ID: 1172680282

View in Genome Browser
Species Human (GRCh38)
Location 20:36708735-36708757
Sequence TTAAAAAGCACAGCCCAAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172680277_1172680282 13 Left 1172680277 20:36708699-36708721 CCCACCAACTACACTGCTGGCTG No data
Right 1172680282 20:36708735-36708757 TTAAAAAGCACAGCCCAAGCCGG No data
1172680278_1172680282 12 Left 1172680278 20:36708700-36708722 CCACCAACTACACTGCTGGCTGG No data
Right 1172680282 20:36708735-36708757 TTAAAAAGCACAGCCCAAGCCGG No data
1172680280_1172680282 9 Left 1172680280 20:36708703-36708725 CCAACTACACTGCTGGCTGGACA No data
Right 1172680282 20:36708735-36708757 TTAAAAAGCACAGCCCAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172680282 Original CRISPR TTAAAAAGCACAGCCCAAGC CGG Intronic