ID: 1172701032

View in Genome Browser
Species Human (GRCh38)
Location 20:36853863-36853885
Sequence TCCTGACACGAATGCCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 3, 3: 3, 4: 85}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172701032_1172701038 22 Left 1172701032 20:36853863-36853885 CCTCTGGGGCATTCGTGTCAGGA 0: 1
1: 0
2: 3
3: 3
4: 85
Right 1172701038 20:36853908-36853930 TCCTTTCCATGTGAACAGGAAGG 0: 1
1: 0
2: 4
3: 28
4: 335
1172701032_1172701036 18 Left 1172701032 20:36853863-36853885 CCTCTGGGGCATTCGTGTCAGGA 0: 1
1: 0
2: 3
3: 3
4: 85
Right 1172701036 20:36853904-36853926 CCCATCCTTTCCATGTGAACAGG 0: 1
1: 0
2: 0
3: 15
4: 192
1172701032_1172701040 26 Left 1172701032 20:36853863-36853885 CCTCTGGGGCATTCGTGTCAGGA 0: 1
1: 0
2: 3
3: 3
4: 85
Right 1172701040 20:36853912-36853934 TTCCATGTGAACAGGAAGGAAGG 0: 1
1: 0
2: 3
3: 35
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172701032 Original CRISPR TCCTGACACGAATGCCCCAG AGG (reversed) Intronic
901453401 1:9349719-9349741 TCCTCACACAACTGGCCCAGAGG - Intronic
902275270 1:15335061-15335083 TCCTGAAACGAATCCCCCAGGGG + Intronic
909709692 1:78633451-78633473 TAGTGACACGGATGCCGCAGTGG + Intronic
911997443 1:104784990-104785012 TGCTGACACGAAACCACCAGTGG + Intergenic
915047104 1:153027227-153027249 GCCTGACACTAATGCCTCATAGG + Intergenic
921963550 1:221062768-221062790 TTCTGACACTACTGCACCAGTGG - Intergenic
922661094 1:227430896-227430918 TCAAGACACGAAGGCCCCAGAGG - Intergenic
1065744236 10:28824727-28824749 TCCTGGAACCAATGCCCCTGAGG + Intergenic
1070486614 10:76938023-76938045 GCCTGTCCCGAATGTCCCAGGGG - Intronic
1071315432 10:84391377-84391399 TCCTAACACTAATGCATCAGTGG + Intronic
1072768598 10:98116947-98116969 TCCTGGAACCAATCCCCCAGAGG - Intergenic
1073214407 10:101828683-101828705 TCCTTCCAGGAATGTCCCAGCGG - Exonic
1075313591 10:121434270-121434292 TTCTGACACCCAGGCCCCAGCGG + Intergenic
1084794501 11:71496153-71496175 TACTGTCACTAATGACCCAGTGG + Intronic
1085397866 11:76216228-76216250 TCCTGACACAAATGCCCCTGTGG - Intergenic
1088916911 11:114234556-114234578 TCCTGAAACTCATGCCCAAGAGG + Intronic
1088997868 11:115018906-115018928 TCCTGAAACCAATTCCCCATGGG + Intergenic
1091548685 12:1521495-1521517 TCCTGGAACCAATCCCCCAGGGG - Intergenic
1104307351 12:127621602-127621624 TCATGACCCGGAAGCCCCAGAGG + Intergenic
1104592852 12:130098596-130098618 AACTGACAACAATGCCCCAGAGG + Intergenic
1105338217 13:19494764-19494786 TCCTGATCCGAATGCCCTGGCGG - Intronic
1106211424 13:27651100-27651122 TTTTGACAAGGATGCCCCAGAGG - Intronic
1107625067 13:42273434-42273456 TCCTGACAAAACTGACCCAGGGG + Intronic
1115223920 14:31084525-31084547 ACCTGACACCACTGCACCAGAGG - Intronic
1119151448 14:72363516-72363538 TCCTTACACGGGTGGCCCAGAGG - Intronic
1122788185 14:104173540-104173562 TGCTGACACGCATCCCACAGGGG - Intronic
1125818283 15:42605455-42605477 CCCTGAAACCAATTCCCCAGGGG - Intronic
1125933156 15:43614217-43614239 TCCTGACACTCATGCTGCAGGGG - Exonic
1125946254 15:43713679-43713701 TCCTGACACTCATGCTGCAGGGG - Intergenic
1129388066 15:75206814-75206836 TCCTGACAGGGTGGCCCCAGGGG - Exonic
1129518607 15:76171778-76171800 TCCAGACAAGAGTGGCCCAGTGG - Intronic
1133767457 16:8848013-8848035 TCTTGTCAAGAATGGCCCAGAGG + Exonic
1138435798 16:56999510-56999532 GCCTGGCAGGAATGTCCCAGAGG - Intronic
1141745336 16:85921936-85921958 TCCTGGCAACAAAGCCCCAGAGG - Exonic
1142349572 16:89573966-89573988 TCCAGACACCAGTGCCACAGGGG + Intergenic
1144855235 17:18263914-18263936 CCCAGGCACGAATGCCCCAAAGG - Exonic
1147555775 17:41478181-41478203 TCCAGTCACAAATCCCCCAGTGG - Intronic
1148469421 17:47884197-47884219 TCCGGACATGAAAGTCCCAGCGG + Intergenic
1150320663 17:64211713-64211735 TCCTGAAACCAATGCCCCCTTGG + Intronic
1160691072 19:460892-460914 TGCTGCCCCGAATGCCGCAGTGG - Exonic
1162090155 19:8274258-8274280 TGCTGATAGGAATGCTCCAGGGG - Intronic
1162092389 19:8289121-8289143 TGCTGATAGGAATGCTCCAGGGG - Intronic
1163322360 19:16582240-16582262 GCTTGACATCAATGCCCCAGAGG - Intronic
926175272 2:10585637-10585659 TCCTGGAACCAATTCCCCAGCGG - Intronic
927190208 2:20512173-20512195 GCCTCACACACATGCCCCAGAGG - Intergenic
929571084 2:43023493-43023515 ACCTGACAAGAAGGGCCCAGTGG + Intergenic
930774904 2:55161917-55161939 ACCTGACACGAACTCCCTAGTGG + Intergenic
936014345 2:108946408-108946430 TCCTGACACCAGTCCCCAAGGGG - Intronic
941105214 2:161344142-161344164 TCCTGAAACCACTGCCCCAAGGG + Intronic
942697640 2:178663663-178663685 TCCTGAAAAGAAAGCGCCAGTGG - Exonic
948653505 2:239463340-239463362 TCCTCACTCGGATGCCCCAAGGG + Intergenic
1169558755 20:6776257-6776279 TCCTGAAAGGTATTCCCCAGAGG + Intronic
1171488595 20:25501001-25501023 TCCTGACATGCAGGTCCCAGAGG - Exonic
1172701032 20:36853863-36853885 TCCTGACACGAATGCCCCAGAGG - Intronic
1175688794 20:61050775-61050797 ACCAGACAGGAATGCCACAGAGG + Intergenic
1175730350 20:61349983-61350005 TCCTGACATGACTGTCCCAGTGG - Intronic
1179584936 21:42368471-42368493 TCCTGAAACCAGTCCCCCAGGGG - Intergenic
1182067669 22:27442108-27442130 TCCTGCCACAGAGGCCCCAGTGG - Intergenic
1184578807 22:45398170-45398192 TCCTGACCCCAAAGCCCCAGAGG - Intronic
1185338956 22:50283196-50283218 TCCTCACCCGAGTGCCCCTGCGG - Intronic
952491752 3:33880503-33880525 TCCCCACACAAATACCCCAGGGG - Intergenic
954875671 3:53801537-53801559 TCCTGACACAAATGCCTACGGGG - Intronic
954901908 3:54027095-54027117 TCCTCTCCAGAATGCCCCAGGGG + Intergenic
960794502 3:121471270-121471292 TACTTATACGGATGCCCCAGAGG + Intronic
967886263 3:194335813-194335835 TTGTGACACAAAGGCCCCAGAGG + Intergenic
969494914 4:7520931-7520953 TCCGTGCACCAATGCCCCAGAGG - Intronic
971700062 4:29961331-29961353 TTCTGACAATAATGCCACAGAGG + Intergenic
972301571 4:37790033-37790055 TCCATACAGGAATGGCCCAGTGG + Intergenic
974941568 4:68475719-68475741 TCATGACAAAAATGCCACAGTGG - Intronic
978955538 4:114608110-114608132 TCCTGAAATGAATGCCCCAGTGG - Intronic
989978828 5:50617124-50617146 TCCTAACACGAATACCCTGGGGG - Intergenic
991992420 5:72353321-72353343 TGCTGACAAGAATGACCCACAGG - Intronic
992097791 5:73379212-73379234 TCCTGAAACCAAATCCCCAGAGG - Intergenic
1002344525 5:178538171-178538193 TCCTCACACAAGAGCCCCAGAGG + Intronic
1005356790 6:24992016-24992038 TCTTGACACCAAAGCCCTAGGGG + Intronic
1009624019 6:66113497-66113519 TCCTGGAACCAGTGCCCCAGAGG + Intergenic
1018440448 6:163807418-163807440 TCCTGAGAAGAATGCAGCAGTGG + Intergenic
1018652331 6:166002743-166002765 TCCTGCCATGAATGCACCACTGG - Intergenic
1023275693 7:38516617-38516639 TCCTTACACAGATGCCCCACTGG + Intronic
1032840608 7:135710887-135710909 TACTGTCACGAATGCCCCCTGGG + Intronic
1034410946 7:150941896-150941918 ACCTGAAACCAAAGCCCCAGAGG - Intergenic
1037615339 8:20514175-20514197 TCCTGACTTGGATCCCCCAGAGG + Intergenic
1043980882 8:86637880-86637902 TCCTTACTCAAATGCGCCAGAGG + Intronic
1045128666 8:99123361-99123383 TCATGACACTACTGCCCCACTGG - Intronic
1053416153 9:37948023-37948045 TCCTGACAGAAATGCCTCACAGG + Intronic
1060816532 9:126638205-126638227 TCCCGACAGGAATGCTCCGGTGG + Intronic
1203778960 EBV:90106-90128 TACTAACACGAATGCCCAGGCGG - Intergenic
1186514547 X:10156826-10156848 TCTGGACACGAATGCTCCGGGGG + Intergenic
1194249748 X:91560455-91560477 TCCTGATATGGATGACCCAGAGG - Intergenic
1197940456 X:131783379-131783401 TCATAACATAAATGCCCCAGGGG + Intergenic
1199473875 X:148224731-148224753 TCCTAATGCAAATGCCCCAGTGG + Intergenic
1200568711 Y:4801705-4801727 TCCTGATATGGATGACCCAGAGG - Intergenic