ID: 1172681218

View in Genome Browser
Species Human (GRCh38)
Location 20:36716822-36716844
Sequence CAGGTACAAGAGGCAGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 235}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172681209_1172681218 20 Left 1172681209 20:36716779-36716801 CCTGTTTATTACAAGGTCTTTTG 0: 1
1: 0
2: 1
3: 15
4: 171
Right 1172681218 20:36716822-36716844 CAGGTACAAGAGGCAGTAGATGG 0: 1
1: 0
2: 2
3: 13
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172681218 Original CRISPR CAGGTACAAGAGGCAGTAGA TGG Intronic
900297571 1:1959646-1959668 CAGGGGAAAGAGTCAGTAGAGGG + Intronic
900806139 1:4769511-4769533 CAGGTAGAGGAGGCAGGTGAAGG + Intronic
902873241 1:19326571-19326593 CAGGTACAACACGCTGGAGATGG - Exonic
903781962 1:25826409-25826431 CAGGTAGTTGAGGCAGTAGCTGG + Exonic
906254633 1:44338730-44338752 AAGGAACAAGTGGCAGTAGCAGG + Intronic
907555049 1:55336146-55336168 CAGGCATCAGAGGCAGAAGAAGG + Intergenic
907885521 1:58589181-58589203 CAGGTACAAGAGGCAGGATGTGG - Intergenic
910402026 1:86847105-86847127 AAGGTAGGAGAGGGAGTAGATGG - Intergenic
911058354 1:93727060-93727082 CATGTACAAGAGTCAATGGAAGG - Intronic
913159541 1:116132766-116132788 CAGGCAGAAGAGGCAGAAGCAGG + Intronic
913352910 1:117881858-117881880 CAGGTACAAGAGGAATTTGAAGG - Exonic
918359544 1:183741855-183741877 CAGGTATAACAGGCAGATGATGG + Intronic
918754437 1:188319918-188319940 CAGGTACAGGAGACAGAGGAGGG - Intergenic
920178345 1:204117213-204117235 GAGGCACAGGAGGCAGTTGAGGG + Intronic
920744022 1:208608572-208608594 CAGGTACAAAAGGCATGAGATGG + Intergenic
922532628 1:226356074-226356096 CAGGGAGAAGAGGCAGGAGCTGG + Intergenic
923920922 1:238564039-238564061 GAGGTCCAAGAGGCAGCAGAGGG + Intergenic
924605477 1:245530986-245531008 GAGGTTCAGGAGGCAGTAGAAGG + Intronic
924852467 1:247844251-247844273 CAGGAACAAAAGGTAGTCGATGG - Intergenic
1065264963 10:23965363-23965385 CAGGAACAAGAGGCCTTATAGGG - Intronic
1066553998 10:36591110-36591132 CAGGCACAAGGAGCAGGAGAAGG + Intergenic
1068039661 10:51807894-51807916 CAGAGACAGGAGGCAGGAGAAGG + Intronic
1068953193 10:62798602-62798624 CAGCTTCAAGAGGCAGTGAAAGG - Intergenic
1070044553 10:72819288-72819310 CAGGTAGAAGAGAAAGAAGAGGG + Intronic
1070427709 10:76305292-76305314 TTGGTACAAAAGACAGTAGATGG + Intronic
1070923903 10:80205554-80205576 CAGGTGCCAGAGGCAGTGCAAGG + Exonic
1074122086 10:110500181-110500203 TAGATACAAGAGGCAGGACAGGG - Intronic
1076289248 10:129331710-129331732 CCTGTAGAAGAGGCAGTAAACGG - Intergenic
1077264226 11:1641166-1641188 CAGGGTCAAGAGGCAGGTGAAGG - Intergenic
1078178330 11:8987788-8987810 CAGGAACAAGAGCCAGTCAAAGG - Intronic
1078519240 11:12050180-12050202 CAGGTACAAGGAGGAGAAGAAGG + Intergenic
1078929063 11:15899453-15899475 CAGGGACAAGTGGCAGTAGAGGG + Intergenic
1081815069 11:45934434-45934456 CAGGTCCCAGAGGCAACAGAGGG + Intronic
1081915539 11:46728076-46728098 CGGGTACAGGAGGCAGTGGGCGG - Exonic
1084029960 11:66475578-66475600 CACCTGCCAGAGGCAGTAGAAGG - Exonic
1084756397 11:71241583-71241605 CAGGGACCAGAGACAGTAGCAGG - Intronic
1086462130 11:87016525-87016547 TAATTAAAAGAGGCAGTAGAGGG + Intergenic
1088226514 11:107626301-107626323 CTGGTACAAGAGACAGTAAGTGG + Intronic
1088741799 11:112773621-112773643 CAGGTTCAAGAGACAGTGGTGGG + Intergenic
1089223936 11:116899644-116899666 CTGCTACAAGACGCAGCAGATGG + Intronic
1089470507 11:118716592-118716614 CAGGAAAAAAAGGGAGTAGAAGG - Intergenic
1091024343 11:132128611-132128633 CAGGTACAAGAGGCTGATAAGGG + Intronic
1091374891 12:18716-18738 CAGGTACAGGTGGCAGCATAGGG - Intergenic
1094037694 12:26088312-26088334 CAGGTAGAAGAGGCCAGAGAAGG + Intergenic
1094370711 12:29734831-29734853 CAGTTAAAAGTGGCAATAGATGG - Intronic
1095917130 12:47490961-47490983 CATTTACAAGTGGCAGTGGAAGG + Intergenic
1096774839 12:53957468-53957490 AAAGTGCAAGAGGCTGTAGATGG + Exonic
1097195123 12:57238857-57238879 CAGGGACCAGAAGCAGGAGAAGG - Intronic
1098157605 12:67615761-67615783 CAGGCATTAGAGGCAGAAGAAGG - Intergenic
1100633799 12:96414853-96414875 CAGGAACAAGATGCGGTAGGTGG + Intergenic
1102035469 12:109768522-109768544 CTGGTACAGGAGGCTGTGGATGG - Exonic
1102182160 12:110920764-110920786 AAGGTTAAAGAGGCAGTAGCTGG + Intergenic
1103014293 12:117481913-117481935 CATGAACAAGAGGGAGTAAATGG + Intronic
1103252091 12:119508729-119508751 CAGGTGCAAGAGGAAGTATCTGG + Intronic
1105319042 13:19299500-19299522 CAGGCAAAACAGGCAGTAAAAGG + Intergenic
1107447560 13:40482208-40482230 CAGAGACAAGAGACAGTAGGGGG + Intergenic
1107839950 13:44447075-44447097 CAGTTACTAGGGGCAGGAGAAGG - Intronic
1108607464 13:52053882-52053904 CAAGGACAAGGTGCAGTAGAAGG - Intronic
1109636335 13:65122727-65122749 AATGTACAAGAGGTAGTACATGG - Intergenic
1113834007 13:113316932-113316954 CAGGTGAAAGGGGCAGGAGAAGG + Intronic
1114184044 14:20386720-20386742 CAGGTACGACAGACAGCAGATGG + Intronic
1115670322 14:35603823-35603845 CAGTTACCAGAGGCAGGTGAAGG + Intronic
1115692191 14:35856215-35856237 CAGGGGCAAGAGGCAGCAGATGG + Intronic
1116201898 14:41808177-41808199 GAGGAAGAAGAGGAAGTAGAGGG + Intronic
1117517917 14:56520861-56520883 CTGGGACAAGGGGCAGAAGAGGG - Intronic
1117626138 14:57640105-57640127 CAGGCACAAGAGGGAAGAGAGGG + Intronic
1121445075 14:93973665-93973687 CAGGGCCAGGAGGCAGCAGAAGG - Intronic
1121781260 14:96623952-96623974 GGGGTACAAGAGGGAGTGGAGGG - Intergenic
1122099124 14:99393409-99393431 CAGGTACAAGCGGCAGAAACAGG + Intergenic
1125063567 15:35454801-35454823 CAGGAAAAAGAAGAAGTAGAGGG - Exonic
1127632855 15:60842642-60842664 CAGGTAGAAGGGGCAGTGAAGGG - Intronic
1128338165 15:66801912-66801934 CACTCACAAGAGGCAGCAGAGGG + Intergenic
1129791755 15:78345491-78345513 CTGGTACCAGAGACAGCAGAGGG + Intronic
1130770816 15:86921681-86921703 CAGGAATAGGATGCAGTAGAAGG + Intronic
1131827821 15:96334145-96334167 CAGGTACGAGTGGCAGTTGAGGG - Exonic
1139275303 16:65722378-65722400 CATGTATAAAAGGCAGTTGAGGG - Intergenic
1141693614 16:85610057-85610079 CAGGTACCTGAGGCAGGTGAGGG + Intergenic
1143487288 17:7261887-7261909 CATGTACAAGGGGCTGTGGATGG - Exonic
1145400095 17:22524750-22524772 TAGGTACAATAAGAAGTAGAAGG - Intergenic
1148463198 17:47849940-47849962 CTGGTCCCAGAGGCAGGAGATGG - Intronic
1149003789 17:51783750-51783772 CAGATACAAATGGCAGAAGAGGG + Intronic
1149357588 17:55858562-55858584 CAGTTAGAAGAGGTAGGAGAAGG + Intergenic
1149960038 17:61098656-61098678 CATGGACAAGAGTGAGTAGAAGG + Intronic
1150890516 17:69143929-69143951 CAGGTACAAGAGACAGGAGAAGG + Intergenic
1151430163 17:74056830-74056852 CAGGAACAAGAGAGAGGAGAGGG - Intergenic
1152247370 17:79192083-79192105 CAGGATCAAGAGGGAGGAGACGG - Intronic
1152722252 17:81928807-81928829 CAGGGAGGAGAGGCAGGAGACGG - Intergenic
1156366138 18:36429042-36429064 AAGCTTCATGAGGCAGTAGAGGG - Intronic
1157721163 18:49925658-49925680 CAGATACAAGAGCCAGAAGCAGG + Intronic
1161217075 19:3099890-3099912 CAGTTACAAGAGGCAGAGGTAGG - Intronic
1161631483 19:5358865-5358887 CAGGTGCAAGATGCAGCTGAGGG - Intergenic
1163527388 19:17830156-17830178 CAGTTCCAAGAGGCGGCAGAGGG + Exonic
1166720027 19:44991290-44991312 CAGGTACAGAAGACTGTAGACGG - Exonic
1167349469 19:48965443-48965465 CAGGTCCCAGAAGCAGGAGATGG - Exonic
925019292 2:555955-555977 CAGGAAAATGAGGCAGTGGAAGG - Intergenic
926433319 2:12813285-12813307 CAGGTCCTAGAGGCAGTATCTGG + Intergenic
927067504 2:19488203-19488225 CAGGTACCAGAGGCAGAGAAAGG - Intergenic
931383263 2:61773490-61773512 CAGGAACAAGAGGGAGTGGCAGG + Intergenic
931481243 2:62643037-62643059 CAGGGACACGAGGAAGTACAAGG - Intergenic
931987565 2:67756386-67756408 CAGGTTGAAGGTGCAGTAGAAGG - Intergenic
933627486 2:84618168-84618190 CTGGTGCTAGAGGCAGAAGAAGG + Intronic
935346465 2:102112624-102112646 CAGGTAAAAGAGGAAGCAAAAGG + Intronic
935516545 2:104047339-104047361 CAGGGTCAAGAGGCACAAGAAGG - Intergenic
937145257 2:119638956-119638978 CAGGAAGAGGAGGCAGTTGAGGG - Intronic
937149036 2:119673255-119673277 CAGGTACAAGAATAAATAGATGG - Intergenic
937812042 2:126210093-126210115 CAGGTGCAAGGGGCAGCACATGG - Intergenic
940391482 2:153137571-153137593 CAGGTACAATAGGCTTTAGGAGG - Intergenic
940811343 2:158246189-158246211 CAGGTAGATGAGACAGCAGATGG + Intronic
940812949 2:158266206-158266228 CAGGTACAAAAGTGAGTAAAGGG + Intronic
940987710 2:160064792-160064814 CAGGTTCATGAGGCAGTGTAGGG + Intergenic
941328466 2:164145949-164145971 TAGGAAAAAGAGGCTGTAGAAGG - Intergenic
941865608 2:170331347-170331369 CAAGTACAAGAGGGATTAGAGGG + Intronic
942209655 2:173657933-173657955 CAGGTAAAAGAGGGAGTTGCTGG + Intergenic
945468590 2:210200788-210200810 CAAGAGCAAGAGGAAGTAGATGG + Intronic
946223781 2:218251094-218251116 CTGGTACAAAAGACAGCAGATGG - Intronic
947562213 2:231165760-231165782 AAGGTACAAGAGGTAGTGGTCGG - Intronic
948649435 2:239431139-239431161 TAGGTACCAGAGGCTGGAGAAGG + Intergenic
948807100 2:240457731-240457753 CAGGGAGGAGAGGCAGGAGAGGG - Intronic
1169134603 20:3189722-3189744 CAGGCACCAGAGGAAGTAGGGGG + Intergenic
1171354250 20:24531992-24532014 CAGGAAGCAGAGGCATTAGATGG - Intronic
1172681218 20:36716822-36716844 CAGGTACAAGAGGCAGTAGATGG + Intronic
1172767993 20:37361325-37361347 CAGGTATCAGAGGGAGGAGAGGG - Intronic
1176605229 21:8824717-8824739 CAGGTAAAAGAGGAGGTGGATGG - Intergenic
1178379290 21:32094430-32094452 GAGGTACAAGAAGAAGTAGAAGG + Intergenic
1181530243 22:23513170-23513192 CAGGAATAAGAGGCAGAGGAGGG + Intergenic
1182435177 22:30325872-30325894 CAGCCACAGGAGCCAGTAGATGG - Intronic
1182886076 22:33775414-33775436 CAGTTAAAAGAGGCAGCAGGTGG - Intronic
1183843942 22:40524724-40524746 CAGTTAAAAGAGGAAGAAGATGG - Intronic
1184234089 22:43173889-43173911 CAGGACCCAGAGGCAGAAGAGGG + Intronic
1184491887 22:44814669-44814691 CAGGTACAAGAAGAACTTGAAGG + Exonic
1184574996 22:45356540-45356562 CAGGAGCAAGAGGAAGTATATGG + Intronic
949805967 3:7956304-7956326 CAGGTAGAAGAGGAAAGAGAAGG - Intergenic
949867741 3:8560347-8560369 CAGGTCCAAAAGGCAGTTTAGGG - Intronic
950430639 3:12948994-12949016 CAGGTACAAGATGCCGTGGTGGG + Intronic
950827800 3:15843856-15843878 AAGTTGCAAGAGGCAGAAGATGG + Intronic
952756714 3:36875334-36875356 AAGATACAAGAGGCAGGACAAGG + Intronic
953086913 3:39677919-39677941 CAGGGCCATTAGGCAGTAGAAGG - Intergenic
953905869 3:46868020-46868042 CAGGTACAAGGACCAGCAGAAGG + Intronic
954362625 3:50130290-50130312 CAGTTTCAAGAGGCTGAAGAAGG - Intergenic
954465966 3:50654955-50654977 CAGGGACCAGAGGCCATAGAAGG - Intergenic
954893482 3:53954714-53954736 CAGGTAAACAGGGCAGTAGAGGG + Intergenic
955836524 3:63061499-63061521 TAGGTACAGGAGCCAGAAGAAGG - Intergenic
956911851 3:73826303-73826325 TAGGCACAAGAGGCTGCAGATGG + Intergenic
958795303 3:98700767-98700789 CAAATACAAGAGGAAGCAGAAGG + Intergenic
959005665 3:101016673-101016695 CAGGAGCAAGAGGCAGCAAAGGG + Intergenic
959282572 3:104363283-104363305 CAGTTACTATAGGAAGTAGAAGG + Intergenic
959736782 3:109668313-109668335 GAGGTACAAAGAGCAGTAGATGG + Intergenic
962017537 3:131457567-131457589 CAGGCAAAACAGGCAGTAAAAGG + Intergenic
962887944 3:139645224-139645246 CAGCTACCAGAAGCAGTAGTTGG + Intronic
963200531 3:142581410-142581432 CAGGTACAAGAGGAAGTACTCGG + Intergenic
967727365 3:192874100-192874122 CGGGTACAAGAGGAAGTGAATGG + Intronic
968491770 4:893986-894008 CAGGTACAAGATGCAGCCCAGGG + Exonic
968508429 4:983258-983280 CAGAGACAGGAGGCAGGAGAAGG - Intronic
972264834 4:37450027-37450049 CAGATCCAAGAGGCAAGAGATGG - Intergenic
974291405 4:59936288-59936310 CAAGAAGAAGAGGCAGTTGAAGG - Intergenic
974671051 4:65030745-65030767 CAGTTACGCGAGGTAGTAGATGG - Intergenic
976874674 4:89837818-89837840 CAGGTTGAGGAGGCAGGAGAAGG + Intronic
982063090 4:151624379-151624401 CAGGTACAAGAGGCACACGTGGG - Intronic
982284863 4:153724344-153724366 TTGGTACAAGAGGTAGTGGATGG + Intronic
982366227 4:154582235-154582257 CAGGCCCAAGAGGCAGGATAAGG + Intergenic
983756024 4:171337466-171337488 CAAGTATAAGAGGCACCAGAAGG - Intergenic
984960342 4:185091271-185091293 CAGGTTGTAGAGGGAGTAGAGGG - Intergenic
987011225 5:13767693-13767715 CAGGTAAAAGAGGTTGGAGAGGG + Intronic
987281463 5:16418230-16418252 CAGGAACAGGAGGGAGAAGAGGG + Intergenic
987934294 5:24443918-24443940 AATGTGCAAGAGGCAGTGGAAGG + Intergenic
992700201 5:79334247-79334269 CAGGAACAAGAGGAGGTTGAAGG + Intergenic
992773209 5:80068471-80068493 CAGGTAGATGGGGCAGAAGAAGG - Intronic
992902400 5:81310989-81311011 CAGGTGCAAGAAGCAGTGGGTGG + Intronic
992994972 5:82323737-82323759 CATGGAAAAGAGGGAGTAGAGGG + Intronic
994483408 5:100364266-100364288 CAGACACAAGAATCAGTAGAGGG - Intergenic
994557678 5:101324822-101324844 CAGGTATCAGAGGGAATAGAGGG - Intergenic
997289194 5:132713251-132713273 CAGGAAAAAGAGGCACTGGAAGG + Intronic
998058070 5:139096402-139096424 CTGGAACCAGAGACAGTAGACGG + Intronic
999439131 5:151587830-151587852 CAACAACAAGAAGCAGTAGAGGG + Intergenic
999940486 5:156537321-156537343 AAGGTACTAGAGGCAGGATAGGG - Intronic
1003173908 6:3740832-3740854 GAGGAGCAAGAGGCTGTAGAGGG - Intronic
1004014738 6:11721696-11721718 CATGTACATGAGGTAGTTGAGGG + Intronic
1004145305 6:13060470-13060492 AATGTGAAAGAGGCAGTAGAAGG + Intronic
1006931499 6:37691807-37691829 CAGGGAGAAGATGCAGAAGAGGG + Intronic
1007068743 6:39019178-39019200 GAGGTAAAAGAGGCAGGAGGAGG + Intronic
1007350697 6:41271672-41271694 CAACTTCAAGATGCAGTAGAGGG + Intronic
1007620865 6:43213672-43213694 CAGGTACCAGAGGAGGCAGAGGG - Intronic
1008260862 6:49365630-49365652 CAGGCACAAGAGAGAGCAGAGGG + Intergenic
1008938288 6:57016664-57016686 CAGGAAAAAGAGACAGAAGAGGG - Intronic
1009294981 6:61935173-61935195 CATTTAAAAGAGGGAGTAGAGGG + Intronic
1009550038 6:65078900-65078922 CAGGAACAAGAGGGAGTGGGAGG - Intronic
1011296439 6:85831367-85831389 CAGGTAAATCAGGCAGGAGAAGG - Intergenic
1019422432 7:957316-957338 CCGGAACAGCAGGCAGTAGATGG - Intronic
1019713312 7:2527154-2527176 CGGGTACAGGTGGCAGTGGATGG - Exonic
1021975258 7:26006312-26006334 CGGGTCCAAGAGGAAGAAGATGG + Intergenic
1022728753 7:33003748-33003770 CAGGGACAAGAGGCCTGAGAGGG - Intronic
1023138410 7:37076921-37076943 CAGTTACATGAGATAGTAGAAGG - Intronic
1023258451 7:38335229-38335251 CAGGTACCAGTGGATGTAGAAGG + Intergenic
1023274425 7:38502762-38502784 CAGGTTCAAGGGGCCGAAGAAGG - Intronic
1023607563 7:41943844-41943866 AAGGTACAAGAGACAGTATGAGG - Intergenic
1025044896 7:55684241-55684263 CAGGGACAAGAGGCCTGAGAGGG + Intergenic
1025715460 7:63951768-63951790 CAGGTTCAAGAGGCTGAGGAAGG + Intergenic
1025886685 7:65601372-65601394 GAGGTACCAGAGGCTGCAGAAGG - Intergenic
1026638625 7:72105750-72105772 CAGGGAGAAGAGGAAGAAGAAGG + Intronic
1027172883 7:75885340-75885362 CAGGTAACAGAGTCAGGAGAGGG + Intronic
1027812392 7:82921038-82921060 TAGATACAAGAGACACTAGATGG + Intronic
1030176371 7:106659964-106659986 CGGGTACGGGAGGCAGCAGAGGG + Exonic
1032347058 7:131126147-131126169 CATGTACAAAAGGCAGGAGAAGG + Intronic
1034160150 7:148987876-148987898 CAGGGACAAAAGGCAGAAGCAGG + Intergenic
1036059183 8:5295866-5295888 CAAGGGCAAGAGGCAGAAGAGGG + Intergenic
1037067938 8:14606171-14606193 TATGTACAAGAGGGAGGAGATGG - Intronic
1037244939 8:16822782-16822804 CAGGAGCAAGAGAGAGTAGAGGG + Intergenic
1037515212 8:19624183-19624205 CAGGAACCAGAGGTAGTAGATGG - Intronic
1039573638 8:38606123-38606145 CTGGGACAAGAGGCATTAGGAGG + Intergenic
1043486231 8:80701672-80701694 CAGATACAAGAGGGAAGAGAGGG + Intronic
1043524083 8:81077357-81077379 GAAGTAGAAGAGGCTGTAGAAGG - Intronic
1045730771 8:105238068-105238090 CAGGTAAAAGAGGGAGGACACGG + Intronic
1045816171 8:106279553-106279575 CAGTCAGAAGAGGCAGTTGATGG - Intronic
1046734235 8:117759275-117759297 CAGGTACAAGATCCAGTATCAGG - Intergenic
1047574264 8:126135720-126135742 CAGATACAGGATGCAGCAGAGGG - Intergenic
1049203299 8:141352053-141352075 CAGGTGCAGGAGGGAGTGGAGGG - Intergenic
1049775048 8:144400236-144400258 CAGGTACAACAGCGAGTTGACGG + Exonic
1053623421 9:39843840-39843862 CTGTCACTAGAGGCAGTAGAGGG + Intergenic
1053652262 9:40181161-40181183 CAGGTATATGTGGCAGTACAGGG + Intergenic
1053881447 9:42599388-42599410 CTGTCACTAGAGGCAGTAGAGGG - Intergenic
1053891216 9:42694924-42694946 CTGTCACTAGAGGCAGTAGAGGG + Intergenic
1054220478 9:62406859-62406881 CTGTCACTAGAGGCAGTAGAGGG - Intergenic
1054230237 9:62502313-62502335 CTGTCACTAGAGGCAGTAGAGGG + Intergenic
1054532320 9:66195054-66195076 CAGGTATATGTGGCAGTACAGGG - Intergenic
1055262574 9:74455088-74455110 CAGTTATAAGAGTGAGTAGAGGG + Intergenic
1055748197 9:79474094-79474116 CAGGAAACTGAGGCAGTAGACGG - Intergenic
1057415254 9:94856339-94856361 AGGGTAAAAGAGGCAGCAGAAGG + Intronic
1058237990 9:102517292-102517314 CAAGTACAAGAACCAGAAGATGG + Intergenic
1058885678 9:109320174-109320196 CAGGAAGACGCGGCAGTAGAGGG + Exonic
1059171128 9:112126197-112126219 CAGTTACAGCAGGAAGTAGAGGG + Intronic
1061250139 9:129421732-129421754 CAGGAATAAGAGGCAGGGGAGGG - Intergenic
1062200711 9:135301328-135301350 CAGGTGCAGGAGGCGGTGGAGGG - Intergenic
1062346253 9:136116655-136116677 CAGGTACTGTAGGCAGAAGAGGG + Exonic
1186358979 X:8818959-8818981 CAGCTACAAGAGACAGAAAAGGG - Intergenic
1188480277 X:30630233-30630255 CAGGTCCCAGAAGCAGGAGATGG - Intergenic
1190774407 X:53541251-53541273 CAGGTCCCAGAAGCAGTAAATGG + Intronic
1192342828 X:70278192-70278214 GAGGTCCAGGAGGCAGTTGAGGG + Intronic
1193212322 X:78821806-78821828 CAGTTACAAGTGTCTGTAGATGG + Intergenic
1194585016 X:95721100-95721122 GAGCTACAAGAAGCAGAAGAGGG + Intergenic
1195793683 X:108620325-108620347 CAGGTGAAAGAGGCAGTCCAGGG + Exonic
1197362380 X:125521295-125521317 CAGGCAGAAGAGGAACTAGAGGG + Intergenic
1198624934 X:138560472-138560494 GAAGGCCAAGAGGCAGTAGAGGG - Intergenic
1199674128 X:150170896-150170918 CAGGGCAATGAGGCAGTAGAAGG - Intergenic
1199893562 X:152111935-152111957 AACAGACAAGAGGCAGTAGAAGG + Intergenic
1200289677 X:154859808-154859830 CAGGTGAAAGTGGCAGTAGAGGG + Intronic
1200844964 Y:7822654-7822676 CAGGTACAAGAGTCATCATAAGG + Intergenic
1200850393 Y:7877217-7877239 CAGGTACAAGAGTCATTATTAGG + Intergenic
1200866225 Y:8046594-8046616 CAGGTACAAGAGTCATTATTAGG - Intergenic
1200897506 Y:8391288-8391310 CAGGTACAAGAGTCATTATTAGG + Intergenic
1200900919 Y:8431065-8431087 CAGGTACAAGAGTCATTATTAGG + Intergenic
1202061101 Y:20889127-20889149 CAGGGCCATGAGGCAGGAGAAGG + Intergenic