ID: 1172684964

View in Genome Browser
Species Human (GRCh38)
Location 20:36746439-36746461
Sequence GAGCCATACCCAAGGTCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172684959_1172684964 -3 Left 1172684959 20:36746419-36746441 CCTCCTTTTAAGGTGACCTAGAG No data
Right 1172684964 20:36746439-36746461 GAGCCATACCCAAGGTCACAGGG No data
1172684960_1172684964 -6 Left 1172684960 20:36746422-36746444 CCTTTTAAGGTGACCTAGAGCCA No data
Right 1172684964 20:36746439-36746461 GAGCCATACCCAAGGTCACAGGG No data
1172684956_1172684964 24 Left 1172684956 20:36746392-36746414 CCTAAGAGCTCTTGCAGGGTATG No data
Right 1172684964 20:36746439-36746461 GAGCCATACCCAAGGTCACAGGG No data
1172684955_1172684964 25 Left 1172684955 20:36746391-36746413 CCCTAAGAGCTCTTGCAGGGTAT No data
Right 1172684964 20:36746439-36746461 GAGCCATACCCAAGGTCACAGGG No data
1172684954_1172684964 26 Left 1172684954 20:36746390-36746412 CCCCTAAGAGCTCTTGCAGGGTA No data
Right 1172684964 20:36746439-36746461 GAGCCATACCCAAGGTCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172684964 Original CRISPR GAGCCATACCCAAGGTCACA GGG Intergenic
No off target data available for this crispr