ID: 1172693048

View in Genome Browser
Species Human (GRCh38)
Location 20:36803642-36803664
Sequence GACTGTGAGCAGTGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 506
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 463}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172693044_1172693048 -6 Left 1172693044 20:36803625-36803647 CCAGGAAGTAGCCAGGAGACTGT 0: 1
1: 0
2: 1
3: 13
4: 157
Right 1172693048 20:36803642-36803664 GACTGTGAGCAGTGGGAAGAAGG 0: 1
1: 0
2: 2
3: 40
4: 463
1172693043_1172693048 -5 Left 1172693043 20:36803624-36803646 CCCAGGAAGTAGCCAGGAGACTG 0: 1
1: 0
2: 1
3: 20
4: 210
Right 1172693048 20:36803642-36803664 GACTGTGAGCAGTGGGAAGAAGG 0: 1
1: 0
2: 2
3: 40
4: 463
1172693042_1172693048 -4 Left 1172693042 20:36803623-36803645 CCCCAGGAAGTAGCCAGGAGACT 0: 1
1: 0
2: 1
3: 16
4: 220
Right 1172693048 20:36803642-36803664 GACTGTGAGCAGTGGGAAGAAGG 0: 1
1: 0
2: 2
3: 40
4: 463

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172693048 Original CRISPR GACTGTGAGCAGTGGGAAGA AGG Intronic
900132407 1:1092640-1092662 GGCTGTGAGCAGCAGGGAGACGG + Intronic
900241087 1:1617845-1617867 GCCTGTGAACTGTGGGTAGATGG + Intronic
900623508 1:3597957-3597979 GCATGTGAGCAGCGGGAGGATGG + Intronic
900738643 1:4316832-4316854 GCCAGTGGGCAGTGGGAGGAAGG + Intergenic
900836075 1:5005158-5005180 GTGAGTGAGGAGTGGGAAGAAGG - Intergenic
901422423 1:9160203-9160225 GTCTATGAGCAGGGAGAAGAGGG - Intergenic
902127132 1:14224262-14224284 GCCTGGAACCAGTGGGAAGAAGG + Intergenic
902230343 1:15023531-15023553 GAATGTGAGCTGGGGGAGGATGG + Intronic
902412479 1:16219509-16219531 GACCAGGAGCAGTGGGGAGAGGG - Intergenic
903360053 1:22771443-22771465 GGCTGTGTCCAGTGGGCAGAGGG + Intronic
903417520 1:23194061-23194083 GACTGTGGCCAGTGTGATGACGG + Exonic
904678476 1:32212809-32212831 GACAATGAGGGGTGGGAAGAAGG + Intronic
904811743 1:33167665-33167687 GGCTGTGAGCAGTGCCAGGAAGG + Intronic
904982309 1:34516833-34516855 GAGGGTGAAGAGTGGGAAGAGGG - Intergenic
905269701 1:36779503-36779525 GACTTTGAGGAGTGAGAAGCTGG - Intergenic
906095030 1:43217104-43217126 GAGTGTGTGCAGAGGGATGAGGG + Intronic
906679190 1:47713639-47713661 GACTGAGAGCAGAGGCAGGATGG + Intergenic
906770447 1:48478725-48478747 GACTGTGGGCCATGGGGAGAGGG - Intergenic
906868263 1:49447078-49447100 GGGTGTGTGCAGTGGGAAGAGGG + Intronic
908098200 1:60762814-60762836 GGCTGTGTGTGGTGGGAAGAGGG + Intergenic
909198506 1:72658327-72658349 GACTCTGAGGAGTAGGAAGAGGG - Intergenic
909907923 1:81221651-81221673 CACTGTGAGCACTGGGAACCTGG - Intergenic
910852772 1:91665097-91665119 GACTGTGAGCAGTACGTGGATGG - Intergenic
911437287 1:97877255-97877277 GATGGTGACCAGTGGGAAGATGG + Intronic
911445387 1:97985638-97985660 AACGGTGAGCAGAAGGAAGATGG - Intergenic
912095314 1:106133658-106133680 GGCTATCAGCAGTAGGAAGAGGG + Intergenic
912438596 1:109680575-109680597 GTGGGTGAGCAGTGGGAAGGGGG + Intronic
912441117 1:109699020-109699042 GTGGGTGAGCAGTGGGAAGGGGG + Intronic
912779196 1:112528188-112528210 GACTGAGGGCAGTCAGAAGAAGG + Intronic
915816942 1:158977499-158977521 GAATGTGAGAAGAGGGAATATGG - Intergenic
916592159 1:166202785-166202807 GCCAGTGAGCAGTGGCAGGAAGG - Intergenic
917235385 1:172886267-172886289 GATTGGGAGCTGTGGGAAGAAGG + Intergenic
918393977 1:184095071-184095093 GACTGCGAGCTCTTGGAAGACGG + Intergenic
918624730 1:186644356-186644378 GGGTGTGGGCAGTGGGTAGATGG + Intergenic
919390016 1:196972075-196972097 GACGGTGAAGGGTGGGAAGAGGG - Intergenic
919466556 1:197927207-197927229 GAGTGTGGGCAGTGGGGAGCTGG + Intronic
920379301 1:205526541-205526563 GAGTGGGAGTAGTGGGATGAGGG + Intronic
920563193 1:206953849-206953871 GTAAGTGAGCAGTGGGAACAAGG + Intergenic
920981397 1:210839426-210839448 GAAGGTGAGGGGTGGGAAGAGGG + Intronic
921584555 1:216931710-216931732 GTCTATGAGCTGTGGGAAGCAGG + Intronic
922503388 1:226112540-226112562 GACTGTGTAGAGTTGGAAGAGGG - Intergenic
922682871 1:227615538-227615560 GACTGTGAGCAATGGCAGGCTGG - Intronic
923647427 1:235838177-235838199 GAGAGTGAGAAGTGGGAAGGAGG + Intronic
923761297 1:236847486-236847508 GACTGTGACCAGTGAGTAGAAGG - Intronic
924116719 1:240754279-240754301 GAGACTGAGCAGAGGGAAGAGGG - Intergenic
924925850 1:248679326-248679348 GATTGGGAGGAGTGGCAAGAGGG + Intergenic
1063426117 10:5951406-5951428 CACTGTGAGCATTTGGGAGATGG - Intronic
1063494944 10:6498422-6498444 AAATGTGGGCTGTGGGAAGAAGG + Exonic
1064469605 10:15622276-15622298 GAGAGTGAGAAGTGGGAAGAAGG - Intronic
1064906024 10:20347021-20347043 GACTCTGAAAGGTGGGAAGAGGG - Intergenic
1065256045 10:23869237-23869259 GACTCTTTCCAGTGGGAAGATGG + Intronic
1067354295 10:45511395-45511417 GACCGTGGGCCGTGGGGAGAGGG - Intronic
1067440962 10:46309022-46309044 GAGAGTGAGGAGTGGGCAGATGG + Intronic
1068305936 10:55208417-55208439 GAATGTGAGAGGTGGGAAGCAGG - Intronic
1068661511 10:59627719-59627741 GACTGGAAGCAGGGGGAATAAGG - Intergenic
1068675603 10:59766591-59766613 GACTGTGAGCGGTATGTAGATGG - Intergenic
1069207077 10:65703265-65703287 GACTATGAGAAGTGGAAAGGAGG + Intergenic
1069583542 10:69581417-69581439 GAGTGTGGGCAGTGGGTAGGGGG - Intergenic
1070350501 10:75587724-75587746 TACTGTGAGAAGCTGGAAGATGG + Intronic
1070399452 10:76040546-76040568 GAGTGTGAGCAGTGGGGAAGGGG - Intronic
1070475586 10:76826115-76826137 GTTTGTGAGAACTGGGAAGAGGG - Intergenic
1070566940 10:77610719-77610741 GACTGGGAGCAGAGGGAATAGGG + Intronic
1070624984 10:78044674-78044696 GACTGTGGGCACTGGGAGGCAGG - Intronic
1070698538 10:78581595-78581617 GAGTGAGACTAGTGGGAAGAAGG - Intergenic
1070703609 10:78621186-78621208 TTCTGTTACCAGTGGGAAGATGG - Intergenic
1070712349 10:78691856-78691878 ACCTGTGAGCAGTGGGGAGTTGG + Intergenic
1070814970 10:79317275-79317297 GACTGTCCACAGAGGGAAGAAGG + Intergenic
1070839673 10:79475406-79475428 GGCTGTGAGGGGTGGGCAGAGGG + Intergenic
1072417387 10:95260541-95260563 CACTGTGTGCACTGGGAGGAAGG + Intronic
1072674576 10:97456108-97456130 GCCTGTGAGCACTTGGAATATGG + Intronic
1072917237 10:99545556-99545578 GAGGGGGAGCAGTGGGAGGAGGG + Intergenic
1073284832 10:102381349-102381371 GTCTGTGAGCCGAGGGAAGAAGG + Intronic
1073755926 10:106580412-106580434 GACTGTGAGATGGGGGAAGGTGG - Intronic
1073928558 10:108546179-108546201 GACTGTGAGGAGTAGGGAGTGGG + Intergenic
1074270406 10:111947915-111947937 GAGTGTGGGGAGTGGGAGGAGGG + Intergenic
1074290965 10:112137728-112137750 GTCTGAGATCTGTGGGAAGAAGG - Intergenic
1074349412 10:112721232-112721254 GACCATGAGAAGTTGGAAGATGG - Intronic
1075875591 10:125803397-125803419 CACACTGAGCTGTGGGAAGACGG + Intronic
1076571632 10:131437215-131437237 GGCTGTGGGCAGTGGGTGGAGGG - Intergenic
1076801810 10:132834441-132834463 GACCGTGGGCAGTGGGCAGTGGG + Intronic
1076937321 10:133575094-133575116 GTCTGTGAGCACAGGGAAGGAGG + Intergenic
1077111457 11:863964-863986 GACTGTGACGTGTGGGCAGAAGG + Intronic
1077121143 11:909170-909192 GCCGGTGAGCAGTGGGGAGCGGG - Intronic
1077739263 11:4826923-4826945 GACTTTCAGCAATGGGAAAAAGG - Intronic
1077838258 11:5944355-5944377 GCCTATGAGCTGTGGGAAGCAGG + Intergenic
1077921247 11:6643317-6643339 GAGTGTGAGAAGTGAGAAAATGG - Intronic
1078317640 11:10305961-10305983 GGCTCTGAGTCGTGGGAAGAGGG + Exonic
1078664530 11:13313707-13313729 GAATGTGGGCAGTGGAATGAGGG - Intronic
1079117005 11:17646279-17646301 GGGTGAGAGCTGTGGGAAGATGG + Intronic
1079177411 11:18155768-18155790 GACTGTAAGCTCTGTGAAGATGG - Intronic
1079328187 11:19512173-19512195 GACTCTGAGGGGTGGAAAGAGGG + Intronic
1080462857 11:32471027-32471049 GATTCTGGACAGTGGGAAGATGG - Intergenic
1080485417 11:32701837-32701859 GAATGTGAGGAGTGTGAAAAAGG - Intronic
1081977089 11:47242559-47242581 GAGGGTGAGAAGTGGGGAGAAGG + Intronic
1083332865 11:61907101-61907123 GGCTGGGAGGAGAGGGAAGAAGG + Intronic
1083397662 11:62402446-62402468 CGCTGTGGGCAGAGGGAAGAGGG - Intergenic
1084409220 11:68996855-68996877 CCCTCTGAGCAGTGGGAAGCCGG + Intergenic
1084581881 11:70029268-70029290 GCCTGTGTGCAGAGGGAAGAGGG - Intergenic
1084793188 11:71488003-71488025 GGCTGTGACCCGTGAGAAGAAGG - Intronic
1085127525 11:74011760-74011782 GCCTGTGAGCAGTGTGCAGCTGG - Intergenic
1085448772 11:76618217-76618239 GACTGTGAACTGTGAGAATAGGG - Intergenic
1085955412 11:81387286-81387308 TACTGGGAGCAGTGAGAAGGGGG - Intergenic
1089518346 11:119047866-119047888 GAGTGTGGGGAGTGGGAAGCTGG + Intronic
1090524893 11:127522405-127522427 GACTGGGAGCTGGGGAAAGAGGG + Intergenic
1091094083 11:132802214-132802236 GACTGTGTGCTGGGGGAAGGAGG - Intronic
1091182947 11:133623427-133623449 GACTGTGTGCAATGGGAAGATGG + Intergenic
1091198128 11:133749122-133749144 CACTGTGTGCTGTGGGGAGAGGG + Intergenic
1091663400 12:2400993-2401015 GTCTGAGGGCAGTGGGGAGAAGG - Intronic
1091828491 12:3532975-3532997 GACTGAGAGCAGTGGGCAGCAGG + Intronic
1092119490 12:6034115-6034137 GAATGGGAGGAGTGGGAGGATGG - Intronic
1092526137 12:9311389-9311411 GACTGGGAGCAGTGGGGATGAGG - Intergenic
1093084716 12:14853879-14853901 GACTTTGGGGAGTGGGTAGATGG + Intronic
1093486275 12:19656330-19656352 GACACTGAGCAGTGGCCAGAAGG + Intronic
1093531409 12:20169181-20169203 GACACTTAGCAGTGGGATGATGG + Intergenic
1096008979 12:48197128-48197150 TACTGTTAACAGTTGGAAGAGGG + Intergenic
1097641887 12:62192080-62192102 ATCTGCGAGCAGTGGGAACAGGG - Exonic
1098622342 12:72617593-72617615 GACTGTTAACATAGGGAAGAGGG - Intronic
1099135172 12:78888794-78888816 GACAGTGAGCAGGAGGAAGGAGG - Intronic
1100396758 12:94192548-94192570 GCCTGTCAGCTATGGGAAGAAGG + Intronic
1101980279 12:109399964-109399986 AACAGTGGGCAGTGGGAAGGGGG - Intronic
1101997651 12:109536369-109536391 GACTGTCAGCACAGGGAAGATGG + Exonic
1103611875 12:122129104-122129126 GACAGAGAGCAGAGTGAAGAGGG - Intronic
1103919166 12:124390549-124390571 GCCGATGAGCAGTGGGACGAGGG - Intronic
1104252995 12:127113692-127113714 AACTATGAGAAGTGGGGAGAAGG + Intergenic
1105323193 13:19346678-19346700 AAATGTGAGCAGTGGGAGAATGG - Intergenic
1105874196 13:24539187-24539209 AAATGTGAGCAGTGGGAGAATGG + Intergenic
1107115926 13:36745475-36745497 CACTGTGAGGAGTGAGCAGAGGG - Intergenic
1108117714 13:47147717-47147739 TATTGGCAGCAGTGGGAAGAGGG + Intergenic
1109257567 13:60101794-60101816 GAGTGGGAGAAGTGGCAAGATGG - Intronic
1110401396 13:75095991-75096013 GACACTGAGCAGTGTGAGGAGGG + Intergenic
1110536270 13:76654130-76654152 GAGGGTGGGGAGTGGGAAGAGGG + Intergenic
1111315666 13:86555751-86555773 GACTGTGAAAAGTTGGTAGAAGG - Intergenic
1111414854 13:87926822-87926844 GAGGGTGTGGAGTGGGAAGAGGG + Intergenic
1112659954 13:101496666-101496688 GACAGAGAGCAGTGGCAAGAAGG - Intronic
1113680748 13:112243010-112243032 AACTGTCAGCATTGGGAGGAAGG - Intergenic
1113865258 13:113517803-113517825 GACTGTGGGTGGAGGGAAGAGGG + Intronic
1115258371 14:31426932-31426954 GACTTTAAGAAGTGGGAAGGTGG + Intronic
1115454403 14:33584961-33584983 GAATGTGAAGTGTGGGAAGAAGG + Intronic
1116342924 14:43749572-43749594 GGCTGAGAAAAGTGGGAAGAAGG - Intergenic
1117119311 14:52551945-52551967 ATCTGTGAGCAGGGGGAAGCTGG - Intronic
1119264398 14:73255460-73255482 GACTGTGTGCTGAGGGAAGGAGG + Intronic
1119537952 14:75418354-75418376 AACTCTGACCTGTGGGAAGAAGG + Intergenic
1120624020 14:86802492-86802514 GACGAAGAGAAGTGGGAAGATGG - Intergenic
1121069316 14:91002801-91002823 GGCTGAGAGAAGAGGGAAGAGGG - Intronic
1121441425 14:93952077-93952099 GACTGGCAGCAGGGGGAGGAGGG + Intronic
1122149407 14:99716862-99716884 GACACTGGGCACTGGGAAGATGG + Intronic
1122238036 14:100344070-100344092 GACCGTGGGGAGAGGGAAGAGGG - Intronic
1122328060 14:100894575-100894597 TACTGTGTGCTGAGGGAAGATGG - Intergenic
1122809565 14:104281340-104281362 GGCTGTGAGCAGGGGGAGGGCGG - Intergenic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1123402527 15:20002802-20002824 CATGGTGAGCAGGGGGAAGAAGG + Intergenic
1123511865 15:21009456-21009478 CATGGTGAGCAGGGGGAAGAAGG + Intergenic
1124249492 15:28097540-28097562 AACTGTTAGTAGTGGAAAGATGG - Intronic
1124786507 15:32686388-32686410 GACTGTGAACACCGTGAAGAAGG + Intronic
1125198671 15:37078290-37078312 GCCGGTGAGAAGTGGCAAGAAGG + Intronic
1125254196 15:37744691-37744713 GACTCTGAGCAGTGCGGAGGAGG - Intergenic
1126330158 15:47523089-47523111 CACTGTTAGCAGATGGAAGATGG - Intronic
1127282250 15:57502315-57502337 GCCTGAGAGCTGTGGGAAAATGG + Intronic
1127783148 15:62333311-62333333 GACCGTGGGCCGTGGGGAGAGGG + Intergenic
1127870688 15:63070783-63070805 GACGGTGTGCCGTGGGAACAGGG - Intronic
1130655295 15:85788362-85788384 GACAGGGAGGTGTGGGAAGATGG - Intronic
1130766651 15:86877850-86877872 GAATGTGAGAAGAGAGAAGAAGG - Intronic
1131578636 15:93617929-93617951 GACTGTGGGAACTGGAAAGAAGG - Intergenic
1131642532 15:94307770-94307792 GGCTGTGGGCAGAGGGAAAATGG + Intronic
1132724971 16:1334471-1334493 GTCGGTGAGCAGAGGGAGGAGGG + Intronic
1132978432 16:2721609-2721631 GAGGGCGAGGAGTGGGAAGAGGG + Intergenic
1133684303 16:8151092-8151114 GGCTGTGAGCAGTGAGAAATGGG - Intergenic
1133744375 16:8675495-8675517 GATTGGGAGCGGTGGGAGGATGG - Intronic
1133978768 16:10618699-10618721 GGCTGTGAACTGGGGGAAGAAGG + Intergenic
1134839906 16:17393452-17393474 GACTGTGAAGAGTGGGAGGGTGG - Intronic
1135030914 16:19037831-19037853 ACTTGTGAGCAGTGGGATGAAGG - Intronic
1137447854 16:48543090-48543112 GGCTGGCAGCAGTGGGAAGTGGG + Exonic
1137572820 16:49577971-49577993 CACTGTGGGCAGGTGGAAGAAGG + Intronic
1137826849 16:51505249-51505271 GACTGAGTGCAGTGAGAGGATGG - Intergenic
1137906111 16:52323611-52323633 GATAGTGTTCAGTGGGAAGAAGG - Intergenic
1137936531 16:52640229-52640251 GTCTGTGAGAAGAAGGAAGAGGG + Intergenic
1138291877 16:55854866-55854888 GACTGAGAACAGAAGGAAGAAGG - Intronic
1138984081 16:62305620-62305642 GACTGTGGGCAGAGGGAATGGGG + Intergenic
1139235924 16:65339003-65339025 CACTGTGAACTGTGGTAAGATGG + Intergenic
1140417624 16:74787412-74787434 GAGTGGGAACAGGGGGAAGAAGG - Intergenic
1141364695 16:83431944-83431966 GATTTTGAGCAGAGGAAAGAGGG + Intronic
1141940037 16:87269579-87269601 GCCTGTGAGCTGTGGAAGGAGGG + Intronic
1142998880 17:3778009-3778031 GACTGTGAGCCCCAGGAAGAGGG + Intronic
1143984051 17:10895846-10895868 GGCGGAGATCAGTGGGAAGAAGG + Intergenic
1144128941 17:12227249-12227271 GAGTGGGAGAAGTGGGGAGATGG - Intergenic
1144843130 17:18200928-18200950 GCATGTGAGCAGTGGGGTGAGGG + Intronic
1145772599 17:27504434-27504456 GACAGTGAGCAGTGCCATGATGG + Intronic
1146761601 17:35483474-35483496 GACAGTCTGCAATGGGAAGAAGG + Intronic
1147007312 17:37413942-37413964 GAGGGTGAACAGTGGGAGGAGGG - Intronic
1147036315 17:37684097-37684119 CACAGAGAGCACTGGGAAGATGG - Intergenic
1147038068 17:37696487-37696509 GAGTGTGAGCAGGAGGGAGAAGG - Intronic
1147904888 17:43816335-43816357 GAGTGTGAGCAGTGTGAATAGGG + Intronic
1147918227 17:43901040-43901062 GACTGAGAGCAGAGGTCAGAGGG - Intronic
1148521454 17:48279860-48279882 AACTGTGAGCACAGGAAAGAAGG - Intronic
1148546185 17:48520745-48520767 TTCTGTGGGAAGTGGGAAGATGG + Intergenic
1148828775 17:50415355-50415377 GACTGTGAGCGGTACGTAGACGG - Intergenic
1149106613 17:52975063-52975085 TAGTGTGAGCAGTGGGGAAAAGG + Intergenic
1149427599 17:56570123-56570145 GACTATGAGAAGAGGGAGGAAGG + Intergenic
1150899785 17:69259547-69259569 GACTGGGAGCTATGGGAATAGGG + Intronic
1150909023 17:69369037-69369059 AACTGTGAACAGTGGGAAGATGG - Intergenic
1151245436 17:72790885-72790907 GACCCTGAGCAGAAGGAAGAAGG + Intronic
1151635399 17:75344225-75344247 GACTGTGAGTAGAAGGAACATGG + Intronic
1151885321 17:76920147-76920169 GGCTGTTGGCAGTGGGCAGATGG + Intronic
1152829598 17:82489143-82489165 GGCTGTGAGGAATGGGAGGAGGG - Exonic
1152829620 17:82489224-82489246 GGCTGTGAGGAATGGGAGGAGGG - Exonic
1153495737 18:5696944-5696966 GACTGGGAGTAGTGGGGGGATGG - Intergenic
1153830573 18:8918693-8918715 GACTGTGAGCAGTACGTGGATGG + Intergenic
1153860352 18:9197454-9197476 GACTGTGTGAAGGGGGAAAAAGG - Intronic
1154079674 18:11243567-11243589 GGCTGTGAGCAGAGGGGTGACGG + Intergenic
1155156584 18:23162826-23162848 GAGTATAAGCAGCGGGAAGAGGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156618593 18:38820826-38820848 GTCTATCAGCAGTGGGAAAAGGG - Intergenic
1156718856 18:40045524-40045546 GACTTAGAGCAGTAGGAAAAGGG + Intergenic
1157249858 18:46085387-46085409 CACTTTGAGAGGTGGGAAGATGG + Intronic
1160293531 18:77617097-77617119 CACTCTGAAAAGTGGGAAGAAGG - Intergenic
1160509839 18:79447232-79447254 GTCAGTGGGCAGAGGGAAGATGG - Intronic
1160829782 19:1098379-1098401 CCCTGTGAGCAGTGAAAAGAGGG + Intergenic
1160840543 19:1145132-1145154 GACTAGGAGCAGGGGGAAGAGGG + Intronic
1163268760 19:16236507-16236529 GACTTTGGGCATCGGGAAGATGG + Intronic
1164696389 19:30247574-30247596 CACTTTGGGAAGTGGGAAGATGG + Intronic
1165064494 19:33221078-33221100 GGCTTTGAGCAGAGGGATGATGG - Intronic
1165245589 19:34496718-34496740 GAGTGAGGGCAGGGGGAAGAGGG + Intronic
1165446840 19:35861244-35861266 GACTGTGAACGGTGAGAAGGCGG + Exonic
1165707820 19:37988880-37988902 GACTGTGTGGAGTGGGAGGGAGG - Intronic
1165778962 19:38421061-38421083 GACTGTGAGCTATGGGTGGAGGG - Intronic
1166169726 19:41019252-41019274 GCCTGTGGCCAGTGGGAAGCTGG + Intergenic
1166391000 19:42408900-42408922 CAGAGTGAGCAGTGGGGAGAGGG + Intronic
1166515130 19:43440802-43440824 GTGTGTGAGCAATGGAAAGAAGG + Intergenic
1166792491 19:45406186-45406208 GACTGGGAGAAGCGGGAAAATGG - Intronic
1167006998 19:46782664-46782686 GACTGGGAGCCTTGGGAGGAAGG - Intronic
1167723996 19:51198871-51198893 TGCTGTGGGCAGTGGGGAGAGGG + Intergenic
1167744574 19:51342964-51342986 GGCTGTGAGCAGGGGGAGGCAGG - Intergenic
1168145555 19:54418644-54418666 GACAGTGAGCAGGGAGGAGAGGG + Intronic
925227678 2:2199827-2199849 TACTGTGTGTAGTGGGAAGCAGG - Intronic
925228245 2:2205605-2205627 GACTGGCAGCAGTGGAGAGAGGG - Intronic
925897340 2:8482811-8482833 GACTGTGAGGAGAGTGGAGAGGG + Intergenic
925994627 2:9281993-9282015 GAGCATGAGCAGAGGGAAGAAGG - Intronic
926019695 2:9484219-9484241 GACAAGGTGCAGTGGGAAGAAGG - Intronic
927239009 2:20903314-20903336 GACTGTGTGCAGTGGGGCCAAGG - Intergenic
927333812 2:21897149-21897171 GACTGTGAGAAGGGAGGAGAGGG + Intergenic
928889660 2:36189031-36189053 GACTGGGAGCTAAGGGAAGAGGG - Intergenic
928955403 2:36861916-36861938 GACTGTGAAGGGTGGGAAGAGGG - Intronic
929434119 2:41914252-41914274 GAGTGAGAGCGGTGGAAAGAGGG - Intergenic
929660553 2:43780081-43780103 GACTGTTAGTGGGGGGAAGAGGG + Intronic
929953837 2:46440018-46440040 GACTGAGAGCAGGCAGAAGAGGG + Intronic
931091694 2:58893365-58893387 GACTGTGAGCCCTGGGATGGAGG - Intergenic
931221893 2:60295781-60295803 GGCTGTCAGCATTAGGAAGAGGG - Intergenic
931423754 2:62152109-62152131 GGAGGTGAGCAGAGGGAAGATGG - Intergenic
931611732 2:64108674-64108696 GACTGTGAAAAGTGGAGAGAAGG + Intronic
931908802 2:66871635-66871657 GACTATGAGCATTGGGATGTTGG + Intergenic
932534316 2:72576256-72576278 GACTGTGATCTGTGGAAAGCAGG + Intronic
932981989 2:76680712-76680734 GGCTGTTAGCTCTGGGAAGAAGG - Intergenic
934065817 2:88340694-88340716 GCCAGTGAGAAATGGGAAGAAGG - Intergenic
934555014 2:95282479-95282501 GACAGTGAGCAGGAGGATGAGGG + Intronic
934962314 2:98687503-98687525 GAAAGTGAGAAGAGGGAAGAAGG - Intronic
935654797 2:105412854-105412876 GAATGTGATCAGTGGCATGATGG + Intronic
935673685 2:105576288-105576310 CTCTGTGAGCAGGGGGAGGAGGG + Intergenic
935949544 2:108316343-108316365 GAGTGGGAGAGGTGGGAAGAAGG - Intergenic
937639606 2:124196643-124196665 GACTGTTTACAGTGGGAAGTGGG - Intronic
937936145 2:127247141-127247163 GACTGTGAGAAGTGGGGAGGCGG - Intergenic
938829295 2:135034807-135034829 GACCGTGGGCTGTGGGGAGAGGG + Intronic
939270668 2:139935349-139935371 GTCTGTGAGGAGAGGAAAGAGGG - Intergenic
939857758 2:147381064-147381086 GACAGAGGGCAGTGTGAAGAAGG + Intergenic
942959304 2:181811039-181811061 GACTGGTAGCAGTGGGCAGCAGG + Intergenic
943567184 2:189529902-189529924 AACTGTGATCAGTGCTAAGATGG + Intergenic
946082710 2:217137833-217137855 GACTATGAGAAGTGGGAGGGAGG - Intergenic
947293433 2:228603276-228603298 TACAGTGAGCATTGGGAAGTTGG + Intergenic
948808903 2:240465136-240465158 GACACTGTGCAGTGAGAAGATGG + Exonic
948880670 2:240855759-240855781 GACTGTGACCTGTGGGGAGAGGG - Intergenic
948909620 2:240996520-240996542 GAAGGTCAGCAGTGGGGAGAAGG + Intergenic
1169066760 20:2698227-2698249 TGCTGGGGGCAGTGGGAAGAGGG + Intronic
1169102456 20:2962959-2962981 GACTGTGAGTCCTGTGAAGATGG + Intronic
1169209964 20:3760344-3760366 GAATGTGGGCAGTCGGTAGAGGG - Intronic
1172217052 20:33243158-33243180 ATCTGTGAGCACTGGGAAGCTGG - Exonic
1172301206 20:33851826-33851848 GACTGTGAGCATCTGGGAGAGGG - Intronic
1172693048 20:36803642-36803664 GACTGTGAGCAGTGGGAAGAAGG + Intronic
1173337445 20:42124307-42124329 GTCTGTGAGCAATGGGAAAGAGG + Intronic
1173587759 20:44196759-44196781 GACTGGCAGCAGTGGGTATATGG - Exonic
1173759886 20:45550135-45550157 GAGTGTGATAAGTGGGAAGATGG + Intergenic
1174097766 20:48102816-48102838 GACTGTTAGCTGTGGGGAGCTGG + Intergenic
1174183569 20:48690028-48690050 GACTCTGAGCTGTGGGGCGAAGG + Intronic
1174396860 20:50252024-50252046 GACTGTCAGCTCTGGGAAGGCGG - Intergenic
1175076811 20:56382292-56382314 GACTGTGGCCAGCGGGAAGCAGG + Intronic
1175697694 20:61114882-61114904 CACTGTGGGCAGTGGGCAGTGGG + Intergenic
1175697696 20:61114889-61114911 GGCAGTGGGCAGTGGGCAGAGGG + Intergenic
1176186980 20:63785782-63785804 GGCTGTGAGCTGTGTGAGGATGG - Intronic
1177154263 21:17485628-17485650 GACGGTGAGGAGTGGGAAGGAGG - Intergenic
1177259182 21:18706909-18706931 GAGGGTGAACAGGGGGAAGAGGG - Intergenic
1177334554 21:19706911-19706933 CACTATGAGCAGTGTGAAAATGG + Intergenic
1177667850 21:24184995-24185017 GACTGTGATCAGTCTGGAGACGG + Intergenic
1178421134 21:32444308-32444330 GACTGTGACTGCTGGGAAGAAGG - Intronic
1178897216 21:36568760-36568782 GTCTGTGAGAAGAGGAAAGAGGG - Intronic
1178966139 21:37120128-37120150 TACTGTGAGAAGTGGGAACATGG + Intronic
1179670701 21:42945416-42945438 GACTGTGAGCAGTACGTGGAGGG - Intergenic
1179830248 21:43992033-43992055 GAGTGTGCGCAGTGGCAAGGGGG + Intergenic
1181469540 22:23129242-23129264 GACAATGAGCAGAGGGAGGAAGG - Intronic
1181482837 22:23211957-23211979 GACAGTGGGAAGTGGGAACAGGG - Intronic
1181506459 22:23361582-23361604 GACTGAGAACAGAAGGAAGAAGG - Intergenic
1182087731 22:27573244-27573266 GACTGTGAGGAGGAGGAAGGAGG + Intergenic
1182910631 22:33981284-33981306 GGCTGTGAGGAGTGGGAAAAAGG - Intergenic
1183030807 22:35103060-35103082 GACTGTGAGGGGTGGGAGGAGGG - Intergenic
1183540306 22:38426127-38426149 GACTCTGAGGGGTGGGATGAGGG - Intergenic
1183899734 22:40996091-40996113 GACTGTGAGTAGTGAGAACCCGG - Intergenic
1183933199 22:41247826-41247848 GGCTGGGAGCTGAGGGAAGAGGG + Intronic
1183980569 22:41537459-41537481 GAGAGGGAGCAGTGGGAACAGGG + Intronic
1184049146 22:41991413-41991435 GACCCTGAGCAGCAGGAAGATGG - Intronic
1184598811 22:45530436-45530458 CACTGGTAGCAGTGGGAGGAAGG - Intronic
1185164402 22:49251912-49251934 GAGTGTGAGCTGAGGGAAGGAGG + Intergenic
1185253496 22:49818324-49818346 GACTGTGATCAGCAGGCAGACGG - Intronic
949127055 3:458706-458728 GACTGTCAGCAGTGCGAGGGAGG - Intergenic
949771000 3:7578152-7578174 GAATGTCAGGAATGGGAAGAGGG + Intronic
949816785 3:8067613-8067635 GACTTTGAGGAGTGGAGAGAAGG - Intergenic
950545779 3:13637187-13637209 CACTGGGTGCACTGGGAAGAAGG + Intronic
951798825 3:26572546-26572568 GACTGTGTGGAGTGGGGGGAGGG - Intergenic
954001915 3:47564395-47564417 GGCTGTGGGCAGTGGGCAGCTGG - Intronic
954279893 3:49569910-49569932 GATTTTGAGTATTGGGAAGAGGG + Intronic
955694205 3:61619420-61619442 GACTGTCAGGACTGGGAGGATGG + Intronic
956245170 3:67174889-67174911 GACAGAGAGCAGAGCGAAGAAGG - Intergenic
957037093 3:75303590-75303612 GACTGAGAGCTGAGGGGAGAGGG - Intergenic
957050258 3:75406229-75406251 GACTGTGACTGCTGGGAAGAAGG + Intergenic
957311644 3:78527535-78527557 GATTGTGAGCTCTGAGAAGATGG - Intergenic
957997280 3:87706482-87706504 GAGTGGGAGATGTGGGAAGATGG - Intergenic
959157083 3:102679711-102679733 GATTGGGATCAGTGGAAAGAGGG + Intergenic
959320807 3:104872639-104872661 AACTGGTAGCAGTGGGAAGCTGG - Intergenic
960681786 3:120255710-120255732 GAGGGTGAAGAGTGGGAAGAGGG + Intronic
960991444 3:123314181-123314203 GGCTGAGAGAAGCGGGAAGAAGG + Intronic
962097560 3:132307755-132307777 GACTGTGAGCAGTACGTGGACGG + Intergenic
962277249 3:134024983-134025005 GACTGTGAGCAGTATGTGGACGG + Intronic
963062907 3:141239741-141239763 GAGTGTGAGCATTGGGCAGTGGG - Intronic
963703771 3:148659912-148659934 GTCTGTTAGCCGTTGGAAGATGG + Intergenic
963971359 3:151432666-151432688 TACTGAGAGCAGTGACAAGAGGG + Intronic
964455393 3:156860065-156860087 GACTCTGAAAAGTGGAAAGAAGG - Intronic
964848749 3:161071132-161071154 GGCTGTGAGCAGTGCTGAGATGG + Exonic
965032314 3:163388009-163388031 GATTGTGAGGAGTGGGGAGGTGG + Intergenic
965550786 3:169962939-169962961 GACTGCTTGCAGTGGGAAGGAGG - Intergenic
965899945 3:173627196-173627218 GAGTGGGAGGAATGGGAAGATGG - Intronic
966039705 3:175467001-175467023 AACTGTGTGCAGTGTGATGATGG - Exonic
967873873 3:194253128-194253150 TACAGGGAGCAGTGGCAAGAAGG + Intergenic
968726007 4:2248119-2248141 GACAGGGAGCAGTGGGAGGTTGG + Exonic
969240879 4:5896470-5896492 GACTAGGAGCAGTTGGAGGATGG - Intergenic
969943921 4:10763301-10763323 GGCTGTGAGTAGTGAGCAGAAGG + Intergenic
972153227 4:36122603-36122625 GAGGGTGAAGAGTGGGAAGAGGG + Intronic
972306687 4:37837459-37837481 GACTGTGAGTGATGGAAAGAAGG - Intronic
972963745 4:44485671-44485693 GACTGTAAGCAGTTGGGACATGG - Intergenic
975147062 4:70980143-70980165 GAGTGTGTACAGGGGGAAGATGG - Intronic
975727847 4:77309302-77309324 GAATGTGGAGAGTGGGAAGAGGG - Intronic
975822172 4:78282820-78282842 GAGGGAGAGAAGTGGGAAGATGG + Exonic
978393762 4:108255687-108255709 GACTGTGAGAAGTGGAGACATGG + Intergenic
979149892 4:117297942-117297964 GAATGTGAGCAGCAGTAAGATGG - Intergenic
981038770 4:140200245-140200267 GAAGGAGAGGAGTGGGAAGAGGG + Intergenic
982717447 4:158823879-158823901 GACTGAGAGTAGAGGGAAGATGG + Intronic
983509085 4:168588193-168588215 CACTGTGAGCCCTGGGAGGATGG + Intronic
984553980 4:181192295-181192317 TACAGTGAACACTGGGAAGAAGG + Intergenic
985706791 5:1406135-1406157 GAGTGGGGGCAGTGGGCAGACGG + Intronic
987299896 5:16588030-16588052 GACTGGGAGCAGTGGGGAGGGGG - Intronic
988390156 5:30617158-30617180 GACTGTGAGGGGTGGGGGGAAGG - Intergenic
988925608 5:35988663-35988685 AAATGTGAACAGTGAGAAGATGG + Intronic
990552828 5:56901238-56901260 GACTGTTAGGAGCGGGTAGAGGG - Intergenic
990796289 5:59544688-59544710 CACAGTGAGTAGTGGGGAGAAGG + Intronic
991573253 5:68077378-68077400 GACTGAGGGAAGGGGGAAGAGGG + Intergenic
991600374 5:68346130-68346152 AACTATGTGTAGTGGGAAGAAGG - Intergenic
992887772 5:81176127-81176149 GACTGTGAAAAGTGGTGAGATGG - Intronic
993448711 5:88046911-88046933 GACTCTGAGCAGGGGGAAAGGGG + Intergenic
994070779 5:95599481-95599503 TACTGTAAGCAGTGGAAAGAAGG - Intronic
996003528 5:118392452-118392474 GACTTTGTGAAGAGGGAAGATGG - Intergenic
996605903 5:125321704-125321726 GAATGTGAGCAGTAGGAGGTTGG + Intergenic
996979266 5:129470561-129470583 GACTGAGAGAAGTGAGAAAATGG + Intronic
997564318 5:134875253-134875275 GACTATGAGGAGTGGGGTGAAGG - Intronic
998059907 5:139111832-139111854 GACCGTGGGGAGTGGGGAGAGGG - Intronic
998874269 5:146583599-146583621 ATCTGTGAGCTGTGTGAAGATGG + Intronic
999136708 5:149325320-149325342 GACTGGCAGCTGGGGGAAGAAGG - Intronic
999715153 5:154354518-154354540 GACTATGACCAATGGGAAGCAGG - Intronic
1000237010 5:159371219-159371241 GACTGTGAGCAGTACGTGGATGG + Intergenic
1000719006 5:164682234-164682256 GAAAGTCAGCAGTGTGAAGATGG - Intergenic
1000721870 5:164718388-164718410 GAGGGTGAGGAGTGGGAGGAGGG - Intergenic
1000801365 5:165730647-165730669 GACTGTGGGGACTGGGAGGATGG + Intergenic
1001218118 5:169874774-169874796 GACTGAGAGAGGTGGGAGGAAGG + Intronic
1002437781 5:179242747-179242769 GACTGGGATCTGAGGGAAGAGGG - Intronic
1002913605 6:1510475-1510497 GACTGGGAGCTGAGGGTAGAGGG + Intergenic
1002963117 6:1936257-1936279 CAATGTGAGCAGTGGCAAGAGGG + Intronic
1004020801 6:11774410-11774432 GCCTGTGAACAGTGAGAAGATGG - Intronic
1005000917 6:21240742-21240764 AACTGAGGGGAGTGGGAAGAAGG + Intergenic
1005441447 6:25873525-25873547 GGCTGAGGGCAGTGGGAAGGAGG - Intronic
1006266649 6:32931345-32931367 GCCTAAGAGCAGAGGGAAGAGGG + Intergenic
1006309619 6:33248676-33248698 GAATGTGAGCCGTGGGGCGAAGG - Intergenic
1006375292 6:33668482-33668504 GACAGCCAGCGGTGGGAAGAGGG - Intronic
1007018198 6:38490723-38490745 GTCAGTGAGAAGAGGGAAGAAGG + Intronic
1007075031 6:39060856-39060878 GAGTGTGTGCATTGGGGAGAAGG + Intronic
1007691718 6:43706748-43706770 GACAGTTGGCACTGGGAAGATGG - Intergenic
1007922360 6:45621874-45621896 GAGTGAGAGCAGTGGAAAAATGG + Intronic
1008475568 6:51932165-51932187 GACTGTAAGCAATGGGACTAGGG + Intronic
1009313459 6:62187908-62187930 GATTGTCAGCAGTAGGAACATGG + Intronic
1010680399 6:78792470-78792492 GAGTGTGGACAGTGGGAGGAGGG + Intergenic
1010787760 6:80024589-80024611 GGCTGGGAGCAGTGGGGAGTGGG + Intronic
1010972078 6:82273737-82273759 AACTGTTAGCACTGTGAAGAAGG + Intergenic
1011110934 6:83836038-83836060 GACGGTGAGGAATGGGAAAAGGG + Intergenic
1012445121 6:99299266-99299288 GACAGTGACCAGTGGGAAGTGGG - Intronic
1012935401 6:105362792-105362814 GACTGTGCCAACTGGGAAGAGGG + Intronic
1012983871 6:105854896-105854918 GACCGTGGGCCGTGGGGAGAGGG + Intergenic
1013204389 6:107933708-107933730 GACCGTGGGCCGTGGGGAGAGGG - Intronic
1013226327 6:108121485-108121507 GACAGTGAGGTGTGGGAAGGTGG - Intronic
1013544229 6:111140004-111140026 GAGTGGGAAGAGTGGGAAGAGGG + Intronic
1013967437 6:115971898-115971920 GACTAAGAGCAGAGAGAAGAGGG + Intronic
1014473283 6:121842167-121842189 GAATGTAAGCAGTGGCAATAAGG - Intergenic
1015020981 6:128474673-128474695 GACAGTGAGCATTGGTATGAAGG - Intronic
1015156436 6:130101629-130101651 GACTGAGAGCAGTGGCGTGAGGG + Intronic
1015273184 6:131358121-131358143 GACTGTGAAAGGTGGGGAGAAGG + Intergenic
1015502045 6:133944898-133944920 CACTGTGATTGGTGGGAAGAAGG - Intergenic
1015512102 6:134048112-134048134 CACTGTGAGCACTGGGCAAATGG - Intronic
1016737359 6:147493890-147493912 GACTCTGAGGAGCGGGAGGAGGG - Intergenic
1017277021 6:152581546-152581568 GGCCATGAGCAGTGGGAAGTTGG - Intronic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1018111920 6:160544616-160544638 GACCTTGAGCTGGGGGAAGAAGG - Intronic
1018245187 6:161815763-161815785 GTCTGTGTGTAGGGGGAAGACGG + Intronic
1018366832 6:163129650-163129672 CCCTGTGATCAGTAGGAAGATGG - Intronic
1018413593 6:163581669-163581691 GACTGTGAGCTGTTTGAAGCAGG - Intergenic
1018706305 6:166465779-166465801 GTCTGTGAGCAGCTGGAGGACGG + Intronic
1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG + Intergenic
1019508346 7:1404786-1404808 GACTGGGAGGAGTGGGAGGAGGG + Intergenic
1021398966 7:20187491-20187513 GAGTTTAAGCTGTGGGAAGAGGG - Intronic
1021956674 7:25832129-25832151 GACTTTTAGCAGTAGGAAGCAGG - Intergenic
1022280413 7:28903057-28903079 CACACTGAGCAGTGGGAACAGGG - Intergenic
1023817219 7:43960303-43960325 GACTGGGGGCAGAGGGATGAGGG + Intergenic
1023878732 7:44306902-44306924 CGGTGTGAGCAGGGGGAAGAGGG + Intronic
1023878769 7:44307042-44307064 GGCGGTGAGCAGGGGGAGGAGGG + Intronic
1023878793 7:44307119-44307141 GGGTGTGAGCAGGGGGAGGAGGG + Intronic
1023878798 7:44307139-44307161 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878803 7:44307159-44307181 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878820 7:44307236-44307258 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878830 7:44307276-44307298 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878856 7:44307376-44307398 GGGTGTGAGCAGGGAGAAGAGGG + Intronic
1026427957 7:70315506-70315528 GAGCATGAACAGTGGGAAGAGGG - Intronic
1029486285 7:100843937-100843959 GACTGTGAGCAGTATGTGGACGG + Intronic
1032928507 7:136637900-136637922 GAATGTGGGTGGTGGGAAGAGGG - Intergenic
1034517374 7:151591351-151591373 GGCAGTGTGCAGTGTGAAGATGG - Intronic
1035768424 8:2127121-2127143 GAATTTGAGCAGAGGGAAGGGGG + Intronic
1035793190 8:2326308-2326330 GTCTGTCAGCGATGGGAAGATGG + Intergenic
1035799614 8:2395397-2395419 GTCTGTCAGCGATGGGAAGATGG - Intergenic
1037102794 8:15067794-15067816 GACTGTGAGCTCTGTGATGATGG - Intronic
1037743929 8:21628607-21628629 GCCTGTGATCAGTTGGCAGAGGG - Intergenic
1037848196 8:22303494-22303516 GACTGAGGGAGGTGGGAAGACGG - Intronic
1038033418 8:23664275-23664297 GACTAAGATCAGTGGAAAGATGG - Intergenic
1038229337 8:25685836-25685858 GGGGGTGAGAAGTGGGAAGAGGG + Intergenic
1039147602 8:34466167-34466189 GACTGTGATAAGTGCTAAGAAGG - Intergenic
1041227324 8:55713393-55713415 GACTGTGAGCAGTACGTGGACGG + Intronic
1041639747 8:60184467-60184489 GGCTGGGAGCTGAGGGAAGAGGG - Intergenic
1042037060 8:64545193-64545215 GAGTGAGAGCACTGGGAAAAGGG - Intergenic
1042354531 8:67812005-67812027 GATGGTGAAAAGTGGGAAGAGGG - Intergenic
1043469157 8:80544835-80544857 GAAAGTGAGCAGAGGGAAGCTGG + Intergenic
1044294023 8:90506378-90506400 AACTGGGAGCTGTGGGATGAGGG + Intergenic
1044646254 8:94446632-94446654 GACTTTGACCAGTGGGAAATAGG - Intronic
1045180403 8:99775390-99775412 GACAGTGAGCTGTGGGGAAAGGG + Intronic
1045824726 8:106383658-106383680 GACTGTGAGCTATGTGAAGCTGG - Intronic
1045950987 8:107851363-107851385 GACAGTGAAAGGTGGGAAGAGGG + Intergenic
1046072922 8:109280522-109280544 GATTGTGAGGAGTGGGAGGATGG + Intronic
1046750684 8:117923345-117923367 GACAGTGAGCAGGGGGATGTGGG + Intronic
1046860959 8:119091198-119091220 GACTGGGCCCATTGGGAAGAAGG + Exonic
1048332256 8:133478813-133478835 GACTGGGAGCAATGTGAGGATGG + Intronic
1049399188 8:142417301-142417323 GACTCTCAGCAGTGGGAACAGGG - Intergenic
1049699927 8:144005917-144005939 GACAGTGGGCACTTGGAAGATGG - Intronic
1049726708 8:144149870-144149892 GACTGTGAGCAGTGGGCTGTGGG + Intronic
1049839107 8:144759277-144759299 GAATGTGAGGAGTGAGAACAAGG - Intergenic
1052938080 9:34110107-34110129 GAGTGGGAGCAGGGGGAAGAAGG + Intronic
1053291516 9:36882523-36882545 GGCTGTGTGCAGTTGGAGGAAGG - Intronic
1053416890 9:37952434-37952456 CACTGTGAGCAGCGGGCAGGAGG + Intronic
1055986076 9:82057248-82057270 GACAGTAAGTAGTGGAAAGATGG + Intergenic
1056585259 9:87923884-87923906 GACAGTAAGTAGTGGAAAGATGG - Intergenic
1056611621 9:88129056-88129078 GACAGTAAGTAGTGGAAAGATGG + Intergenic
1057128890 9:92639895-92639917 GCCTCTCAGCAGTGGGCAGATGG - Intronic
1057155878 9:92838848-92838870 GAGGGTGAAGAGTGGGAAGAAGG + Intergenic
1057455632 9:95207412-95207434 GACTTTGATCACTGGGCAGAGGG - Intronic
1058097563 9:100880257-100880279 AACTGTGAGAATTGGGCAGAGGG - Intergenic
1059727393 9:117022824-117022846 GGCAGTGGGCAGTGGGCAGAGGG + Intronic
1060077694 9:120607968-120607990 GAATGTGACCAGTGTAAAGATGG - Exonic
1060876083 9:127084516-127084538 CACAAAGAGCAGTGGGAAGAGGG - Intronic
1061357347 9:130116483-130116505 GACTGTGTGCAGTGGACAGGAGG + Intronic
1061436480 9:130566038-130566060 AACTTTGAGGAGTGGAAAGAAGG - Intergenic
1061999536 9:134208909-134208931 GACTGGGAACAGTGGGGAGCAGG - Intergenic
1062340711 9:136092838-136092860 GACTGTGGCCGGTGGGATGAGGG - Intronic
1062567060 9:137168101-137168123 GTCTCTGAGCAGTGGGGAGCGGG + Exonic
1062686226 9:137814848-137814870 GAGTGTGAGGGGTGTGAAGAGGG + Intronic
1203742538 Un_GL000218v1:14717-14739 GAATGTGGGCAGAGGGTAGAGGG + Intergenic
1186504421 X:10079403-10079425 GTCTGAGAGGAGTGGGTAGAAGG + Intronic
1186659193 X:11651280-11651302 GAGGGTGAGCAGTGGGAGGAGGG - Intronic
1186688623 X:11951591-11951613 GAGGGTGAGCAGTGGGAGGAGGG + Intergenic
1187380216 X:18794794-18794816 TACTGGGAGCTGGGGGAAGAAGG + Intronic
1187501300 X:19841206-19841228 GACAGTGAGCAGAGGGAGGTAGG - Intronic
1189158980 X:38791134-38791156 GAATGTGAGCAGAGAGAAGATGG - Intergenic
1189428309 X:40922991-40923013 GACTGGGGGTAGTGGGAAGTGGG + Intergenic
1189781484 X:44518189-44518211 CACTGTGATCAGTGGAATGATGG - Intergenic
1190509990 X:51164954-51164976 GACTGTGGGCAGTAGGTGGATGG + Intergenic
1190713877 X:53088212-53088234 GACTGGGAGAAGTGGGTAGAGGG - Exonic
1191849018 X:65571896-65571918 GATTCTGAGCAGAGGGAGGAAGG + Intergenic
1191918999 X:66234052-66234074 AAATGTGAGGGGTGGGAAGAGGG - Intronic
1192256829 X:69468544-69468566 GAGTGTGAGCAGTGGGGCGAGGG + Intergenic
1192580807 X:72279374-72279396 ATCTGAGAGCACTGGGAAGATGG + Intronic
1193102673 X:77633591-77633613 GAATTTGAGAAGTGGCAAGAGGG - Exonic
1193552760 X:82918633-82918655 GATGGTGAACAGTGGGAGGAGGG - Intergenic
1195688159 X:107603618-107603640 TGCTGTGAGCAGAGTGAAGAGGG - Exonic
1195777497 X:108423974-108423996 GACTGTGGACAGTTGGAACAGGG - Intronic
1196279800 X:113810741-113810763 GAGTGTGTGAAGTGGGAAGCAGG + Intergenic
1196395539 X:115257944-115257966 GAATTTGTGCAGTGGGAATAAGG - Intergenic
1196999807 X:121426615-121426637 CACTGTGAGAAGTGAGAATATGG - Intergenic
1197829458 X:130626255-130626277 TACTGCCAGCACTGGGAAGAAGG - Intronic
1198792340 X:140359101-140359123 GAATGTGGGCTGGGGGAAGAGGG - Intergenic
1199286103 X:146056042-146056064 ATCTGTGAGTAATGGGAAGAGGG + Intergenic