ID: 1172694896

View in Genome Browser
Species Human (GRCh38)
Location 20:36815779-36815801
Sequence CGTCCAGCTCGTGCTCCGAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 40}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172694893_1172694896 -8 Left 1172694893 20:36815764-36815786 CCTCCGACAGCGCCACGTCCAGC 0: 1
1: 0
2: 0
3: 5
4: 114
Right 1172694896 20:36815779-36815801 CGTCCAGCTCGTGCTCCGAGCGG 0: 1
1: 0
2: 1
3: 2
4: 40
1172694892_1172694896 25 Left 1172694892 20:36815731-36815753 CCTGTGAAGGTTCGCTGAGCACA 0: 1
1: 0
2: 0
3: 11
4: 139
Right 1172694896 20:36815779-36815801 CGTCCAGCTCGTGCTCCGAGCGG 0: 1
1: 0
2: 1
3: 2
4: 40
1172694891_1172694896 28 Left 1172694891 20:36815728-36815750 CCTCCTGTGAAGGTTCGCTGAGC 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1172694896 20:36815779-36815801 CGTCCAGCTCGTGCTCCGAGCGG 0: 1
1: 0
2: 1
3: 2
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172694896 Original CRISPR CGTCCAGCTCGTGCTCCGAG CGG Exonic
904932914 1:34104663-34104685 TGTCCAGCTGGTGCTCCGTGTGG - Intronic
905405152 1:37727430-37727452 AGCCCAGCTCCTGCTCAGAGAGG + Intronic
909560876 1:77008148-77008170 TGTCCAGCTGGTGCTCAGAGGGG + Intronic
1077483056 11:2825486-2825508 CGTCCAGCCCTTGCTGCCAGGGG + Intronic
1077717836 11:4599655-4599677 TGCCCAGCTTGTGCTCAGAGAGG + Exonic
1083901645 11:65646316-65646338 CTTCCAGCACGTGTTCCTAGTGG + Exonic
1094108757 12:26839218-26839240 GGGCCAGCTCGAGTTCCGAGTGG + Intergenic
1101940711 12:109097565-109097587 CGGCCCGCGCATGCTCCGAGCGG - Exonic
1102452259 12:113050613-113050635 CATCCAGATCGTGCTCAGGGTGG - Intergenic
1103941919 12:124505923-124505945 CGTCCTGCTCCTGCTTCCAGGGG + Intronic
1104831740 12:131757234-131757256 CGTTCAGCTGGTGTTGCGAGAGG + Intronic
1104969095 12:132523147-132523169 CCTCCAGCTCCTGCTGGGAGTGG + Intronic
1123118194 14:105904212-105904234 CATCCAGATCTGGCTCCGAGGGG - Intergenic
1124514541 15:30355240-30355262 CGCCCAGGTCGTTCTCAGAGAGG + Intergenic
1127319728 15:57831314-57831336 CTTCCAGCTCCTTCTCTGAGGGG - Intergenic
1136153752 16:28368477-28368499 CCTCCAGCACCTGCGCCGAGGGG + Intergenic
1136209340 16:28746793-28746815 CCTCCAGCACCTGCGCCGAGGGG - Intergenic
1142000475 16:87661478-87661500 AGTCCAGCCCATGCTCAGAGCGG - Intronic
1143683201 17:8492850-8492872 CGTCCAGCTCCTGCTGCAGGCGG + Exonic
1147139171 17:38451985-38452007 GGTCCAGCTCTTGCACGGAGGGG + Intronic
1150221217 17:63496918-63496940 CATGCAGCTCGTTCTCCGTGCGG - Exonic
1151326165 17:73380894-73380916 TGTCCAGCTCGTACTGCGTGAGG + Exonic
1151441246 17:74130582-74130604 CGTCCAGCTCCTGCTCTGCACGG - Intergenic
1154046466 18:10910336-10910358 CGCCCAGCTCGGCCTCCCAGAGG - Intronic
1158823154 18:61184455-61184477 TGTCCATCTCGTGCTGCAAGGGG - Intergenic
1159656237 18:71032024-71032046 CGGCCAGCTAGTGTTCCGCGTGG - Intergenic
1161314916 19:3613289-3613311 CGTCCACCTCGGCCTCCGCGGGG + Exonic
1161852407 19:6744610-6744632 CCTCCAGCTCGGCCTCCGACAGG - Exonic
1162132559 19:8536317-8536339 CGTCCAGCACCTGCTTCGGGCGG - Exonic
1163013533 19:14440308-14440330 CCTCCAGCTCCTGCTCCGAGGGG - Exonic
931668561 2:64627094-64627116 AGTCCAGCCCATGCTCTGAGTGG - Intergenic
934646221 2:96060647-96060669 CCTCCAGCTCCTGCACCGTGAGG + Intergenic
942450881 2:176107517-176107539 CGTCCAGCCCGTGCGCGAAGTGG + Exonic
1172694896 20:36815779-36815801 CGTCCAGCTCGTGCTCCGAGCGG + Exonic
1178813533 21:35906187-35906209 TGTCCAGCTCCTCCTCCCAGTGG + Intronic
1183381039 22:37490684-37490706 CATCCAGCTCGCGCTCCTCGTGG - Exonic
961612667 3:128153240-128153262 CCTCCATCTCGGGCTCCTAGAGG + Intronic
966863144 3:184241695-184241717 CCCCCAGCTCGGGCTCTGAGGGG + Exonic
985111934 4:186555311-186555333 CTCCCAGCCCGTGCTCCGCGGGG - Exonic
990986752 5:61647940-61647962 CTTCCAGCCCCTGCTCTGAGAGG - Intronic
1002108701 5:176893528-176893550 CTTCCAGCTGGTGCTCCTCGTGG - Intronic
1007423951 6:41735154-41735176 CGCCCAGCGCGTGGCCCGAGCGG - Intronic
1189446316 X:41085005-41085027 CGTCCCGCTCCTGAGCCGAGGGG + Intergenic
1197529595 X:127606506-127606528 CCTCCAGTTCTTGCTCCCAGTGG + Intergenic