ID: 1172684923

View in Genome Browser
Species Human (GRCh38)
Location 20:36746194-36746216
Sequence TCGGTAGTTCCCGAGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 35}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172684923_1172684929 -2 Left 1172684923 20:36746194-36746216 CCGTCCACCTCGGGAACTACCGA 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1172684929 20:36746215-36746237 GAGAAGATGGTGGCTGAGCCAGG 0: 1
1: 0
2: 8
3: 102
4: 616
1172684923_1172684931 7 Left 1172684923 20:36746194-36746216 CCGTCCACCTCGGGAACTACCGA 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1172684931 20:36746224-36746246 GTGGCTGAGCCAGGAGAGGCCGG 0: 1
1: 1
2: 9
3: 103
4: 986
1172684923_1172684932 10 Left 1172684923 20:36746194-36746216 CCGTCCACCTCGGGAACTACCGA 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1172684932 20:36746227-36746249 GCTGAGCCAGGAGAGGCCGGCGG 0: 1
1: 0
2: 8
3: 65
4: 628
1172684923_1172684930 3 Left 1172684923 20:36746194-36746216 CCGTCCACCTCGGGAACTACCGA 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1172684930 20:36746220-36746242 GATGGTGGCTGAGCCAGGAGAGG 0: 1
1: 1
2: 6
3: 57
4: 1008

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172684923 Original CRISPR TCGGTAGTTCCCGAGGTGGA CGG (reversed) Intergenic
907732058 1:57076208-57076230 CAGGTAGTTCCGGAGGTGGCTGG + Intronic
910229272 1:84969272-84969294 TCAGAAGTTCCAGAGGTGGCTGG + Intronic
921847941 1:219904087-219904109 TCGGTAGATTCTGAAGTGGAGGG + Intronic
1069869281 10:71523392-71523414 TTGGTAGTCCCCGAGTTTGAGGG - Intronic
1073347153 10:102792265-102792287 ACGGTCATTCCCGAGGTGAAAGG + Intronic
1084084283 11:66847790-66847812 TGGGCAGTTCCTGAGATGGAGGG - Intergenic
1086895978 11:92313275-92313297 TTGGTAGTCCCAGATGTGGATGG - Intergenic
1091103032 11:132893315-132893337 TCTGTATTTCCCGAGGATGATGG - Intronic
1103407643 12:120687118-120687140 TAGGTTGTTCCTGAGGTGGGAGG + Exonic
1104704681 12:130934211-130934233 TCCTCAGTTCCCGGGGTGGAGGG - Intergenic
1117912533 14:60648998-60649020 ACGGAAGTTGCCGCGGTGGAAGG + Exonic
1120961349 14:90127953-90127975 TTGGTAGTTGCCCAGGTTGAAGG + Intronic
1140896273 16:79327228-79327250 TCGGTAGTGCCTGTGGTGGAGGG + Intergenic
1143346145 17:6250648-6250670 TAGGTATTTCCCGGGGTGGAAGG + Intergenic
1144203936 17:12965823-12965845 TCTGTAGATCCTGTGGTGGAGGG + Intronic
1164513738 19:28917278-28917300 TCTGTCCTTACCGAGGTGGAAGG - Intergenic
1165073276 19:33267769-33267791 TCGGGACTTCCCAGGGTGGAAGG - Intergenic
1165306799 19:35007621-35007643 TTGGTAGTGCCCAAGGTGGGAGG + Intronic
1166672939 19:44722436-44722458 TCGGGGCTTCCCGAGGTGGGAGG - Intergenic
929788641 2:45008919-45008941 GCGGAAGTTGCCGCGGTGGAAGG + Exonic
946376981 2:219316643-219316665 TCGGGAGAGGCCGAGGTGGAAGG - Intergenic
1172684923 20:36746194-36746216 TCGGTAGTTCCCGAGGTGGACGG - Intergenic
1182145692 22:27995432-27995454 CAGGTTGTTCCCGAGGTAGAAGG + Intronic
952303926 3:32128771-32128793 TTGTTAGTTCCAGAGGTGGCTGG - Intronic
955136932 3:56228295-56228317 TGGGAAGTTCCGGAGATGGATGG - Intronic
961760300 3:129162191-129162213 TAGTTAGGTCCCGTGGTGGAGGG - Intergenic
967850194 3:194076646-194076668 TCGGTGCTTTCCCAGGTGGAAGG + Intergenic
968742270 4:2337283-2337305 TCGGGAGTGCCCCAGATGGAAGG - Intronic
970333902 4:15011836-15011858 TTGATAATTCCCCAGGTGGAAGG - Intronic
998134096 5:139665668-139665690 TTGGTGGTTCCGGAGGTGGCGGG + Intronic
1003264011 6:4550346-4550368 TGGGTAGATCCCCAGGTGGGTGG - Intergenic
1023806722 7:43877752-43877774 GCAGTACTTCCTGAGGTGGATGG - Exonic
1029257947 7:99281918-99281940 GCGGTAGTTCCCGAGGCAGCAGG - Intergenic
1029379597 7:100204477-100204499 TCGGGAGTTCCCTAGAAGGAAGG + Intronic
1032204065 7:129846440-129846462 TCAGTAGTTGCCGAGGTGAGAGG + Intronic
1035748581 8:1979212-1979234 GCGGAGGTTCCCGAGGAGGAGGG - Intronic
1043962223 8:86430090-86430112 TCGGTTGTTGCTGAGGTGGGAGG + Intronic
1045434070 8:102142009-102142031 TGGGTGGATCCCGAGGTGGGTGG - Intergenic