTGG + Intergenic
1008150217 6:47941064-47941086 GGGCTGAGTTGCCAACAGTCAGG - Intronic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1019924781 7:4185049-4185071 GTCCTGAGGTGCCCAAAGCCAGG + Intronic
1025023515 7:55497885-55497907 GTGCTGAGGTGGGCACAGTCAGG + Intronic
1026775300 7:73227389-73227411 GTCCTGAGGAGAGAACAGTCTGG - Intergenic
1027016157 7:74780760-74780782 GTCCTGAGGAGAGAACAGTCTGG - Exonic
1027071871 7:75165177-75165199 GTCCTGAGGAGAGAACAGTCTGG + Intergenic
1031432629 7:121691256-121691278 GTCCTAACTTGAATACAGTCAGG + Intergenic
1031999575 7:128256009-128256031 GTCCAGGGTTGATCACACTCTGG + Exonic
1034331466 7:150286895-150286917 GTCCAGTGTGGACCACAGTGAGG - Intronic
1034666577 7:152822966-152822988 GTCCAGTGTGGACCACAGTGAGG + Intronic
1038664773 8:29528813-29528835 CTCCTGAGCTGACCACAGGGCGG + Intergenic
1041224209 8:55682744-55682766 GTCCTGGCTTGACAGCAGTCAGG + Intergenic
1045800705 8:106097406-106097428 GGCCTGAGGTGACTACAGCCTGG - Intergenic
1048791116 8:138104579-138104601 ATCATGAGTTGGCCACATTCTGG - Intergenic
1049066856 8:140322975-140322997 GCACTGAGTTGACCAAAGGCTGG + Intronic
1051841575 9:21403418-21403440 CTCCAGACTTGATCACAGTCTGG + Intergenic
1053415569 9:37944979-37945001 GTCCAGAGGTGAGAACAGTCAGG - Intronic
1057613840 9:96570471-96570493 CTGCTGAGTTCACCACAGACAGG + Intronic
1060892363 9:127196944-127196966 GACCAGACTGGACCACAGTCAGG + Intronic
1062461693 9:136665116-136665138 CTGCTGAGTTCAGCACAGTCAGG - Intronic
1188575164 X:31640211-31640233 GCCCTGAGTTGAGCACTGTCAGG - Intronic
1200831583 Y:7691662-7691684 GTCCTGGGCTGACCAGAGACAGG - Intergenic