ID: 1172701040

View in Genome Browser
Species Human (GRCh38)
Location 20:36853912-36853934
Sequence TTCCATGTGAACAGGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 348}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172701032_1172701040 26 Left 1172701032 20:36853863-36853885 CCTCTGGGGCATTCGTGTCAGGA 0: 1
1: 0
2: 3
3: 3
4: 85
Right 1172701040 20:36853912-36853934 TTCCATGTGAACAGGAAGGAAGG 0: 1
1: 0
2: 3
3: 35
4: 348
1172701033_1172701040 -1 Left 1172701033 20:36853890-36853912 CCTGACAGTTTCCTCCCATCCTT No data
Right 1172701040 20:36853912-36853934 TTCCATGTGAACAGGAAGGAAGG 0: 1
1: 0
2: 3
3: 35
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172701040 Original CRISPR TTCCATGTGAACAGGAAGGA AGG Intronic
900110894 1:1005162-1005184 GCCCACATGAACAGGAAGGAGGG - Intergenic
901114130 1:6827653-6827675 TTTCATGTCAACATGAAGAATGG - Intronic
902315603 1:15616505-15616527 TTCCATTTTAACAGGAGAGAAGG - Intergenic
903027026 1:20436719-20436741 TTCCATGGAAAAAGGGAGGAGGG - Intergenic
903803232 1:25985438-25985460 TTCCAAGGGAAAAGGAAGGGAGG - Intronic
904847829 1:33433791-33433813 TTTCCTGTGGTCAGGAAGGATGG - Intergenic
906188692 1:43881551-43881573 TGCCTTGTGTAGAGGAAGGAGGG - Intronic
907882587 1:58565101-58565123 TTCCAGGTGAACATGAATTAGGG - Intergenic
907950629 1:59179773-59179795 TGCCACATGAACATGAAGGAAGG - Intergenic
908090521 1:60680660-60680682 GTCCATGTGAAATGGCAGGATGG + Intergenic
908141025 1:61184835-61184857 TTGCACATGAACACGAAGGAAGG + Intronic
908503368 1:64768441-64768463 TTCCATTTGAGCAGGAATGTGGG + Intronic
909538926 1:76769351-76769373 TGCCAGGTGAACATGAAAGAAGG - Intergenic
910163957 1:84303233-84303255 TTCCATGTCAACAGATAGCATGG - Exonic
911243407 1:95490256-95490278 TTCCATGAGAACAAGAACCATGG - Intergenic
912331342 1:108822747-108822769 TGCCAAGGGAACAGGAAGGAGGG - Intronic
913265125 1:117036002-117036024 GTCCATGTGAGCAGAGAGGAGGG - Intronic
914506060 1:148289964-148289986 TATCATGAGAACAGCAAGGAGGG + Intergenic
916432408 1:164743759-164743781 TTCCAGGCAAAAAGGAAGGAAGG + Intronic
918223200 1:182455055-182455077 TTCCATGAGGACAGGAATGCAGG - Intronic
918350937 1:183654959-183654981 TTCACTGTGAACAGGAACCATGG - Intronic
919952715 1:202380244-202380266 TATCATGAGAACAAGAAGGAAGG - Intronic
919965511 1:202519652-202519674 TTTCATGTGAACAGAAATGTAGG - Intronic
920783280 1:209015291-209015313 GCCCATGTGATAAGGAAGGAAGG - Intergenic
922001558 1:221483794-221483816 TTCCATGGGAAAAGCAAGGCAGG + Intergenic
922158007 1:223054951-223054973 TTCCATAACAACAGGAAGGAAGG - Intergenic
923448577 1:234095314-234095336 TGCCAGGTGAGTAGGAAGGAGGG + Intronic
924012360 1:239679459-239679481 TTAAATCTGAACAGGAGGGAGGG + Intronic
924627758 1:245709973-245709995 TTCCCTCTGAACAGTAATGAGGG + Intergenic
924740280 1:246790860-246790882 TCTCATGTGCACAGGAGGGAAGG + Intergenic
1063196453 10:3747983-3748005 TTCTATGTGACCGGGAAGCATGG + Intergenic
1063262088 10:4400875-4400897 TTCCATTTGAGCTTGAAGGAAGG + Intergenic
1064360092 10:14656464-14656486 TTCCATGTCATCAGAATGGAAGG + Intronic
1064839825 10:19578784-19578806 TACCATCAGAAGAGGAAGGAAGG - Intronic
1065827926 10:29588818-29588840 TTACATGTGAAAACAAAGGAGGG - Intronic
1065939755 10:30553657-30553679 TTACATGTGAAAAGATAGGAGGG - Intergenic
1066646886 10:37619334-37619356 TTTTATGTGAACATGGAGGAAGG + Intergenic
1067407043 10:46032645-46032667 TTCCTGATGAAGAGGAAGGAGGG + Intergenic
1067773993 10:49148409-49148431 TTCCATGGGAAAAGCAAGGCAGG - Intergenic
1067916574 10:50406404-50406426 TTCCCTGGGACCATGAAGGATGG + Intronic
1067972204 10:50985692-50985714 CTCCAGGTGAAAAGGAAGCATGG - Intergenic
1068487983 10:57683861-57683883 TTCTATTGTAACAGGAAGGAAGG - Intergenic
1068775531 10:60864147-60864169 TTCCATGAGACCAGTAAGGAAGG - Intergenic
1070313880 10:75293385-75293407 TTCCAGGTAGGCAGGAAGGAAGG + Intergenic
1070469593 10:76765885-76765907 TTCGATGTGGAGAGCAAGGAAGG - Intergenic
1070495870 10:77021719-77021741 TTCCCTGTGAACAGGGGTGAGGG + Intronic
1070977931 10:80620230-80620252 TACCATGAGAACAGCAAGGGGGG - Intronic
1071490585 10:86133872-86133894 CTCCTTGTGAACTGGAAAGAAGG + Intronic
1072169552 10:92846666-92846688 TTCCAGATTAATAGGAAGGAGGG + Intronic
1072190480 10:93073441-93073463 TTCCACGTGATGAGGAAGCAAGG - Intergenic
1072932895 10:99682639-99682661 ATATATGTGAACAGAAAGGAGGG - Intronic
1073486981 10:103825552-103825574 TTACAGGTGACCAGGGAGGAAGG - Intronic
1075827840 10:125375282-125375304 TTCCATGGGAACAGGAGACAAGG + Intergenic
1077274313 11:1696486-1696508 TTCCAGGTGGACAGGAATGAGGG - Intergenic
1077497544 11:2893486-2893508 TGCCATGTAAACAGGCAGGCAGG + Intronic
1080149865 11:29038958-29038980 TTACATGTAAACAGGAAGTATGG - Intergenic
1082930499 11:58598961-58598983 TTGCAGCTGAACAGGAGGGAAGG - Intronic
1082934032 11:58638230-58638252 TTCTATGGGAAAATGAAGGAGGG - Intergenic
1083672496 11:64306979-64307001 TTCCATGGCAACAGCTAGGAGGG + Intronic
1083742236 11:64717036-64717058 TTCCAGGAGCTCAGGAAGGATGG - Intronic
1084704691 11:70809318-70809340 TTCTATGAGGACAGGGAGGAAGG + Intronic
1085064710 11:73483520-73483542 TTTCATGGGAAGATGAAGGATGG + Intronic
1085560408 11:77467275-77467297 TGCCATGTGAACACAGAGGAAGG - Intronic
1085975167 11:81644362-81644384 TTCCAAGTTAACAGCAAGGAAGG - Intergenic
1086554014 11:88088101-88088123 TTCCATGTCAGCAGACAGGATGG + Intergenic
1089079647 11:115765093-115765115 CTCCCAGTGAACAGGGAGGAGGG - Intergenic
1090408365 11:126491060-126491082 TCCTATGTGAACAGAAGGGAGGG + Intronic
1091494830 12:963166-963188 TTCCATGTGAAAAGTATGGGTGG + Intronic
1091587152 12:1822844-1822866 TTCCATGTGGCCAGGACGCAGGG - Intronic
1091742665 12:2971119-2971141 TTCCATGAGGACAGGAACCAGGG - Intronic
1093441615 12:19204109-19204131 CTCCATGTTAAGAGGCAGGAGGG + Intronic
1098495800 12:71134602-71134624 TACCATGGGAACAGGAAAGGAGG - Intronic
1099068718 12:78017996-78018018 TTCCATGTGAATATAAAGCAAGG + Intronic
1099092045 12:78324432-78324454 AGCCTTGGGAACAGGAAGGAGGG - Intergenic
1099231248 12:80027848-80027870 TCATATGTGAACAGGAAGTATGG + Intergenic
1099890483 12:88583546-88583568 TCCCAGGTGGACAGGAGGGATGG + Intergenic
1101142209 12:101808137-101808159 TTCCATGTTCACAGACAGGAAGG + Intronic
1101997553 12:109535742-109535764 TTCCCTGTGCTGAGGAAGGATGG - Exonic
1102581569 12:113891537-113891559 GTCCAGGTGGACAGGGAGGAAGG + Intronic
1103654268 12:122457737-122457759 ATCCATGGGAACAGGGAGGACGG + Intergenic
1104165528 12:126225557-126225579 TTCCATGTTGGAAGGAAGGAGGG + Intergenic
1104381679 12:128312996-128313018 TTCCATGAGGAGAGGGAGGATGG - Intronic
1104575892 12:129965634-129965656 ATCCATGAGGCCAGGAAGGAGGG - Intergenic
1106569560 13:30914981-30915003 CTCCATGTAAACAGGATGGTAGG + Intronic
1107114152 13:36728331-36728353 TGCCATGTGAAATGAAAGGACGG + Intergenic
1107514568 13:41116384-41116406 TTCCATCAAAACAGGAAGCATGG + Intergenic
1107677463 13:42811703-42811725 ATCCACGTGGCCAGGAAGGAAGG + Intergenic
1108482952 13:50893773-50893795 TTGCATGTAAACAGGGAGCATGG - Intergenic
1108909499 13:55526945-55526967 TTTTATGTGAACATGAAGGTAGG + Intergenic
1109106123 13:58253040-58253062 CTCCATATCAACGGGAAGGAGGG + Intergenic
1109587016 13:64418958-64418980 TTCCATGAGGACAAGAGGGAGGG - Intergenic
1109712893 13:66182490-66182512 TTCCAGGTCAACTGGAAGAAAGG - Intergenic
1110621546 13:77601376-77601398 TTCAATGTGAGAAAGAAGGAAGG - Intronic
1110820879 13:79914824-79914846 TTCCATGACAAGAGGAAGCATGG - Intergenic
1111701586 13:91696030-91696052 TCCTATGTGAAAAGGAAGGGAGG + Intronic
1112182390 13:97096715-97096737 TTCCAGGTGAAGAGAGAGGAAGG + Intergenic
1112701083 13:102009259-102009281 TTCCATGTGAACAGTTTAGATGG + Intronic
1113650687 13:112032201-112032223 GTCCATGCGAACAGAAAAGAGGG + Intergenic
1114581318 14:23762670-23762692 TTCCATGGGAAAAGCAAGAAGGG + Intergenic
1115379712 14:32722387-32722409 TTCAATATGGACAGGAAGCAGGG + Intronic
1116607416 14:47018917-47018939 TGCCATGTGAACACAGAGGACGG - Intronic
1117318116 14:54593906-54593928 TGCCTTGTGAAAAGGAAGGAAGG + Intronic
1119182505 14:72614326-72614348 TACCAGGTGAAGGGGAAGGATGG - Intergenic
1121268614 14:92622426-92622448 TTCTAACAGAACAGGAAGGATGG - Intronic
1121698782 14:95935562-95935584 TTCCATGTGAGCAGTGAGTATGG - Intergenic
1121982347 14:98465920-98465942 TTCTTTGTGAAGAGAAAGGAAGG + Intergenic
1123088573 14:105731237-105731259 GTCCATGTGGACAGTGAGGAAGG + Intergenic
1123435323 15:20249914-20249936 TTCCATCTGCACAGGAGGGCAGG - Intergenic
1123476543 15:20595455-20595477 GTCCATCTGGACAGGAAGGTGGG - Intergenic
1123641468 15:22404909-22404931 GTCCATCTGGACAGGAAGGTGGG + Intergenic
1124195831 15:27627707-27627729 TTTCATGTAAGCAAGAAGGAAGG + Intergenic
1125730612 15:41890819-41890841 TGCCATTTGGACAGGGAGGATGG + Intronic
1126737306 15:51743734-51743756 TTCCATGTTCACAGATAGGAAGG - Intronic
1127001425 15:54512336-54512358 TTCCATGAGCAGAAGAAGGAAGG + Intronic
1127538959 15:59918260-59918282 TCCCAGATGAACAGCAAGGATGG + Intergenic
1129268014 15:74404374-74404396 TTCCTTCTGATCAGGAAGCAGGG - Intergenic
1129475729 15:75783537-75783559 TCCCATGTCACCAGGAAGGGTGG - Intergenic
1129556394 15:76514551-76514573 TTCTTTGTGATCAGGGAGGAAGG + Intronic
1133661775 16:7925144-7925166 TTCCATCTGAAAATGCAGGAAGG - Intergenic
1133873259 16:9709418-9709440 TTCCAGGAGAAGGGGAAGGAAGG - Intergenic
1136849290 16:33601076-33601098 TTCCATCTGCACAGGAGGGAAGG + Intergenic
1137608810 16:49805239-49805261 TGCCAAGTGAACTGGAAGGTGGG - Intronic
1139362478 16:66409135-66409157 TTCAATGTTAACAGGAAGGAGGG + Intergenic
1139406677 16:66724653-66724675 TTCCATGTAAGCAGGTAGGGCGG - Intronic
1141304831 16:82852439-82852461 ATCCATGGAAATAGGAAGGAAGG - Intronic
1142131301 16:88432773-88432795 TTCCCTGTGAACAGAGAGGAGGG + Exonic
1142229453 16:88892985-88893007 TTCACTGTGAACAGGGAGCAAGG + Intronic
1203110997 16_KI270728v1_random:1449726-1449748 TTCCATCTGCACAGGAGGGAAGG + Intergenic
1143089218 17:4439024-4439046 TCCCATATGAAGAGGAGGGAAGG + Intronic
1144366909 17:14553368-14553390 CTCCATGAGCACAGGAAGTATGG - Intergenic
1144412853 17:15018356-15018378 TTGCATGTGATCAGGATGGCTGG + Intergenic
1144673599 17:17146834-17146856 TTCACTGTGAGCAGTAAGGAAGG - Intronic
1144856786 17:18273446-18273468 TACCATGTGGAAAGGGAGGAAGG + Intronic
1146055247 17:29577666-29577688 TTCCGGGTTAACAGGCAGGAAGG + Exonic
1146129994 17:30264114-30264136 TTCTAACTTAACAGGAAGGAAGG - Intronic
1147043393 17:37735195-37735217 GTCCAAAGGAACAGGAAGGATGG - Intronic
1150133995 17:62685302-62685324 TTCCATGGAAAAAGGCAGGAAGG - Intronic
1150678334 17:67264032-67264054 TTCCATCTGAAAATCAAGGAGGG - Intergenic
1151007308 17:70452601-70452623 TTCCAGGGGAAGTGGAAGGAGGG + Intergenic
1152226379 17:79094692-79094714 TTCCTTCTTAACAAGAAGGAGGG - Intronic
1152864453 17:82714080-82714102 TTCCATGTAGACAGGAAAAATGG + Intergenic
1155533239 18:26789330-26789352 TTGCCTGTGAAGAGAAAGGAGGG - Intergenic
1155982476 18:32195923-32195945 TGCCATGGGAAGAGGAAGCAAGG - Intronic
1157204502 18:45687204-45687226 TGCCCTGTGAGCAGGTAGGATGG + Intergenic
1158229128 18:55234188-55234210 TTCCAAATGAATAGGAAGGAAGG - Intronic
1158257946 18:55574184-55574206 TTCTATGTGAATATAAAGGAAGG - Intronic
1158525190 18:58206949-58206971 TTCCTTGTGCACAGGATGGGTGG - Intronic
1159496650 18:69216198-69216220 TTCCATTTCAATAAGAAGGAAGG - Intergenic
1159600790 18:70426915-70426937 TGCCATGTAAACAGGAGGCAAGG + Intergenic
1160040479 18:75340390-75340412 AACCATGTGAACTGGGAGGATGG + Intergenic
1160470998 18:79133716-79133738 TCTCAAGTGAAAAGGAAGGATGG - Intronic
1161568550 19:5017095-5017117 TTCCCTGTGCAGAGGGAGGAAGG + Intronic
1162788862 19:13052900-13052922 CTCCCTGTGAACAGGACGAAGGG - Intronic
1164711550 19:30360273-30360295 TTGCATGTGAACAGGATGAAGGG - Intronic
1165031479 19:33000778-33000800 TTCCATCTGCACAGGAGGGAAGG - Intronic
1166568474 19:43779323-43779345 GTCCATGCCAACAGGAAGCATGG - Intronic
1167423714 19:49418583-49418605 GTCCATGTGAATAAGAGGGAGGG - Intergenic
1167932472 19:52877395-52877417 TTATATGTGAGCAGGGAGGAGGG + Exonic
1168218010 19:54940450-54940472 CTGCAGGTGAAAAGGAAGGATGG - Exonic
1168249878 19:55135841-55135863 AACCATGTGCACAGGAAGGAGGG + Intronic
926783853 2:16500556-16500578 TTCCAGGTGAAGAAGAAGCAAGG - Intergenic
926831416 2:16966513-16966535 TCCCATGGGAAAAGGTAGGAGGG - Intergenic
928234035 2:29524658-29524680 TTTCATGAGAACAAAAAGGAGGG + Intronic
931620335 2:64204038-64204060 TACCATGGGGACAGGAATGAGGG + Intergenic
932803986 2:74767410-74767432 TTCCATGTGAAGGGGAAGTTGGG + Intergenic
933319901 2:80760115-80760137 TTCAATGGGAAAAGCAAGGATGG + Intergenic
934477548 2:94603455-94603477 TGTCATGTGATCAGGAAGGTAGG - Exonic
936348495 2:111694063-111694085 TTCAATGGCAAAAGGAAGGAAGG + Intergenic
937304651 2:120863890-120863912 GTCAATGTGAACAGGAGAGAGGG + Intronic
938586706 2:132697788-132697810 TTCCAAGCCAACAGGAAGAAGGG + Intronic
938650650 2:133379589-133379611 CTCCATGTGGACAGGAACCATGG + Intronic
938715378 2:134016010-134016032 TTCCATGTGATAACCAAGGAAGG + Intergenic
939430773 2:142104203-142104225 TTCAAGGGGAACTGGAAGGAAGG + Intronic
940459057 2:153939190-153939212 TGACATTTGAGCAGGAAGGAAGG + Intronic
940578578 2:155548001-155548023 TTCCATGTGTATTGGAAGGCAGG - Intergenic
940856330 2:158731088-158731110 TTGCATGTGAGAAGGAAGGTGGG - Intergenic
942219587 2:173756231-173756253 TTCCATGGGAAAAGCAAGGCAGG + Intergenic
942571303 2:177317313-177317335 TTCCTTGTGAACAGGCTGGAGGG - Intronic
942636897 2:178017578-178017600 TTACCTGTGGAGAGGAAGGAAGG + Intronic
943435361 2:187859071-187859093 TGCCATTTTAACAGGAGGGAAGG + Intergenic
944007785 2:194931828-194931850 TTCTATGAGACCAGGCAGGATGG + Intergenic
944269992 2:197771613-197771635 TTACTTTTGAACAGGAAAGAGGG + Intronic
944422012 2:199541589-199541611 TTCCATGAGAACAAGAATCATGG + Intergenic
945805660 2:214487081-214487103 TTCCATGTGAAGACAGAGGAAGG + Intronic
946060085 2:216934200-216934222 TTCCAAGAGCACAGGGAGGAAGG + Intergenic
946215981 2:218183947-218183969 TTCCATGGGCACAGGATGGGGGG + Intergenic
946827172 2:223690794-223690816 TTTCATGTGAACACGAAGGCAGG - Intergenic
946931643 2:224677229-224677251 TTACCTGTGAGCAGGAGGGAGGG - Intergenic
946996314 2:225396089-225396111 GGCCATGCGAACAGAAAGGAAGG + Intergenic
947539115 2:230962613-230962635 TTCCAGGTGAACAGGAATTTGGG + Intergenic
947683853 2:232062878-232062900 ATCCATGTGAAAAGGAAGGAAGG - Intronic
947704224 2:232261382-232261404 TTCCAAAAGAACAGGAGGGAAGG - Intronic
947911005 2:233800863-233800885 TACCATGAGAACATCAAGGAGGG + Intronic
948361128 2:237421404-237421426 TTCCATGTGTAAAGGATGGGTGG + Exonic
948733920 2:239986263-239986285 TTCCATTTGAACTTGAAGGAAGG - Intronic
1170057824 20:12226447-12226469 TGTCATGAGAACAGCAAGGAGGG - Intergenic
1170634553 20:18093160-18093182 TTCCAGGTGCACAGGGAGCAGGG - Intergenic
1172248053 20:33459605-33459627 TCCCAGGTGAGCAGGAAGCAGGG + Intergenic
1172458447 20:35095965-35095987 TACCATGTGACCATGAAGTAAGG + Intergenic
1172701040 20:36853912-36853934 TTCCATGTGAACAGGAAGGAAGG + Intronic
1172922489 20:38496977-38496999 TTCAATGTGAGCAGCAAGGGTGG + Intronic
1173689381 20:44948278-44948300 TGGCATGAGAGCAGGAAGGATGG - Intronic
1173791742 20:45832549-45832571 TCCCATGTGAGCAGAAAGGCTGG - Intronic
1176057207 20:63155127-63155149 TCTAATGTGAACAGGAGGGAGGG - Intergenic
1176515461 21:7780477-7780499 TCCCATGGGAGCAGGGAGGAGGG - Intergenic
1177264506 21:18765250-18765272 GTCCTTGTGATAAGGAAGGAGGG + Intergenic
1177878116 21:26659713-26659735 TACCACGAGAACAGTAAGGAGGG + Intergenic
1178102276 21:29282601-29282623 TTCCATATGTACAAGAAGGCAGG - Intronic
1178480633 21:32976939-32976961 AGCCATGTGGCCAGGAAGGAAGG - Intergenic
1178603952 21:34018905-34018927 ATCCCTGGGAACAGGAAGGAAGG - Intergenic
1178649489 21:34410489-34410511 TCCCATGGGAGCAGGGAGGAGGG - Intergenic
1179395596 21:41037388-41037410 TTCCCTGTGAACAGGCAGAAGGG - Intergenic
1179961190 21:44767710-44767732 TTGCATGGGAAAAGCAAGGACGG + Intergenic
1179972871 21:44845964-44845986 GTCCCTGTGGCCAGGAAGGAAGG + Intergenic
1181755944 22:25024905-25024927 TGCTCTGTGAACAGGTAGGAGGG + Intronic
1182115068 22:27751745-27751767 TTCCAGAGGAGCAGGAAGGATGG + Intronic
1182141198 22:27959943-27959965 ATCCATATGCAAAGGAAGGAAGG + Intergenic
1182540690 22:31039661-31039683 TTCCGAGGGAACAGGATGGAGGG + Intergenic
1182768160 22:32773834-32773856 TTCTATCTGAAGAGGAAGGAGGG + Intronic
1183152400 22:36048064-36048086 TTCCAAGTGAACATCAAGGGCGG + Intergenic
1184387152 22:44182706-44182728 GGCCAGGGGAACAGGAAGGAGGG + Intronic
950332027 3:12163556-12163578 TTCCTTGTGAACAAGAATGATGG + Intronic
951014471 3:17714983-17715005 TTAAATGTGCAAAGGAAGGAAGG + Intronic
951186115 3:19715474-19715496 TTTCATTTCAAAAGGAAGGAGGG - Intergenic
951988800 3:28652105-28652127 TGCCATGAGGACAGGAAGGATGG + Intergenic
953747419 3:45585764-45585786 ATCCATAGTAACAGGAAGGAAGG - Intronic
955409787 3:58648072-58648094 TGCCATGGGAACAGGCAGGGTGG + Intronic
955488114 3:59455269-59455291 TTCCCTCTGAACAGGCAGGAAGG + Intergenic
955601351 3:60648569-60648591 TGCCAGGTAAACAGGAAGGGGGG + Intronic
957194607 3:77051335-77051357 TGCCATGTGTACAGGGAGGTGGG - Intronic
957532717 3:81461013-81461035 TTTCAACTGAGCAGGAAGGAGGG + Intergenic
958067894 3:88568057-88568079 TTCCAATTAGACAGGAAGGAAGG + Intergenic
959460071 3:106614540-106614562 TTCTATTTGAATAGGAATGAGGG - Intergenic
959808860 3:110592622-110592644 TATCATGAGAACAGCAAGGAGGG - Intergenic
961449192 3:126994853-126994875 CCCTATGTGAACAGGCAGGAGGG - Intronic
961901677 3:130219010-130219032 TGCCATGGGCACAGGAAGGGAGG - Intergenic
962315701 3:134358356-134358378 CTCAATGTGAACATGAGGGATGG - Intronic
963070778 3:141303603-141303625 TTCCATCTGTAAAGGAAGCAGGG + Intergenic
963102849 3:141622799-141622821 TTGCATGTGGACTTGAAGGATGG - Intergenic
963274990 3:143320938-143320960 TGCCATGTGAAGACAAAGGAAGG + Intronic
963348337 3:144123246-144123268 TTCCAGGTTAACAGGAGGGCAGG - Intergenic
963734697 3:149006706-149006728 TTCCATGGGAACAGAAAAAAAGG - Intronic
963757996 3:149256115-149256137 TTACATGTGAAGAGGGTGGAGGG + Intergenic
964105716 3:153037243-153037265 TTTGATTTGAACAGGATGGAGGG - Intergenic
964447645 3:156776869-156776891 TTCCATGTTAAGAGGAAAGCAGG + Intergenic
964806046 3:160610806-160610828 TTCCCTGAGAAGAGGAAGCATGG - Intergenic
965305910 3:167062758-167062780 TGCCATGTGAACATGAAGACAGG - Intergenic
966363213 3:179151853-179151875 TGCTATGGGAACAGGAAGCAGGG - Intronic
967054513 3:185818280-185818302 AGCCAAGTGAAAAGGAAGGAGGG + Intronic
969343649 4:6557972-6557994 TCCCCTGTGGACAGGAAGGCAGG + Intronic
969785405 4:9453580-9453602 TGGCTTGGGAACAGGAAGGATGG - Intergenic
970124241 4:12791608-12791630 TTCTATGAGAACAGGAAAGAGGG - Intergenic
970929199 4:21489365-21489387 TTCCAATTGAATAGGAAGTAGGG + Intronic
971011088 4:22436147-22436169 TTCAATGTGAACTCGAAGGATGG + Intronic
971483644 4:27137956-27137978 TTCCATGGGAAAAGGAAGTGGGG - Intergenic
971508320 4:27391095-27391117 TACCCTGTGAACAGCCAGGATGG - Intergenic
972006687 4:34118453-34118475 TTCCATTTTAACAGGAGGCATGG + Intergenic
972063567 4:34910971-34910993 TACCATGAGAACAGTATGGAGGG - Intergenic
972818403 4:42670758-42670780 TTCTAACTGAGCAGGAAGGATGG + Intergenic
973549449 4:52018486-52018508 TGCCATTAGAACAGAAAGGAAGG - Intergenic
974056657 4:56990103-56990125 TTTCATTTGAATAGGACGGAGGG - Intronic
974186718 4:58456718-58456740 TTACATGTGAATAAGCAGGAGGG - Intergenic
975084422 4:70320512-70320534 TTCCATGAGAACAGTTATGAAGG + Intergenic
975859914 4:78665793-78665815 TTCCATGGCAAAAGGATGGATGG - Intergenic
975865777 4:78722420-78722442 TTCTCTGCAAACAGGAAGGAAGG + Intergenic
977953385 4:103000109-103000131 TTCCATGTGTCAAGGGAGGAAGG - Intronic
978079610 4:104576030-104576052 TACCATGGAAACAGAAAGGAAGG + Intergenic
979696722 4:123621232-123621254 ATTCCTGTCAACAGGAAGGATGG + Intergenic
980320648 4:131268668-131268690 TTCCATGTGAAGAGATATGAGGG - Intergenic
981091625 4:140738359-140738381 TTACATGTGAAAAGAAAGGGGGG - Intronic
982335671 4:154235010-154235032 TTTCAGGTGATCAGGAAGTAAGG - Exonic
986059935 5:4178499-4178521 TGCCATGGGAAGAGGAAGGCAGG + Intergenic
988465498 5:31487333-31487355 ATACATGTGAAAATGAAGGAAGG + Intronic
991062088 5:62387274-62387296 TTCAAAGGGAAGAGGAAGGATGG + Exonic
991718545 5:69474634-69474656 TTCCATGTGAAGGGAAGGGAAGG - Intergenic
992085987 5:73278873-73278895 GTCCAAGTGAACAGGTAGGTTGG + Intergenic
992476096 5:77102955-77102977 TTCCATGTGAAGAGGAGTGGTGG + Intergenic
992551643 5:77865621-77865643 TTCCATGGGGACAGGAGGGCTGG - Intronic
992865896 5:80956874-80956896 TTTGATGAGAAAAGGAAGGAAGG - Intergenic
992974936 5:82105836-82105858 CTCCATGTGAACAAGAACAAGGG - Intronic
993612500 5:90072489-90072511 TTTCATGTGAGGAAGAAGGAAGG + Intergenic
993862518 5:93153492-93153514 TTCCATGGGTAGAGGGAGGAGGG - Intergenic
995028347 5:107450134-107450156 TTCCACATGAGAAGGAAGGAGGG + Intronic
996354295 5:122579327-122579349 TTCCATGAGAACTGGGTGGATGG - Intergenic
996850458 5:127945816-127945838 GTCCATGTGAACACAAAGAAGGG - Intergenic
997447674 5:133953327-133953349 TTCCAAGGGAACAGAAAAGAAGG - Intergenic
998668572 5:144327454-144327476 TACCATGGAAACAGGAAGAAGGG - Intronic
998790783 5:145764360-145764382 TGCCATGGGCACAGGATGGAAGG - Intronic
1000740838 5:164968570-164968592 TCACATGTGCACTGGAAGGATGG - Intergenic
1000926206 5:167197686-167197708 TTCCATATGAACATGAAATAAGG + Intergenic
1001322542 5:170694514-170694536 TTCCATCTGATCAGGGATGAAGG - Intronic
1001322811 5:170696985-170697007 TTCTACGTGTACAGGGAGGATGG - Intronic
1001351472 5:170971400-170971422 TTCCATGTCTACAGAAAGGAAGG - Intronic
1001949285 5:175804967-175804989 TTACATGTGAACAAAATGGAGGG - Intronic
1002041898 5:176520785-176520807 TTCAATGGGAACTAGAAGGAAGG + Intergenic
1003079863 6:3013335-3013357 TGCCATGTAAATAGGAATGAAGG + Intronic
1003298181 6:4852613-4852635 TTAAATCTAAACAGGAAGGAAGG - Intronic
1005074320 6:21891570-21891592 TGGCATTTGAACAGAAAGGAAGG - Intergenic
1005388542 6:25310260-25310282 TACCATGAGAACATAAAGGAGGG + Intronic
1006036578 6:31217710-31217732 TTACATGTGAAAAGAAGGGAGGG + Intergenic
1006249042 6:32765135-32765157 CTCCCTTTGAACAGGAAGAAGGG - Intergenic
1007251002 6:40494947-40494969 TTCCAGGTGAGCATGAAGGAAGG - Intronic
1007262774 6:40575405-40575427 TTCCATGGACACAGGAAAGAAGG + Intronic
1007368895 6:41413414-41413436 TTCCAGGAGAAAAGGAAGCAGGG - Intergenic
1012065294 6:94542597-94542619 GTCCATGTGAACACAAAGAAGGG + Intergenic
1012217740 6:96608796-96608818 TTCCTTTTGAAGAGGTAGGAAGG - Intronic
1013356641 6:109351127-109351149 TTCCATGTTCACAGGAGGGAAGG - Intergenic
1013963605 6:115929292-115929314 TACAATGTGAAGAGGAAGAATGG + Intergenic
1014105216 6:117553342-117553364 TTCCATTGACACAGGAAGGAAGG - Intronic
1015500218 6:133924096-133924118 TAACAGGTGAACAGGAAGGAGGG - Intergenic
1015839145 6:137457573-137457595 TGCCATGTGAATATGAAGGCAGG - Intergenic
1015839350 6:137460279-137460301 TGCCATGTGAATATGAAGGCAGG - Intergenic
1016454368 6:144215778-144215800 TCTCATGTGCACAGAAAGGAAGG + Intergenic
1017643225 6:156514378-156514400 TTCCTTCTGAACTGGAAGGCTGG - Intergenic
1018398058 6:163395991-163396013 TTCACTGAGAACAGAAAGGAAGG + Intergenic
1020940093 7:14522479-14522501 TTGCAAGAGAACAGGAAGGGTGG - Intronic
1020985329 7:15126804-15126826 TTGGATCTGAAAAGGAAGGAAGG - Intergenic
1021864055 7:24937216-24937238 TATCATGAGAACAGGATGGAGGG + Intronic
1022738530 7:33099121-33099143 TGCCATGTGAAGAAGAAAGAGGG - Intronic
1024047381 7:45593896-45593918 GTCTATGTGAACACGTAGGAGGG + Intronic
1024152506 7:46587098-46587120 TTCCATATGAAAATGAAGGCAGG - Intergenic
1025865731 7:65378905-65378927 TTCCTGGAGAACAGAAAGGATGG + Intronic
1027435659 7:78161928-78161950 TTCCATTTGAACAGAAAGAAAGG - Intronic
1027925956 7:84463805-84463827 TTTTATGGGAAAAGGAAGGAAGG - Intronic
1028714951 7:93955138-93955160 TTGGATGTGAAGAGTAAGGAAGG - Intergenic
1029148441 7:98463390-98463412 TGCCATGTGAACAGGTGGCAGGG - Intergenic
1030623443 7:111817406-111817428 ATCCATAATAACAGGAAGGAAGG - Intronic
1031083474 7:117280126-117280148 CTTCATGAGGACAGGAAGGATGG + Intronic
1031152625 7:118072286-118072308 TTGCATGAGTACAGAAAGGATGG - Intergenic
1031851659 7:126872128-126872150 TTGCATGTGCATAGGATGGAAGG + Intronic
1034245292 7:149639264-149639286 TTCCATGTGAGAAAGAAAGAAGG + Intergenic
1035678981 8:1473745-1473767 TACCATGAGAACAGTATGGAGGG - Intergenic
1035994784 8:4533387-4533409 ATCCATATGACCAGGATGGACGG + Intronic
1036215726 8:6878215-6878237 CTCCATGTGATCCAGAAGGAGGG - Intergenic
1037932893 8:22893544-22893566 TTCCATGTGTTCAAGAAGGTAGG + Intronic
1038129202 8:24710510-24710532 TTTCATGGGAACACAAAGGAGGG - Intergenic
1038200882 8:25411489-25411511 TTCCATGTGGACTGGAAGGGAGG - Exonic
1038235839 8:25753610-25753632 TGCCATTTGAACAGTAAGCAAGG + Intergenic
1039085738 8:33777803-33777825 GTCAATGAGAACAGGAAGGCTGG - Intergenic
1039390637 8:37178366-37178388 TTCTATGTGATCAGGAGAGAAGG + Intergenic
1040456943 8:47607770-47607792 TGGCATGTGGACAGGAAGAATGG - Intronic
1041174801 8:55184239-55184261 TCCCATGAGAACACTAAGGATGG - Intronic
1041786584 8:61640679-61640701 ATCCATGAGAACAGGAACCATGG + Intronic
1044517223 8:93153650-93153672 TTCCCTGTAGACAGGCAGGACGG - Intronic
1044823895 8:96178429-96178451 TTTCAGGTCAACAGGAAAGAAGG + Intergenic
1045650675 8:104339059-104339081 TTTCATTTGAACAGGAAGGATGG - Intronic
1047097340 8:121639739-121639761 GTCCCTGTGAACAGGAGGGCGGG - Intronic
1048236444 8:132695440-132695462 TTCTATAGAAACAGGAAGGAAGG + Intronic
1048276304 8:133068565-133068587 TTCCATGAGAACACCCAGGAAGG - Intronic
1048458309 8:134598364-134598386 TTCAATGTGAACATGTAGGATGG - Intronic
1048474162 8:134728229-134728251 TTCCATGATCACAGGGAGGAAGG + Intergenic
1048844754 8:138595690-138595712 CTCCAAGAGGACAGGAAGGAGGG + Intronic
1050498119 9:6265911-6265933 TTCCATGTGAACAAGGAGCATGG - Intergenic
1050966401 9:11809594-11809616 GTGCATGTGAACACAAAGGAGGG - Intergenic
1052852419 9:33386101-33386123 TGTCATGTGATCAGGAAGGTAGG + Exonic
1052944715 9:34159033-34159055 TTCCAAGTGAACATATAGGAAGG - Intergenic
1053070085 9:35096098-35096120 GTACATGTGAACAGTCAGGAGGG + Intronic
1053288587 9:36865374-36865396 TTCCATCTGAGCAGGTAGCATGG + Intronic
1053680520 9:40482652-40482674 TGTCATGTGATCAGGAAGGTAGG + Intergenic
1053930509 9:43110963-43110985 TGTCATGTGATCAGGAAGGTAGG + Intergenic
1054283192 9:63142283-63142305 TGTCATGTGATCAGGAAGGTAGG - Intergenic
1054293605 9:63318167-63318189 TGTCATGTGATCAGGAAGGTAGG + Intergenic
1054504101 9:65893672-65893694 TGTCATGTGATCAGGAAGGTAGG - Exonic
1055153657 9:73034877-73034899 GTGCATGTGATCAGGATGGAGGG + Intronic
1057458224 9:95233996-95234018 CTCCATGTGACCAGTAAGGAAGG + Intronic
1058035876 9:100252101-100252123 ATACATATGAATAGGAAGGAAGG + Intronic
1058378276 9:104350204-104350226 GTTCATGTGAAGAGAAAGGAGGG - Intergenic
1059108734 9:111534653-111534675 GTGAATGAGAACAGGAAGGAGGG + Intronic
1060922797 9:127434250-127434272 TGCCAGGAGAACAGGAAGGCGGG - Intronic
1061893993 9:133637448-133637470 TCCCATGTGGAAAGGAAGGCTGG - Intronic
1190275253 X:48895098-48895120 TTCCCTGGGGAAAGGAAGGAAGG + Exonic
1190939593 X:55027710-55027732 TTCTATGAGATCAGGAAGGGAGG - Intronic
1194681332 X:96857323-96857345 TTCCATTTTTACAGGAAAGAGGG + Intronic
1195064653 X:101230049-101230071 TTGGATGTGAACAGTAAGGGAGG - Intronic
1195311372 X:103634690-103634712 TTCTGTGTGGACAGGAAGGTGGG - Intergenic
1195397305 X:104425279-104425301 TTCCGGGTAAACAGGCAGGAAGG + Intergenic
1196733487 X:118963948-118963970 TTCCTGCTCAACAGGAAGGATGG - Intergenic
1196864213 X:120056282-120056304 TTCATTCTGAACTGGAAGGAAGG - Intergenic
1196878886 X:120180048-120180070 TTCATTCTGAACTGGAAGGAAGG + Intergenic
1198030783 X:132751607-132751629 TTCCATGCTCACAGGAAGAAGGG - Intronic
1198103355 X:133440592-133440614 TTTTATGTGAGCAGGGAGGAAGG - Intergenic
1198294416 X:135271890-135271912 TTCCATAGGAACAAGAAGGTAGG - Intronic
1198686931 X:139237129-139237151 TTGAATGAAAACAGGAAGGAAGG - Intergenic
1198852887 X:140984453-140984475 TTCCAAGTAAACAGTAAGGCAGG - Intergenic
1199526770 X:148801543-148801565 TTCCATTGTAACAGGAGGGAAGG - Intronic
1201782647 Y:17740468-17740490 TTCCAAGTGTAAAGGAAGGGTGG + Intergenic
1201818906 Y:18165520-18165542 TTCCAAGTGTAAAGGAAGGGTGG - Intergenic