ID: 1172679451

View in Genome Browser
Species Human (GRCh38)
Location 20:36701247-36701269
Sequence CTTTTTAAGGTCAGGCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 297}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172679446_1172679451 9 Left 1172679446 20:36701215-36701237 CCTAATGAAAGCTGTAGTCTTAA 0: 1
1: 0
2: 1
3: 18
4: 180
Right 1172679451 20:36701247-36701269 CTTTTTAAGGTCAGGCAGGATGG 0: 1
1: 0
2: 1
3: 32
4: 297
1172679445_1172679451 12 Left 1172679445 20:36701212-36701234 CCACCTAATGAAAGCTGTAGTCT 0: 1
1: 0
2: 0
3: 8
4: 107
Right 1172679451 20:36701247-36701269 CTTTTTAAGGTCAGGCAGGATGG 0: 1
1: 0
2: 1
3: 32
4: 297
1172679444_1172679451 13 Left 1172679444 20:36701211-36701233 CCCACCTAATGAAAGCTGTAGTC 0: 1
1: 0
2: 0
3: 7
4: 80
Right 1172679451 20:36701247-36701269 CTTTTTAAGGTCAGGCAGGATGG 0: 1
1: 0
2: 1
3: 32
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172679451 Original CRISPR CTTTTTAAGGTCAGGCAGGA TGG Intronic
900490504 1:2946470-2946492 ATTTTGTAGGTCAGGGAGGATGG + Intergenic
901154599 1:7127083-7127105 CTTTGTAGGGTCAGGCAGCATGG + Intronic
901691635 1:10977178-10977200 CTTTTTGAGGCCAGGCATGGTGG - Intronic
901933400 1:12611846-12611868 CTTTGGAAGGTCAAGAAGGAAGG + Intronic
902893077 1:19459072-19459094 CTTTGGAAGGGCAGGCAGGCGGG - Intronic
903990191 1:27262213-27262235 TTTTTTTAGGTCAGGCATGGTGG - Intronic
904022363 1:27477250-27477272 CTTTTTAAGGCCAGGCGCGGTGG + Intronic
904356063 1:29940726-29940748 TTTTTCAAGGTCACACAGGAAGG + Intergenic
906897343 1:49790089-49790111 CTATTTAAGGCCAGGCACGGTGG + Intronic
907198641 1:52707315-52707337 GTTTTTATGTGCAGGCAGGAGGG - Intergenic
907362642 1:53932062-53932084 CTTTCTAAGGCCAGGCATGGTGG + Intronic
908270674 1:62419222-62419244 TTTTTTAAGTTCAAGCAGAAGGG - Intergenic
908550266 1:65201727-65201749 CTTTTGAAGGTGAGGGAGGCAGG + Intronic
909441356 1:75699467-75699489 CTTTTTTAGGGCAGGCCGGGTGG - Intergenic
911046603 1:93633932-93633954 CTTTTTAAGGTCAGGCTTATTGG + Intronic
911453006 1:98089912-98089934 CATTTTGAGGCCAGGCATGATGG + Intergenic
912104276 1:106251270-106251292 CTTTCTAAGGTCAGTGAAGAGGG + Intergenic
912347442 1:108977562-108977584 CTTTTTAAGGCCAGGCGCGGTGG + Intronic
912352636 1:109028736-109028758 TTTTTTAAGGCCAGGCACGGTGG - Intronic
914377798 1:147087887-147087909 CTTTGGGAGGTGAGGCAGGAGGG - Intergenic
915159733 1:153909512-153909534 ATTTTTAAGGCCAGGCACGATGG + Intronic
915561011 1:156688022-156688044 CATTTTAAGGCCAGGCATGGTGG - Intergenic
917884431 1:179369363-179369385 TTTTTTAAGGCCAGGCATGTTGG - Intronic
917938763 1:179895323-179895345 TTTTTTAAGGCCAGGCATGGTGG + Intronic
918735165 1:188052496-188052518 CTATTTAGGGTCAGGCACTATGG + Intergenic
919305077 1:195822067-195822089 CTTTTTTAGGTCGGGCACGGTGG + Intergenic
919777163 1:201201824-201201846 CTGTATAAGGTGAGGCTGGAGGG + Exonic
922132340 1:222792188-222792210 TTGTTCAAGGTCAGGCAGTAAGG + Intergenic
922521173 1:226253584-226253606 CTTTTTTTGGCCAGGCATGATGG - Intronic
922756524 1:228100055-228100077 CTTCTTAGGGTCAGGCAGAAGGG + Intergenic
923619652 1:235568040-235568062 CTTTATAGGGTCATGCTGGAGGG - Intronic
924600635 1:245485669-245485691 CTTTTGAAGGCCAGGCACGGTGG - Intronic
1063089812 10:2853494-2853516 CTTTTTAAGGGCTGGCTGCAGGG - Intergenic
1063151951 10:3345138-3345160 CTTGTTAAAGACAGGAAGGAAGG - Intergenic
1063452226 10:6157983-6158005 CTTTTAAAAGTCAGGCAGTGTGG + Intronic
1064502874 10:15993863-15993885 CTGTTTGGGGTCAGCCAGGAAGG - Intergenic
1065690832 10:28331860-28331882 TCTTTTAAGGCCAGGCAAGATGG - Intronic
1069606483 10:69742025-69742047 CTTGTTAAGGCCAAGAAGGAAGG - Intergenic
1070597216 10:77840956-77840978 CGTTTAAAGGTCAGGCAGATTGG - Intronic
1072143797 10:92615114-92615136 CTTTTTTAGGCCAGGCACGGTGG + Intronic
1072996897 10:100253170-100253192 CTTTTCAGGGCCAGGCATGATGG - Intronic
1073338016 10:102725299-102725321 CCTCTTTAGGTGAGGCAGGAAGG + Intronic
1074483403 10:113849680-113849702 CTTTTGAAAGTCAGGTAGAAGGG - Exonic
1074876416 10:117616969-117616991 CTTTTTAAGCCCAGGCAGTTTGG - Intergenic
1076251701 10:128989398-128989420 GTGATTAAGGTCAGTCAGGATGG - Intergenic
1076881504 10:133241738-133241760 CTTTTAAACGTCAGGTAAGAGGG + Exonic
1079155615 11:17944917-17944939 TCTTTTAATGTTAGGCAGGAAGG - Intronic
1079397647 11:20079349-20079371 CTTTTTAAGGTCAGGGATTAGGG + Intronic
1080892447 11:36421171-36421193 CTTTTAAATGTCAAGGAGGAAGG - Intronic
1081385992 11:42474174-42474196 CTTTTTGGGGCCAGGCAGAATGG + Intergenic
1081793160 11:45803370-45803392 CTTTTTGAGGTCAGGCACGGTGG + Intergenic
1082253449 11:50006907-50006929 CTTTTTTAGGGCAGGCCTGATGG - Intergenic
1082953612 11:58845356-58845378 CTTGGGAAGCTCAGGCAGGAGGG + Intronic
1083308504 11:61772787-61772809 CTTTGCTAGGTCAGGCAGGTGGG + Intronic
1083392226 11:62361430-62361452 CTTTGGAAGGCCAAGCAGGAGGG - Intronic
1085980099 11:81714449-81714471 CCACTTAAGGTAAGGCAGGAGGG + Intergenic
1086045243 11:82524746-82524768 CTTTTTAAAGTAAAGCATGATGG + Intergenic
1088075160 11:105839114-105839136 CTTCATAATGTCAGACAGGAAGG - Intronic
1089250286 11:117154729-117154751 ATTTTTAAAGTCAGGCACGGTGG - Intronic
1089723058 11:120447529-120447551 ATTTTTAAGGCCAGGCATGGTGG + Intronic
1091524858 12:1289275-1289297 CTTTTTTAAGGAAGGCAGGAAGG - Intronic
1092339612 12:7664140-7664162 TTTTTTAAGGTCAGGTGTGATGG - Intronic
1092875559 12:12844419-12844441 TTTTATAAGGCCAGGCACGATGG + Intergenic
1093966798 12:25336244-25336266 CTTTTTTAGGTCAGGATGGGAGG + Intergenic
1094358070 12:29600069-29600091 CTTGTCAAGGTCAGGATGGAAGG + Intronic
1094525139 12:31226474-31226496 CTTCTTAGGGTCAAGAAGGAAGG + Intergenic
1094547916 12:31422130-31422152 GTCTTTAAGGTCAGGCACGGTGG + Intronic
1094586286 12:31780680-31780702 CTTTATAAAGGCAGGGAGGAAGG - Intergenic
1096151956 12:49319800-49319822 ATTTTTAAGGTCAGGCGTGGTGG - Intergenic
1096577381 12:52561412-52561434 CTTTTCAAGGTCACAGAGGATGG + Intergenic
1096839795 12:54373224-54373246 CTTCTTAGGGTGGGGCAGGAAGG + Intronic
1101119248 12:101562115-101562137 GTTTTTCAGGTGAGGCTGGAGGG - Intergenic
1101869015 12:108546806-108546828 CATTTTAAGGCCAGGCATGGTGG - Intronic
1102529520 12:113536079-113536101 CTTATTGAGGTCAGGCATGGTGG + Intergenic
1103528492 12:121583098-121583120 CTTTGTAAGATCGAGCAGGAGGG - Intergenic
1103605337 12:122081785-122081807 CTTTCTCAGCTCGGGCAGGAGGG - Intronic
1105006150 12:132721888-132721910 ATTTTTTAGGCCAGGCACGATGG - Exonic
1105520316 13:21125359-21125381 CTTTGTAAAGACAGGCAGGCTGG + Intergenic
1106122582 13:26872930-26872952 GTTCTTAAGGTCAGCCAGGCAGG - Intergenic
1106331726 13:28745631-28745653 CGTTTTAAGGTAAAGCATGATGG + Intergenic
1107326020 13:39243657-39243679 TTTTTTAAGGCCAGGCACGGTGG - Intergenic
1107666717 13:42698132-42698154 GTCTTAAAAGTCAGGCAGGAAGG + Intergenic
1107675826 13:42795823-42795845 AAATTTAAGGTCAGGCAGGGAGG + Intergenic
1109710438 13:66152464-66152486 CTTTTCAATGTTAGGAAGGAAGG + Intergenic
1109866918 13:68276586-68276608 ATTTTTAGGGGCAGGGAGGAAGG + Intergenic
1114108199 14:19448347-19448369 TTTTTTATGGCCAGGCATGATGG - Intergenic
1114177230 14:20333352-20333374 CCTTTTAAGGTAAAGGAGGAGGG - Intergenic
1115003312 14:28448052-28448074 CTTTTTAAGATCAAGTAGAATGG + Intergenic
1115282995 14:31685725-31685747 CTTTTTAGTGTCAGGTAGGATGG - Intronic
1115559846 14:34573285-34573307 CTTTTTGAGGCCAGGCGGGATGG + Intronic
1115956241 14:38783338-38783360 CTTTTTGAGGCCAGGCATGGTGG + Intergenic
1115956600 14:38787728-38787750 CTTTTTGAGGCCAGGCATGGTGG + Intergenic
1116155588 14:41200367-41200389 GTTATTAAGGCCAGGTAGGATGG + Intergenic
1117712464 14:58545726-58545748 ATTTTTAAGGCCAGGCATGGTGG + Intronic
1117923258 14:60747907-60747929 CATTTTAAGGCCAGGCATGGTGG + Intronic
1118013602 14:61635858-61635880 CTTTTTTAGATTAGGAAGGATGG + Intronic
1119026860 14:71159715-71159737 TTTTTTTAGGTCAGGCATGGTGG - Intergenic
1119173894 14:72555144-72555166 CTTTCTAAGGTGGGGCAGGCAGG - Intronic
1119681620 14:76596435-76596457 AATTTTAAGGGCAGGCAGGGTGG + Intergenic
1120030755 14:79638015-79638037 CTTTATAAGGCCAGGCACGGTGG - Intronic
1120668862 14:87340767-87340789 CATTTTTATTTCAGGCAGGAAGG + Intergenic
1121290186 14:92767979-92768001 CTTATTAAGGTCAGGCATGGTGG - Intergenic
1121459486 14:94063639-94063661 CTTTTTATGGCCAGGCATGGTGG + Intronic
1122049448 14:99045650-99045672 CTTTTAAAGGTAAGGCAGGGAGG + Intergenic
1122633918 14:103121615-103121637 CTCTCTAAGCTCAGGCATGAGGG - Intergenic
1122864660 14:104598099-104598121 CGTTTGCAGGCCAGGCAGGAGGG - Intronic
1126986095 15:54310632-54310654 CTTTTTAAGGTCACAGAAGACGG + Intronic
1127232384 15:57010980-57011002 CTTTTTAAGGTAAGTGAGGTGGG + Intronic
1128199730 15:65793975-65793997 CTTTTTAAGGTAGGGCACAATGG - Intronic
1129562154 15:76581871-76581893 CTTTTTCAGGCCAGGCATGGTGG - Intronic
1129565618 15:76619788-76619810 CTCTTAAAGGTCGGGCACGATGG + Intronic
1129705321 15:77790970-77790992 CTTTTGATGGTCAGCCAGGTTGG - Intronic
1131492858 15:92877985-92878007 ATATTTAAGTTGAGGCAGGAAGG - Intergenic
1131738036 15:95355790-95355812 CTTTTTGAGGCCAGGCATGGTGG + Intergenic
1133090379 16:3399731-3399753 ATTTTTAAGGTCGGGCATGGTGG - Intronic
1137838530 16:51618331-51618353 CATTCTAAGGTCAAGCAGCAAGG + Intergenic
1138165288 16:54795702-54795724 CTTTGTAAGGCCAGGCACAATGG - Intergenic
1138687835 16:58741139-58741161 CCTTGTAAGGTCAGGCATGGTGG - Intergenic
1138988748 16:62363844-62363866 CTTTTTAATTTTTGGCAGGAAGG - Intergenic
1139174872 16:64674789-64674811 CTTTTTAGGGTGAGGCTGGAGGG - Intergenic
1140137676 16:72222213-72222235 CTTGAGAAGGTGAGGCAGGAAGG - Intergenic
1141258315 16:82425120-82425142 CTTTTGAGGGTAAGGCAAGATGG + Intergenic
1141504926 16:84470365-84470387 CTTTTGAAGGCCAGGCACGGTGG + Intergenic
1142775670 17:2136869-2136891 CAAATTAAGGTCAGGCATGATGG + Intronic
1142973466 17:3628938-3628960 CTTTTTAAGGCCGGGCATGGTGG - Intronic
1143609920 17:8012328-8012350 CTTGATAAGGTCCAGCAGGAGGG - Exonic
1145788735 17:27611062-27611084 CAGTTAAAGGTCAGGGAGGAAGG - Intronic
1145792288 17:27635161-27635183 ATTTTTCAGGCCAGGCATGATGG + Intronic
1146964955 17:37018649-37018671 CTTTAAAAGGTCAGGTGGGAAGG - Intronic
1147194760 17:38758630-38758652 CTTTTTTAGGCCAGGCATGATGG - Intronic
1149792294 17:59489749-59489771 CTTTTTTAGGTCAGGCACAGTGG - Intergenic
1150504981 17:65689688-65689710 CTTTATAAAGTCAGAGAGGATGG + Intronic
1151106752 17:71624227-71624249 CTTATAAAGGAAAGGCAGGAGGG + Intergenic
1151217916 17:72590780-72590802 CTTTTTAAAATCAGACAGGGAGG + Intergenic
1151268210 17:72972926-72972948 CTGTGGTAGGTCAGGCAGGAAGG + Intronic
1151414753 17:73954697-73954719 CGTATTCAGGTCAGGCAGGTGGG + Intergenic
1152398241 17:80048351-80048373 CGTTTTAAAGGTAGGCAGGAAGG - Intronic
1153907402 18:9674624-9674646 CTTGTTAAGCTCATGCTGGAAGG - Intergenic
1154051527 18:10964006-10964028 TTCTTTGAGGTCTGGCAGGAAGG - Intronic
1154953104 18:21229118-21229140 CTTTTTCTGGCCAGGCACGATGG + Intergenic
1155472753 18:26208028-26208050 CTTTTCAGGGTCAGGCATGGTGG - Intergenic
1156343298 18:36232260-36232282 AATTTTAAGGTCAGGCATGGTGG - Intronic
1157334301 18:46726629-46726651 ATTTTTAAGGCCAGGCACGGTGG + Intronic
1157789867 18:50522086-50522108 TTTTTTAATGTCAGGAAGGAAGG - Intergenic
1158629828 18:59102152-59102174 CATTTTAAGGTCAATCAGTATGG - Intergenic
1158714311 18:59864121-59864143 ATTTTTAAGGCCAGGCACGGTGG - Intergenic
1158891844 18:61879674-61879696 TTTTTTGAGGCCAGGCACGATGG + Intronic
1159961529 18:74559080-74559102 GTATAGAAGGTCAGGCAGGACGG - Intronic
1160092945 18:75844366-75844388 CCCTTCAAAGTCAGGCAGGAGGG + Intergenic
1160631531 18:80249774-80249796 CTTTTAAAGGAAAGGCTGGAAGG + Intergenic
1161656388 19:5518074-5518096 CTTCTTATGGTCAGGCATGGTGG + Intergenic
1162509465 19:11109093-11109115 CATTTTTAGGCCTGGCAGGATGG + Intronic
1162787128 19:13042642-13042664 CTTTTTCAGGCCAGGCATGGTGG - Intronic
1162885597 19:13694675-13694697 CTTTTTTAGGCCAGGCACGGTGG - Intergenic
1163135882 19:15310780-15310802 CTGTTTAAGGCCAGGCACGGTGG - Intronic
1166145054 19:40828372-40828394 CTTTTTAGAGGGAGGCAGGAGGG + Intronic
1166217326 19:41344226-41344248 CTTTTGAAGGCCAAGGAGGATGG - Intronic
1166421940 19:42643447-42643469 CTTTTTTAGGGCAGGCATGATGG + Intronic
1166521536 19:43483841-43483863 ATATTTTAGGTCAGGCATGATGG + Intronic
925050286 2:808257-808279 CATTTTAAGGCCAGGCGTGATGG - Intergenic
925639081 2:5970205-5970227 CTTTTTAAGGTCAGGCACCATGG + Intergenic
925656173 2:6151741-6151763 CTTTTCATGGCCAGGCAGGATGG - Intergenic
925951414 2:8915836-8915858 CTTTCTAAGGTCACACAGGTAGG - Intronic
925986481 2:9219451-9219473 AATTTTTAGGTCAGGGAGGATGG - Intronic
926201320 2:10800896-10800918 ACTTTTACGGTCAGGCATGATGG - Intronic
928956623 2:36875977-36875999 CTTTATCAGGTCAGGCATGGTGG + Intronic
932000025 2:67876707-67876729 CGTTTTGGGGTCAGGAAGGAGGG - Intergenic
932829924 2:74979295-74979317 ATTTTTAAGGTCAGGCATGGTGG - Intergenic
933599907 2:84318626-84318648 CTTTTTTAGGTAAAGCAAGAGGG - Intergenic
934670730 2:96210685-96210707 CCTTTTAAGGCCAGGCACGGTGG - Intergenic
935063604 2:99629572-99629594 CTTTTTTAGAACAGGCAGGTAGG + Intronic
935390846 2:102551194-102551216 CTTTATAAGGGGAGGCAGCAGGG + Intergenic
936391321 2:112076762-112076784 CCTTTTTAGGTCTGGAAGGATGG + Intronic
938470368 2:131554157-131554179 TTTTTTATGGCCAGGCATGATGG + Intergenic
938896040 2:135751473-135751495 GTTTTTAAGGCCAGGCACGATGG - Intronic
939280660 2:140059640-140059662 CTTTTTATGGTCAGGCCTGGTGG - Intergenic
939408848 2:141798418-141798440 ATTTTAAAGGTCAGGCACGGTGG + Intronic
939521063 2:143231387-143231409 CTTTTGGAGGTCATGCATGATGG - Intronic
940001424 2:148970033-148970055 ATTCTAAAGGTCAGGCAGTAAGG - Intronic
940404380 2:153283965-153283987 CAATTTAAGCTCAGGAAGGATGG + Intergenic
940761535 2:157743930-157743952 CTTTTGAAGGAAAGGAAGGATGG - Intronic
942227303 2:173828721-173828743 CTTTTTGATGGCAAGCAGGAAGG - Intergenic
942367666 2:175244842-175244864 CTTTTTAAGGGGAGGTAGAAGGG + Intergenic
942426558 2:175866475-175866497 TTTTTTACGGTCAGGCAGGGTGG + Intergenic
943748954 2:191491150-191491172 CTTTTTAAAGTCAGGCATATTGG + Intergenic
945588751 2:211701454-211701476 GTTCTTAAGATCAGGCAAGACGG + Intronic
946037253 2:216754089-216754111 CTTCTCTAGGTCAGGAAGGAAGG - Intergenic
946750133 2:222886028-222886050 TTTTTTAAAGTCAGGCATGGTGG - Intronic
948494521 2:238338348-238338370 CTATTTTATGTCAGGAAGGAAGG + Exonic
949001060 2:241613862-241613884 CTTTTCAAGGCCGGGCATGATGG + Intronic
949065598 2:241988371-241988393 CTCTCTAAGGCGAGGCAGGAGGG + Intergenic
1169885254 20:10391535-10391557 TGTTTTAAGTTGAGGCAGGAGGG - Intergenic
1171456380 20:25275039-25275061 CTGCTTAAGGGCAGGCAGGAGGG + Intronic
1172118982 20:32586504-32586526 CTGCTCAAGGTCATGCAGGAAGG + Intronic
1172564074 20:35914719-35914741 CTTTGTGAGGTGAGGCAGGTGGG + Intronic
1172679451 20:36701247-36701269 CTTTTTAAGGTCAGGCAGGATGG + Intronic
1172798168 20:37557693-37557715 GTTTTTAAGGCCAGGCATGGTGG + Intergenic
1173903888 20:46611754-46611776 CTTGTAGAGGTCAGACAGGAGGG - Intronic
1174377349 20:50134884-50134906 CTTTAAAGGGTCAGGCAGGCCGG + Intronic
1174640879 20:52043126-52043148 ATTTTTAAGGCCAGGCATGGTGG - Intergenic
1177461089 21:21411742-21411764 CATTTTAAGTTAAGGCAGTATGG - Intronic
1177698664 21:24608360-24608382 AATTTTGAGGCCAGGCAGGATGG + Intergenic
1177872843 21:26594163-26594185 TTTTTTATTGTGAGGCAGGAGGG - Intergenic
1178509116 21:33187809-33187831 ATTTTTAAAGTGAGGGAGGAGGG + Intergenic
1182353247 22:29710587-29710609 CTATCCAAGGTCAGGCGGGAGGG - Intergenic
1182596853 22:31428004-31428026 TTTTTTAAGGCCAGGCACGGTGG - Intronic
1183707702 22:39484692-39484714 CTTTTTAAGGACAGCAAGGTAGG - Intronic
1184161690 22:42700918-42700940 GTGTTTAAGGTCAGGAAGCAGGG + Intronic
1184213593 22:43051683-43051705 GTTTCTCAGGCCAGGCAGGAAGG - Intronic
1184218188 22:43081268-43081290 GATGTTCAGGTCAGGCAGGATGG - Intronic
1184750932 22:46486246-46486268 CTTTTTAAAGTCATGCATCAAGG + Intronic
950292929 3:11801611-11801633 ATTTTTAAGGTCAGGCATGGTGG - Intronic
950306814 3:11921634-11921656 CTCTTTTAGGTGAGACAGGAAGG + Intergenic
950565029 3:13764246-13764268 CTTTTTAATGTCAGGTAAGATGG + Intergenic
950760011 3:15214165-15214187 CTTTTTAAGGCCAGGCATGGTGG - Intronic
950882533 3:16334872-16334894 CCTTATAAGGACAGGCAGGAAGG + Intronic
951115984 3:18862705-18862727 CTTGATAATGGCAGGCAGGAAGG - Intergenic
952384316 3:32828740-32828762 CTTTGGGAGGACAGGCAGGAGGG - Intronic
954347258 3:50010613-50010635 TTTTTTAAGGCCAGGCAGGGTGG + Intronic
954914879 3:54140208-54140230 CTTTTTGAGGCCAGGAATGACGG - Intronic
955369935 3:58342353-58342375 CTTTTTTAGGCCAGGCACGGTGG + Intronic
955586981 3:60489766-60489788 CTTTTTCAGTTTTGGCAGGAGGG + Intronic
956619514 3:71207053-71207075 CCTCTGAAGGTCAGGCATGATGG + Intronic
957042349 3:75345574-75345596 CTTCTTAAGTTCTGGGAGGAAGG - Intergenic
959501974 3:107117032-107117054 ATATTTTAGGTCAGGCAGGGTGG - Intergenic
959712936 3:109402810-109402832 CTCTATAAGGTTAGGCAGGTTGG - Intergenic
960718045 3:120596763-120596785 GTTCTTAAGGTCACGCAGGCAGG - Intronic
961047077 3:123716424-123716446 CTTCTTAAGTTCTGGGAGGAAGG - Intronic
961237927 3:125384514-125384536 CATTTTAAGGCCAGGCATGGTGG + Intergenic
961241877 3:125418148-125418170 CTTTTTAACGTGAGTCAGGGTGG + Intergenic
962895065 3:139706680-139706702 GTTGTTAAGGAAAGGCAGGAAGG + Intergenic
963069353 3:141290211-141290233 CTTCTTTAGGACAGGCAGGAGGG - Intronic
963641469 3:147865689-147865711 TTTTATAAGGTCATGCTGGAGGG - Intergenic
963787715 3:149551784-149551806 CTTTTTAAGGGAAGGCATTAGGG - Intronic
963795722 3:149628924-149628946 TTTTTTAAAGCCAGGCAGGGTGG - Intronic
966069143 3:175853707-175853729 CTATTTGAGGCCAGGCATGATGG - Intergenic
966480013 3:180396975-180396997 CTTCTTCAGGTCAGGCTGGCTGG - Intergenic
967529538 3:190532889-190532911 CTTTTTCGGCTCAGGCAGCATGG + Intronic
968470212 4:777518-777540 CGTTTTTAGGTCAGGCACGGTGG + Intergenic
974453444 4:62095414-62095436 GTTTTCAAGGAGAGGCAGGAGGG + Intergenic
975152611 4:71037128-71037150 CTTCTTAAGGGCAGGCTGGGGGG - Intergenic
976735665 4:88306347-88306369 CATTTTAACATTAGGCAGGAAGG - Intergenic
976770911 4:88651873-88651895 CTTTTTAAGGCCAGGCACAGTGG - Intronic
977252799 4:94707651-94707673 CTCTTTCAGGACAGGCTGGAGGG - Intergenic
977673160 4:99718857-99718879 CTATTTAAGGCCAGGCATGGTGG + Intergenic
978450559 4:108828420-108828442 CTTTTTCAGGCCAGGCACGGTGG - Intronic
979006690 4:115307830-115307852 ATTTTTAAGGTGATGGAGGATGG - Intergenic
983580990 4:169309867-169309889 CTTTTTAATGCCAGGCACGGTGG + Intergenic
985049898 4:185979294-185979316 GTTTTTCAGGTCAGGCATGGTGG - Intergenic
985171835 4:187158263-187158285 TTTCTGAAGGTCAGCCAGGAGGG - Intergenic
989256693 5:39373678-39373700 CTTCTTTAGGTCATGAAGGAAGG - Intronic
989616290 5:43340034-43340056 CTTTTTAGGGCCAGGCATGGTGG + Intergenic
990596279 5:57315336-57315358 CTTTTTAAGGAAAGGAAGGCAGG - Intergenic
995307835 5:110675330-110675352 ATTTTTAAGGCCAGGCACGGTGG - Intronic
996514222 5:124351888-124351910 TTTTTTAAGGACAGCCAAGAAGG - Intergenic
998881974 5:146654038-146654060 CCCTTTAAGGCCAGGCAGGAAGG + Intronic
999687233 5:154114158-154114180 CTTGCTAAGGTCATGCAGGTAGG - Intronic
1000011332 5:157236084-157236106 CCTTTTAAGGCCAGGCACGGTGG + Intronic
1000337889 5:160255002-160255024 ATCTTTAAAGTCAGGCAGCAAGG - Intronic
1001014135 5:168125523-168125545 ATTTTTAAGGTCACTCTGGAGGG - Intronic
1001969811 5:175946281-175946303 ATTTATAAGGTCGGGCACGATGG - Intronic
1002247625 5:177897487-177897509 ATTTATAAGGTCGGGCACGATGG + Intergenic
1002419124 5:179136376-179136398 CCTTTTCAGGCCAGGCAAGATGG + Intronic
1005018984 6:21399852-21399874 TTTTTTAGGGTCAGGCATGGTGG + Intergenic
1006268194 6:32943065-32943087 CTTTTTCAGGCCAGGCACGATGG - Intronic
1008341129 6:50365566-50365588 ATTGTTAAGGTCAGACAGCAAGG - Intergenic
1016193616 6:141303211-141303233 CTTTTCAAGTTTGGGCAGGAGGG - Intergenic
1016332537 6:142969122-142969144 AGTTTTAAGGCCAGGCATGATGG + Intergenic
1016859150 6:148699176-148699198 CTATTTAGGGTCAGGCTGGCTGG + Intergenic
1016916404 6:149248102-149248124 CATTCTAAGGTCAGGCATGGTGG + Intronic
1021283311 7:18747098-18747120 CTTTTTGAGGAAAGGAAGGAAGG + Intronic
1021745041 7:23731738-23731760 ATTTTTAAAGTCAGGCATGTAGG - Intronic
1021774525 7:24039398-24039420 CTTGTTAAGGTTAGGCCAGAAGG - Intergenic
1021827316 7:24568369-24568391 CTGTTTGAGGTGAGGCAGAAAGG + Intergenic
1022326859 7:29340481-29340503 ATTAGTAAGGGCAGGCAGGAAGG + Intronic
1022836872 7:34126241-34126263 ATTTTTAAGGAAAAGCAGGAAGG + Intronic
1024195992 7:47059483-47059505 GTCTTAAAGGTCAGGCAGAAGGG - Intergenic
1026631123 7:72039090-72039112 ATATTTAAGGTTAGGCAGGGTGG - Intronic
1027899281 7:84088732-84088754 AGTTTTAATGTTAGGCAGGAAGG - Intronic
1033372756 7:140726190-140726212 CTTTTGATGGTCAGGCATGATGG - Intronic
1034328904 7:150265404-150265426 GTTTTTTAGGTCTGGCATGATGG + Intronic
1035182311 7:157098218-157098240 CTTTTTTAGGTCAGGCGAGGTGG - Intergenic
1036567395 8:9949158-9949180 CTTTCTATGGGCAGGAAGGAAGG - Intergenic
1037017403 8:13925618-13925640 CCTTTTCAGGTAAGACAGGATGG + Intergenic
1037384786 8:18326707-18326729 CTTATTTAGGCCAGGCACGATGG - Intergenic
1038594254 8:28871691-28871713 CTTTCCTAGGTCAGGCATGATGG - Intronic
1039854947 8:41403952-41403974 CTTCCTAAGGGAAGGCAGGAAGG + Intergenic
1041143945 8:54851742-54851764 TTTATAAAGGTCAGGCATGATGG + Intergenic
1041413343 8:57580872-57580894 TCTTTTAAGGTCAGGCGGAAGGG + Intergenic
1041672855 8:60510453-60510475 ATTTTTAAGGCCAGGCAGAGTGG + Intergenic
1041820910 8:62031953-62031975 TTTTATAAGGTCATGCTGGAAGG + Intergenic
1042472654 8:69208962-69208984 CTTCTAAAGGCAAGGCAGGAGGG - Intergenic
1043421373 8:80102145-80102167 ATTCTGAAGGTCAGGCATGAGGG + Intronic
1044975888 8:97665056-97665078 CTTTATAAGGAAAGGCAGGCCGG - Intronic
1046691301 8:117288064-117288086 CTTTTTTTGGTCATCCAGGAAGG - Intergenic
1046749863 8:117915565-117915587 CTATTTGAGGTCAGGCACGGTGG + Intronic
1047911380 8:129533591-129533613 CATTATAAGGTCAGGCACGGTGG - Intergenic
1050370270 9:4914345-4914367 CTTTTTAAAGTTAGGCATGGTGG - Intergenic
1053235692 9:36451927-36451949 CTTTTTAAGGCCAGGCGCGGTGG + Intronic
1053524359 9:38813596-38813618 CTTTGTAAGGTGAGGCAGAAAGG - Intergenic
1054196593 9:62038005-62038027 CTTTGTAAGGTGAGGCAGAAAGG - Intergenic
1054641812 9:67550680-67550702 CTTTGTAAGGTGAGGCAGAAAGG + Intergenic
1056058084 9:82850088-82850110 CTTTTGGAGGTCAAGGAGGAGGG + Intergenic
1056561677 9:87735306-87735328 CATTTTTAGGTGAGACAGGATGG - Intergenic
1056588054 9:87941092-87941114 CCTTTTAAGGCCAGGCATAATGG - Intergenic
1056608813 9:88111853-88111875 CCTTTTAAGGCCAGGCATAATGG + Intergenic
1056766994 9:89450568-89450590 CTTATAGAGGTCAGGCTGGAAGG - Intronic
1058073287 9:100623716-100623738 CTTTGGGAGGCCAGGCAGGAGGG + Intergenic
1059244833 9:112840957-112840979 TTTTTTAGTGTCAGCCAGGATGG + Intronic
1059462302 9:114440526-114440548 ATTTTTTAGGTCGGGCAGGATGG - Intronic
1061565972 9:131440192-131440214 CCTTTTGAGGTCAGGCACGGTGG - Intronic
1185512876 X:676370-676392 ATTTTTAAGGTCAGGGTGCAAGG + Intergenic
1186577134 X:10778607-10778629 ATTTTAAGGGTGAGGCAGGAAGG + Intronic
1187151904 X:16688804-16688826 CTGTTTAAGGCCAGGCATGGTGG + Intronic
1187929756 X:24283267-24283289 TTTTTTAATGTAAGGCAGGAAGG - Intergenic
1189463401 X:41260315-41260337 CTTTTTAAGGCCGGGCATGGTGG - Intergenic
1189662552 X:43317569-43317591 CCTTATAAGGTCAGGCAGAGAGG - Intergenic
1189684242 X:43547268-43547290 CATTTTAAGAACAGACAGGATGG - Intergenic
1189701148 X:43717022-43717044 GTGGTTAAGGTGAGGCAGGATGG + Intronic
1190395370 X:49976614-49976636 CTATTTAATGTCAGGCATGTGGG + Intronic
1191871597 X:65751021-65751043 TTTTATAAGGTCATGCTGGAGGG - Intergenic
1192355877 X:70403123-70403145 CATTTTAAGGTCAGCAAAGATGG - Intronic
1193142256 X:78040201-78040223 CTTTTTAAGGTAAGGGGGGGGGG - Intronic
1193660373 X:84249696-84249718 GTATTTGAGGTCAGGCATGATGG - Intergenic
1195522590 X:105848998-105849020 TATTTTAAGGCAAGGCAGGAAGG - Intronic
1195953580 X:110305106-110305128 CTTTTTAAGGACATGAAGCATGG + Intronic
1196831803 X:119781665-119781687 CTTTTTACGGCCAGGCATGGTGG + Intergenic
1198383551 X:136106071-136106093 TGATTTAAGGTCAGGCACGATGG - Intergenic
1201479555 Y:14425066-14425088 CATTTTTAGCTGAGGCAGGAGGG - Intergenic
1202143103 Y:21749737-21749759 ATTTTTAAAGTCAGGCATGGTGG + Intergenic
1202143724 Y:21756078-21756100 ATTTTTAAAGTCAGGCATGGTGG - Intergenic