ID: 1172702366

View in Genome Browser
Species Human (GRCh38)
Location 20:36861580-36861602
Sequence TGGAGCTCACAGCATGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 924
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 890}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172702366_1172702371 -4 Left 1172702366 20:36861580-36861602 CCAGCAGCATGCTGTGAGCTCCA 0: 1
1: 0
2: 4
3: 29
4: 890
Right 1172702371 20:36861599-36861621 TCCACAGCCAGGGGCACTCTGGG 0: 1
1: 0
2: 3
3: 16
4: 200
1172702366_1172702374 8 Left 1172702366 20:36861580-36861602 CCAGCAGCATGCTGTGAGCTCCA 0: 1
1: 0
2: 4
3: 29
4: 890
Right 1172702374 20:36861611-36861633 GGCACTCTGGGTGTTGTGCCAGG 0: 1
1: 1
2: 1
3: 17
4: 149
1172702366_1172702370 -5 Left 1172702366 20:36861580-36861602 CCAGCAGCATGCTGTGAGCTCCA 0: 1
1: 0
2: 4
3: 29
4: 890
Right 1172702370 20:36861598-36861620 CTCCACAGCCAGGGGCACTCTGG 0: 1
1: 0
2: 4
3: 20
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172702366 Original CRISPR TGGAGCTCACAGCATGCTGC TGG (reversed) Intronic
900243287 1:1626801-1626823 AGGGGGTCACAGCAGGCTGCAGG - Intronic
901914832 1:12490622-12490644 TGTAGCTCCCACCATGCTGTGGG - Intronic
901960035 1:12819107-12819129 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
902019309 1:13330751-13330773 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
903529882 1:24022024-24022046 TGCAGCTCACAGTCTGCTGCTGG - Intergenic
903677330 1:25072644-25072666 TGAGGCTCACAGCCAGCTGCAGG + Intergenic
903994159 1:27295030-27295052 TGCAGCTCAGAGCAAGCTGTGGG + Intronic
904563192 1:31412418-31412440 TGTAGCTCCCAGCAGGCTGTTGG + Intronic
904684374 1:32249963-32249985 TGGAGCTCCAAGCCTGGTGCAGG - Intergenic
904897807 1:33830157-33830179 TGGTTCTCCCAGCATGCAGCTGG + Intronic
905268854 1:36773508-36773530 TGGATCTCACAGCAGGCTCCAGG + Intergenic
905821957 1:40999575-40999597 TGGAGCTCTTACCTTGCTGCCGG + Intronic
905981696 1:42234891-42234913 TGGTTCTCCCAGCATGCAGCTGG - Intronic
906368601 1:45233128-45233150 TGCAACAGACAGCATGCTGCAGG + Intronic
906584501 1:46964727-46964749 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
906755662 1:48312218-48312240 TGGTTCTCCCAGCATGCAGCTGG + Intronic
907422804 1:54358510-54358532 TGCAGCTCACACCTTGCTCCAGG + Intronic
908691066 1:66780771-66780793 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
908797019 1:67840283-67840305 TGGAGCTTACAGCATGATGAGGG - Intergenic
908977030 1:69910689-69910711 TGGTTCTCCCAGCATGCAGCTGG - Intronic
910815444 1:91287285-91287307 TGGTTCTCCCAGCATGCAGCTGG + Intronic
910816601 1:91297444-91297466 TGGTTCTCCCAGCATGCAGCTGG + Intronic
911359406 1:96858701-96858723 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
911492681 1:98589287-98589309 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
911988750 1:104664212-104664234 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
912297820 1:108487110-108487132 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
912743272 1:112222046-112222068 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
913113514 1:115676773-115676795 TGGATCTCGCAGGCTGCTGCTGG + Intronic
913314100 1:117535420-117535442 TGGAGGCCCCAGCAGGCTGCTGG - Intergenic
913335691 1:117707499-117707521 TGGAGCTTACAGTCTGTTGCTGG - Intergenic
913388147 1:118281519-118281541 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
913719239 1:121574929-121574951 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
915097537 1:153473986-153474008 TGGATCTCACAGCATTCTGGAGG - Intergenic
915286558 1:154857067-154857089 TGGAGCTCACAGGCTGGTGGGGG - Intronic
915760270 1:158304591-158304613 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
915861892 1:159453591-159453613 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
915869104 1:159538854-159538876 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
915875154 1:159604384-159604406 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
916402089 1:164459840-164459862 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
916467396 1:165085597-165085619 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
916517447 1:165532829-165532851 TGGAGATCACCGCATCCTGTAGG + Intergenic
916596434 1:166248426-166248448 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
916816062 1:168354227-168354249 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
916903580 1:169256931-169256953 TGGTTCTCCCAGCATGCAGCTGG - Intronic
917547986 1:175992890-175992912 TGGTTCTCCCAGCATGCAGCTGG + Intronic
917745279 1:178000803-178000825 TGGAGCTTAAAGGATCCTGCTGG + Intergenic
918326924 1:183418643-183418665 AAGAGCTCACACCATGCTGTGGG - Intergenic
918398769 1:184143346-184143368 GGAAGCTCTCAGCATGATGCTGG + Intergenic
918483274 1:185002168-185002190 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
918700212 1:187598305-187598327 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
918855848 1:189755440-189755462 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
919068511 1:192724278-192724300 TGGAGCTAACAGAATGCTTCAGG + Intergenic
919377228 1:196809225-196809247 TGGATCCCACAGCTGGCTGCAGG - Intergenic
919419448 1:197353047-197353069 TGAAGCACACAGCCTGCTGAGGG + Intronic
920966790 1:210707661-210707683 TGGAGCCCACAGCCTGCCACTGG - Intronic
921158322 1:212454933-212454955 GGGAGCTCAGAGCCTGCTGGTGG + Intergenic
921793733 1:219319191-219319213 TTAAGCTCAGAGCATGTTGCTGG + Intergenic
921846355 1:219887346-219887368 TGGTTCTCCCAGCATGCAGCCGG + Intronic
922197438 1:223372036-223372058 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
922206083 1:223447628-223447650 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
922374349 1:224945977-224945999 TGGTTCTCCCAGCATGCAGCTGG - Intronic
923119574 1:230978311-230978333 ATGAGCTGACAGCATGCTCCTGG - Intronic
923142905 1:231176233-231176255 GACAGCTCACAGCCTGCTGCAGG + Intronic
923599195 1:235387291-235387313 TGGTTCTCCCAGCATGCAGCTGG - Intronic
923694296 1:236231996-236232018 TGGAGGAAACAGCATGCAGCTGG - Intronic
923875479 1:238042610-238042632 TGGGTCTCCCAGCATGCAGCTGG - Intergenic
924008910 1:239643260-239643282 TGGTTCTCCCAGCATGCAGCTGG - Intronic
924857949 1:247893688-247893710 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1063332961 10:5180469-5180491 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1063336824 10:5223323-5223345 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1063528716 10:6809640-6809662 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1063554277 10:7063401-7063423 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1063897334 10:10696370-10696392 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1064922148 10:20531184-20531206 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1064943104 10:20757034-20757056 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1065077731 10:22097976-22097998 TGGAGCTCACAGGGAACTGCAGG - Intergenic
1066201509 10:33146176-33146198 AAGAGCTCACAGCGTGGTGCTGG - Intergenic
1066595354 10:37044247-37044269 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1066662454 10:37749706-37749728 CTGAGAACACAGCATGCTGCTGG - Intergenic
1066813561 10:39372603-39372625 TGGTTCTCTCAGCATGCAGCTGG - Intergenic
1066818434 10:39451852-39451874 TGGTTCTCCCAGCATGCAGCCGG - Intergenic
1066992719 10:42531567-42531589 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1067149386 10:43717339-43717361 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1067195214 10:44112237-44112259 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1067212231 10:44268949-44268971 TGGTTCTCTCAGCATGCAGCTGG + Intergenic
1067785825 10:49246249-49246271 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1067987313 10:51164044-51164066 TGGTTCTCCCAGCATGCAGCTGG + Intronic
1068050785 10:51946955-51946977 TGGTTCTCCCAGCATGCAGCTGG - Intronic
1068376401 10:56186871-56186893 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1069548857 10:69348452-69348474 TGGAGTTCCCATCATGCAGCTGG + Intronic
1070894416 10:79970313-79970335 TGGAGCTAAAAGAATGCAGCTGG - Intronic
1071005723 10:80882105-80882127 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1071303940 10:84280605-84280627 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1071448302 10:85769973-85769995 TGGTTCTCCCAGCATGCAGCTGG + Intronic
1071912464 10:90251251-90251273 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1072377214 10:94830022-94830044 TGGTTCTCCCAGCATGCAGCTGG - Intronic
1072383353 10:94898404-94898426 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1072399229 10:95079852-95079874 TGGTTCTCACAGCACGCAGCTGG + Intergenic
1073040301 10:100599592-100599614 TGGAGCTCTCAGTCTCCTGCTGG + Intergenic
1073587528 10:104725464-104725486 TGGTACTCCCAGCATGCAGCTGG - Intronic
1073837762 10:107464182-107464204 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1074199369 10:111221005-111221027 TTAAGATCTCAGCATGCTGCTGG + Intergenic
1074903239 10:117838254-117838276 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1076213762 10:128675544-128675566 TAGAGCTCACTGCACACTGCAGG - Intergenic
1077378696 11:2217793-2217815 AGGCGCTGGCAGCATGCTGCAGG - Intergenic
1077524792 11:3057518-3057540 TACAGCTCCCAGCATGCTCCGGG - Intronic
1077697326 11:4406280-4406302 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1077788588 11:5412940-5412962 TGGTTCTCCCAGCATGCAGCTGG + Intronic
1078242764 11:9545705-9545727 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1078695609 11:13628592-13628614 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1078979917 11:16521128-16521150 TGGTTCTCCCAGCATGCAGCTGG + Intronic
1079121045 11:17685277-17685299 TGGAGCTCAGAGCTGGCTTCTGG - Intergenic
1079286261 11:19135697-19135719 TGGTTCTCCCAGCATGCAGCTGG + Intronic
1079470011 11:20769200-20769222 TGGAGCTCAGGGCTTGCTGATGG + Intronic
1079549286 11:21674409-21674431 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1079577476 11:22021362-22021384 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1079822367 11:25146784-25146806 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1079859501 11:25649142-25649164 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1079865071 11:25724225-25724247 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1079922678 11:26451733-26451755 TGGTTCTCCCAGCATGCAGCTGG + Intronic
1080579395 11:33630147-33630169 TGGTCCTCCCAGCATGCAGCTGG - Intronic
1080810959 11:35703408-35703430 TGGTTCTCTCAGCATGCAGCTGG + Intronic
1080816220 11:35759981-35760003 TGGTTCTCCCAGCATGCAGCTGG - Intronic
1081086822 11:38811816-38811838 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1081454362 11:43206720-43206742 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1082123256 11:48402978-48403000 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1082141731 11:48617243-48617265 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1082232136 11:49780491-49780513 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1082568891 11:54714049-54714071 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1082579688 11:54850578-54850600 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1082586499 11:54947603-54947625 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1082596194 11:55085008-55085030 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1082642893 11:55686278-55686300 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1082736730 11:56864264-56864286 TGGAGCTCACAGATTACTGAAGG + Intergenic
1082877058 11:57999527-57999549 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1082970544 11:59015876-59015898 TGGTTCTCCCAGCATGCAGCTGG + Intronic
1083544613 11:63538955-63538977 AGGAGCTCACAGCATCCTGCTGG - Intronic
1083770514 11:64864394-64864416 TGGAGCTCAGAGCCAGCTGCAGG - Intronic
1084247654 11:67871127-67871149 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1084465300 11:69319863-69319885 CGGAGCTCAGAGCCTGCTGAGGG - Intronic
1084969327 11:72761692-72761714 TGGAGCACACAGCATGATCTCGG - Intronic
1085222646 11:74888075-74888097 TGGTTCTCCCAGCATGCAGCTGG + Intronic
1086015012 11:82156496-82156518 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1086417023 11:86598598-86598620 TGGTTCTCCCAGCATGCAGCTGG + Intronic
1086548580 11:88027875-88027897 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1086744235 11:90405440-90405462 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1087067140 11:94037493-94037515 TGGTTCTCCCAGCATGCAGCTGG + Intronic
1087916753 11:103820295-103820317 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1088257934 11:107918427-107918449 TGGAGCTCACAGTATCTTGGTGG + Intronic
1088309541 11:108445258-108445280 TGGTTCTCCCAGCATGCAGCTGG + Intronic
1088370487 11:109083562-109083584 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1088731088 11:112683915-112683937 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1088849490 11:113693356-113693378 GGGAGCTCACCGCCTGCTGACGG - Intronic
1089617466 11:119703032-119703054 TGGAGCTCACAGGCTGGTGGGGG - Intronic
1090579138 11:128140690-128140712 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1090597628 11:128336316-128336338 TGAAGCTCCCAGCAGGCAGCAGG + Intergenic
1090896857 11:130984901-130984923 TGGTCCTCCCAGCATGCAGCTGG + Intergenic
1090954947 11:131505578-131505600 TGGATCACACAGCAGGCAGCTGG + Intronic
1091045302 11:132319771-132319793 TGGTTCTCCCAGCATGCAGCTGG + Intronic
1091809705 12:3386202-3386224 TTGAGCATACACCATGCTGCAGG - Intronic
1092417933 12:8306523-8306545 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1092553235 12:9526916-9526938 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1092706525 12:11290870-11290892 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1093265509 12:16998950-16998972 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1093309770 12:17564581-17564603 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1093314196 12:17628015-17628037 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1093404299 12:18785851-18785873 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1093493906 12:19734184-19734206 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1093571274 12:20668473-20668495 TGGTTCTCCCAGCATGCAGCTGG + Intronic
1094092854 12:26670196-26670218 TGGTTCTCCCAGCATGCAGCTGG + Intronic
1094282981 12:28760865-28760887 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1094341043 12:29411798-29411820 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1094451681 12:30588993-30589015 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1094518872 12:31163710-31163732 TGGTTCTCCCAGCATGCGGCTGG + Intergenic
1094725242 12:33107796-33107818 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1094804140 12:34072187-34072209 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1094861900 12:34476938-34476960 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1095065079 12:37762339-37762361 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1095105649 12:38230334-38230356 TGGCTCTCCCAGCATGCAGCTGG - Intergenic
1095165663 12:38968957-38968979 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1095167251 12:38988301-38988323 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1095276274 12:40286556-40286578 TGGGGCTCAGAGCATGGTGGGGG - Intronic
1095388051 12:41673083-41673105 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1095424816 12:42063623-42063645 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1095490154 12:42725298-42725320 TGGATCTCCCAGCATGCAGCTGG - Intergenic
1095657434 12:44686782-44686804 TGGCGCTCCCAGCACGCAGCTGG - Intronic
1096895526 12:54818062-54818084 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1096931117 12:55211063-55211085 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1096940959 12:55344887-55344909 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1097344572 12:58476900-58476922 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1097409044 12:59227816-59227838 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1097452367 12:59751753-59751775 TGGTTCTCCCAGCATGCAGCTGG + Intronic
1097528362 12:60766825-60766847 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1097567927 12:61294411-61294433 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1097578144 12:61420465-61420487 TGGTTCTCCCAGCATGCAGCCGG - Intergenic
1097740856 12:63241025-63241047 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1097837975 12:64292719-64292741 TGGTTCTCCCAGCATGCAGCTGG - Intronic
1098463990 12:70765659-70765681 TGGTTCTCCCAGCATGCAGCTGG + Intronic
1098642595 12:72856919-72856941 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1098668847 12:73199130-73199152 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1098683926 12:73395446-73395468 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1098726787 12:73978503-73978525 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1099380628 12:81947844-81947866 TGGAGCACAGAGCATGCTTATGG + Intergenic
1099514850 12:83584905-83584927 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1099521839 12:83674453-83674475 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1099538194 12:83871604-83871626 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1099548174 12:84011275-84011297 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1099841730 12:87975138-87975160 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1100746919 12:97656510-97656532 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1101240373 12:102832549-102832571 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1102400194 12:112621832-112621854 TGGTTCTCCCAGCATGCAGCTGG + Intronic
1102466495 12:113133677-113133699 TGGAGCTCCCAGCAGCCTCCAGG + Intronic
1102833993 12:116036044-116036066 TGGAGCTCACATTATGGTGAGGG - Intronic
1104069566 12:125332478-125332500 TGGAGGGCACAGCCTGCTTCTGG - Intronic
1104164945 12:126218941-126218963 TGGAGCTGAAAGCATGCTAAAGG - Intergenic
1104333152 12:127866493-127866515 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1105072765 12:133245578-133245600 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1105667397 13:22575371-22575393 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1105875960 13:24553896-24553918 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1106867721 13:33985303-33985325 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1107231236 13:38112770-38112792 TGGTTCTCCCAGCATGCAGCGGG + Intergenic
1107951093 13:45462911-45462933 TGGGGAACACAGCATGCTGCTGG + Intergenic
1108628358 13:52254953-52254975 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1108657701 13:52551496-52551518 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1109823287 13:67685632-67685654 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1110813891 13:79840300-79840322 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1110991302 13:82045988-82046010 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1111530185 13:89526491-89526513 AGGAGCTGACAACATGGTGCTGG - Intergenic
1112663783 13:101544542-101544564 TGGTTCTCCCAGCATGCAGCTGG - Intronic
1113800999 13:113086165-113086187 TGGAGCTCAGCGCCTCCTGCAGG - Exonic
1114801108 14:25776814-25776836 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1114801827 14:25784222-25784244 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1114807722 14:25857344-25857366 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1115719802 14:36148030-36148052 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1115723210 14:36185188-36185210 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1115743521 14:36412351-36412373 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1115792708 14:36898022-36898044 TGGTTCTCCCAGCATGCAGCTGG - Intronic
1116092455 14:40326842-40326864 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1116094325 14:40348693-40348715 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1116290106 14:43023756-43023778 TGGAGCTCCAAGGATGCTTCCGG + Intergenic
1116405063 14:44557141-44557163 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1117193756 14:53318679-53318701 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1118780493 14:69004568-69004590 TGGAACTCACAGCATCCTCCAGG - Intergenic
1118955295 14:70475841-70475863 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1119097588 14:71848337-71848359 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1119409249 14:74419294-74419316 TGGAGCTCACAGTCTGGTGAAGG - Intronic
1119731454 14:76953761-76953783 TGGAGCTCAGGGCCTGCTGGCGG - Intergenic
1119920974 14:78445653-78445675 TGGAGCTCACAGTCTGTTGAGGG - Intronic
1120971498 14:90212147-90212169 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1121376732 14:93418514-93418536 TGGTTCTCCCAGCATGCAGCTGG - Intronic
1122376839 14:101266834-101266856 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1122442243 14:101740020-101740042 TGGAGCTCAGAGGGTCCTGCTGG + Intergenic
1122631302 14:103108950-103108972 TGGAGCTCACAGAAAGCCCCTGG + Intronic
1122800416 14:104226620-104226642 TGGAGCTACCAGCCTTCTGCGGG + Intergenic
1122961032 14:105093699-105093721 TGGACCCCCCAGCACGCTGCGGG + Intergenic
1124022075 15:25934088-25934110 TGTCGCTCACAGCACACTGCAGG - Intergenic
1126248747 15:46541742-46541764 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1126254972 15:46614941-46614963 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1126501875 15:49354864-49354886 TGGTTCTCCCAGCATGCAGCTGG + Intronic
1127189565 15:56515404-56515426 TGGTTCTCCCAGCATGCAGCCGG - Intergenic
1127255643 15:57290524-57290546 TGGTCTTCACACCATGCTGCAGG + Intronic
1127711683 15:61605113-61605135 AGGAGCTCCCAGCATGCAGTTGG + Intergenic
1128290807 15:66476971-66476993 TGAACCCCAGAGCATGCTGCTGG - Intronic
1129978389 15:79843743-79843765 TGGAGCTCACAGTATGGTGAAGG + Intronic
1130032625 15:80329277-80329299 TGAAGGTCACAGCTTGCTGAGGG - Intergenic
1130034179 15:80342420-80342442 TGCAGGTCACAGCTTGCTGAGGG + Intergenic
1130190536 15:81730918-81730940 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1130778050 15:87006182-87006204 TGGTTCTCCCAGCATGCAGCTGG - Intronic
1130947417 15:88559607-88559629 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1131014752 15:89049256-89049278 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1131615336 15:94010968-94010990 TGAATCTCAAAGCATGCTGGTGG + Intergenic
1131929045 15:97418815-97418837 TGGTTCTCACAGCATGCAGCTGG - Intergenic
1132004967 15:98218602-98218624 TGAGGCTGACAGCATGCTCCTGG + Intergenic
1132591060 16:726695-726717 TGTAGCTCAGGGCATCCTGCGGG - Intronic
1132939196 16:2498649-2498671 TGGAGCTCACAGCATTGTCTTGG + Intronic
1132945597 16:2530074-2530096 TGGAGCCCACAGCCTGGTTCTGG + Exonic
1133333996 16:4994926-4994948 CGGAGCTCCCAGCATCCTTCCGG - Intronic
1135268351 16:21048043-21048065 TGGTTCTCACAGCAAGCAGCTGG - Intronic
1136056380 16:27692858-27692880 AGAAGCTCACAGCATAGTGCAGG + Intronic
1136685931 16:31994947-31994969 AGGAGCTCAGTGCATGCTGAGGG - Intergenic
1137075810 16:35959148-35959170 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1138940382 16:61782713-61782735 TGGGTCTCCCAGCATGCAGCTGG + Intronic
1139375993 16:66496621-66496643 TGGTTCTCCCAGCATGCAGCTGG + Intronic
1140410776 16:74739180-74739202 GAGAGCTCACAGCCTGGTGCAGG - Intronic
1140539212 16:75740316-75740338 TGGTTCTCCCAGCATGCAGCTGG - Intronic
1140846625 16:78894992-78895014 TGGAGATCCCATCATGCCGCCGG + Intronic
1141751321 16:85960399-85960421 AGGAAATCTCAGCATGCTGCAGG + Intergenic
1142135911 16:88452010-88452032 AGGAGCTCCCAGCAGGCTGGCGG + Intergenic
1142201830 16:88764811-88764833 GGGAGGTCACGGCATGATGCTGG - Intronic
1142695456 17:1630230-1630252 TGGAGCTGTCAGCCTGCTGGGGG + Intergenic
1143040321 17:4030582-4030604 TGGAGATCACAGCTCACTGCAGG + Intronic
1143101476 17:4506941-4506963 TGAAGATCACAGCCTCCTGCGGG + Intronic
1143112059 17:4558452-4558474 CGGGGCTCACAGCAGTCTGCAGG + Exonic
1143422711 17:6807956-6807978 TGGTTCTCCCAGCATGCAGCTGG - Intronic
1143574513 17:7782979-7783001 TGGAGGTCACAGGATGATGGTGG + Intronic
1144092016 17:11866512-11866534 TGGTTCTCCCAGCATGCAGCTGG - Intronic
1144151767 17:12455275-12455297 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1144789469 17:17849441-17849463 TGCAGCTCCCAGGAGGCTGCAGG - Intronic
1144854354 17:18259846-18259868 TGTAGCTCGCAGCATACAGCAGG + Intergenic
1145724387 17:27104521-27104543 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1146732294 17:35204299-35204321 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1146752547 17:35394576-35394598 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1146945501 17:36870422-36870444 TGCAGCTCACGTCAGGCTGCCGG - Intergenic
1147146885 17:38490611-38490633 TGGAGCTCAGTGCGTGCTGAGGG - Intronic
1147988040 17:44317740-44317762 TGGAGCTCACAGTCTGGTGGGGG - Intronic
1148350227 17:46936142-46936164 GGGAGCGCCCAGCAGGCTGCTGG - Intronic
1149059824 17:52409206-52409228 TGGCTCTCCCAGCATGCAGCTGG - Intergenic
1149323124 17:55502348-55502370 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1149408654 17:56380934-56380956 TGGTTCTCCCAGCATGCAGCTGG + Intronic
1150778560 17:68101278-68101300 TGGAGCGCCCTGCATGCTGTGGG + Intergenic
1150996985 17:70329829-70329851 GGGAGCTCAGAGAATGGTGCAGG + Intergenic
1151683064 17:75631769-75631791 TGGGGCTCCCGGCATGGTGCCGG - Intronic
1152448503 17:80361082-80361104 TACAGGTCACAGCATGCTTCAGG - Intronic
1152667254 17:81578235-81578257 TGGAGAGCACAGCATGCACCCGG - Intronic
1152718193 17:81909891-81909913 TGGAGCCCACTGAAAGCTGCAGG + Intronic
1152919500 17:83058914-83058936 CGGGGCTCACAGCAGGCTGCCGG + Intergenic
1153790899 18:8578707-8578729 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1154149263 18:11893423-11893445 TGGACCTCACAGCAGGATGAGGG + Intronic
1154397653 18:14006296-14006318 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1155426966 18:25716788-25716810 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1156206860 18:34895412-34895434 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1156532555 18:37832274-37832296 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1156932387 18:42660958-42660980 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1157205551 18:45695107-45695129 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1157632041 18:49107894-49107916 TGGTTCTCCCAGCATGCAGCTGG - Intronic
1158180390 18:54708977-54708999 TGGAGCCCACAGTCTGCTGTGGG - Intergenic
1158347066 18:56526202-56526224 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1158732055 18:60035048-60035070 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1159126607 18:64231815-64231837 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1159171324 18:64771974-64771996 TAGAGCACACAGCATTCTGATGG + Intergenic
1159311469 18:66715712-66715734 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1159993431 18:74938243-74938265 TCGTGCTCAGAGCATGATGCTGG - Intronic
1160691576 19:462643-462665 GGGGGCTCACAGCATGCCCCAGG + Intergenic
1161252482 19:3288028-3288050 TGCAGCTCACAGCACACTGGGGG + Intronic
1162172349 19:8801338-8801360 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1162245690 19:9398328-9398350 TGGTTCTCTCAGCATGCAGCTGG + Intergenic
1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG + Intergenic
1162916877 19:13879348-13879370 AGGAGCTCACAGTCTGCTGGGGG - Intronic
1163463331 19:17452383-17452405 TGGTGCTCACAGCCTGGTGGGGG + Intronic
1164347640 19:27285901-27285923 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1164420574 19:28088287-28088309 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1164552909 19:29226414-29226436 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1164578263 19:29418670-29418692 TTGAGCTCACACAGTGCTGCAGG - Intergenic
1164607289 19:29609321-29609343 GGGAGCTCACAGTATGATGGTGG - Intronic
1164706274 19:30322676-30322698 TGGAGCTCACAGTAAGTTTCTGG + Intronic
1165288201 19:34860826-34860848 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1165494844 19:36146451-36146473 TGGAGCTCACAGTCTGGTGGAGG + Intronic
1165563582 19:36703422-36703444 TGGTTCTCCCAGCATGCAGCTGG - Intronic
1165938016 19:39401270-39401292 TGGTGCACACTGCATGCTCCAGG + Intergenic
1166433750 19:42749439-42749461 TGGTTCTCCCAGCATGCAGCTGG - Intronic
1166446575 19:42863025-42863047 TGGTTCTCCCAGCATGCAGCTGG - Intronic
1166566865 19:43770804-43770826 TTGAGCTCACAGCCTGCTCCTGG - Intronic
1166613928 19:44226270-44226292 TGGTTCTCCCAGCATGCAGCTGG - Intronic
1167611905 19:50511758-50511780 GGGAGCTGGCAGCAGGCTGCGGG + Exonic
1202632436 1_KI270706v1_random:13328-13350 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1202653429 1_KI270707v1_random:26723-26745 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
925470769 2:4158447-4158469 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
925640437 2:5981575-5981597 CGGGGATCACAGGATGCTGCCGG - Intergenic
925963300 2:9038967-9038989 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
926595824 2:14788824-14788846 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
926601338 2:14848701-14848723 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
927094094 2:19734696-19734718 TGAACCTCACAGCCTCCTGCTGG + Intergenic
927149232 2:20186230-20186252 TGGAGATCACAGCATCCTGCCGG - Intergenic
927213730 2:20654073-20654095 TGGGGCTCACAGCCCACTGCAGG + Intergenic
927354447 2:22157081-22157103 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
927492417 2:23529402-23529424 TGGAGCTCTTAGCCAGCTGCAGG - Intronic
928463392 2:31496941-31496963 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
928628947 2:33170657-33170679 TGGTTCTCCCAGCATGCAGCTGG + Intronic
928802570 2:35112350-35112372 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
928881109 2:36097643-36097665 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
929274801 2:40013959-40013981 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
929588644 2:43131443-43131465 TGGAGCACCCAGCAGGCTTCGGG - Intergenic
929801976 2:45112074-45112096 TGGAGCTGAAAGCATGATGCTGG + Intergenic
930220409 2:48740466-48740488 TGGTTCTCACAGCACGCAGCTGG + Intronic
930461329 2:51681321-51681343 TCTAGCAAACAGCATGCTGCAGG - Intergenic
930801035 2:55442744-55442766 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
930972963 2:57419345-57419367 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
931205544 2:60141828-60141850 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
931477666 2:62605875-62605897 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
931887427 2:66632577-66632599 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
932990569 2:76781120-76781142 TGGTTCTCCCAGCATGCAGCTGG - Intronic
932991740 2:76796441-76796463 TGGTTCTCCCAGCATGCAGCTGG + Intronic
933186746 2:79287615-79287637 TGGTTCTCCCAGCATGCAGCAGG - Intronic
933241082 2:79920964-79920986 TTTAGTTCACAGCATTCTGCAGG + Intronic
933550427 2:83768940-83768962 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
933816607 2:86073701-86073723 TGGAGTTGACAGCATGGTGGGGG - Intronic
934550354 2:95257558-95257580 TGGTTCTCCCAGCATGCAGCTGG - Intronic
934627159 2:95870161-95870183 TGGTTCTCCCAGCATGCAGCTGG + Intronic
934693406 2:96379609-96379631 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
934806404 2:97231134-97231156 TGGTTCTCCCAGCATGCAGCTGG - Intronic
934925512 2:98379528-98379550 TGGAGCTCACGGCAAGCTCCAGG + Intronic
935422017 2:102879521-102879543 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
935878327 2:107536175-107536197 TGGAGCCCACAGCAGGGTGGAGG + Intergenic
936036485 2:109117126-109117148 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
936621401 2:114101794-114101816 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
936914276 2:117623889-117623911 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
937471386 2:122176724-122176746 TGCAGTGCACAGCATGCAGCAGG - Intergenic
937533970 2:122863566-122863588 TGGAGCTCACTGAATGCCACTGG - Intergenic
938445469 2:131373923-131373945 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
938534957 2:132231959-132231981 TGGTTCTCCCAGCATGCAGCTGG + Intronic
938666882 2:133547502-133547524 TGGTTCTCCCAGCATGCAGCTGG + Intronic
938704532 2:133911118-133911140 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
938848125 2:135232447-135232469 TGGTTCTCCCAGCATGCAGCTGG + Intronic
939554918 2:143662190-143662212 TGGTTCTCCCAGCATGCAGCTGG + Intronic
941534678 2:166708098-166708120 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
941611581 2:167668318-167668340 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
941626473 2:167835681-167835703 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
941904850 2:170710882-170710904 TGAAGCTCACAGCATTGTGCAGG + Intergenic
942086566 2:172449495-172449517 TGGAGCTAACAGCATTCTAGGGG + Intronic
942416057 2:175760233-175760255 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
942977031 2:182030580-182030602 TGGTTCTCCCAGCATGCAGCTGG - Intronic
942992002 2:182213041-182213063 TGGTTCTCCCAGCATGCAGCTGG + Intronic
943244165 2:185424804-185424826 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
943309988 2:186313413-186313435 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
944056130 2:195523640-195523662 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
944332093 2:198481827-198481849 TGGATGTCAGACCATGCTGCAGG + Intronic
944659581 2:201910257-201910279 TGGAGAGCACAGCATGATGGGGG - Intergenic
945115539 2:206404742-206404764 TTGAGCCCACAGCATGGTCCAGG - Intergenic
945171535 2:207001542-207001564 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
945495836 2:210506039-210506061 TGGTTCTCCCAGCATGCAGCTGG + Intronic
945822742 2:214684410-214684432 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
946496657 2:220202365-220202387 TGTAGCACACAGGATGCAGCAGG - Intergenic
947266092 2:228283619-228283641 TGGAGTTCACAGCATCTCGCAGG + Intergenic
947290539 2:228568897-228568919 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
947909281 2:233790730-233790752 AGGAGCTCAGCGCATGCTTCTGG - Intronic
1170097492 20:12662784-12662806 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1170515025 20:17120279-17120301 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1170545260 20:17430901-17430923 GGGAGCTCACAGCTTTCTGGAGG + Intronic
1170938104 20:20827116-20827138 TGGAACTCCCAGCCAGCTGCAGG + Intergenic
1171357286 20:24557800-24557822 TGGTTCTCCCAGCATGCGGCTGG - Intronic
1171910663 20:30949481-30949503 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1172186081 20:33031829-33031851 TGGAGCTCACGGGATGCTCCAGG - Intronic
1172702366 20:36861580-36861602 TGGAGCTCACAGCATGCTGCTGG - Intronic
1172996383 20:39072999-39073021 TGGACTTCACAGCATGCTAGAGG + Intergenic
1173177600 20:40776440-40776462 TGGAGCTCCTAGAATGTTGCTGG - Intergenic
1173357714 20:42309845-42309867 TGGAGCTCTCAGCATGCTGTGGG + Intronic
1173774543 20:45693322-45693344 TGGTTCTCCCAGCATGCAGCTGG - Intronic
1174166570 20:48587752-48587774 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1174445223 20:50586611-50586633 TGGAGCTCACAGACGGCGGCTGG - Exonic
1175512148 20:59537144-59537166 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1175928376 20:62481733-62481755 AGGAGCTGACAGGAGGCTGCGGG - Intergenic
1176309205 21:5140891-5140913 TGGGTGTGACAGCATGCTGCTGG + Intronic
1176590055 21:8639698-8639720 TGGTGTTCCCAGCATGCAGCTGG + Intergenic
1176598733 21:8772932-8772954 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1177025770 21:15920074-15920096 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1178101859 21:29278558-29278580 TGGAGCTCACACATTGCTGATGG + Intronic
1178568867 21:33716101-33716123 TGGAGATAACAGCATGCCCCAGG + Intronic
1179793949 21:43771520-43771542 TGGGGCTCACAGCATGGGGGCGG - Intergenic
1179847856 21:44121142-44121164 TGGGTGTGACAGCATGCTGCTGG - Intronic
1180368300 22:11960025-11960047 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1180377796 22:12111306-12111328 TGGATCTCTCAGCACGCAGCTGG - Intergenic
1181010519 22:20037690-20037712 AGCAGCAGACAGCATGCTGCAGG + Intronic
1181735212 22:24876241-24876263 TCATGCTCACAGGATGCTGCAGG - Intronic
1181800417 22:25344343-25344365 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1182180192 22:28339379-28339401 TGGTTCTCCCAGCATGCAGCTGG - Intronic
1182707955 22:32300022-32300044 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1183316178 22:37138032-37138054 AGGAGCTCACAGTCTGCTGGGGG - Intronic
1183709546 22:39494823-39494845 TGGAGCTCTCACCATGCTCCAGG - Intergenic
1184558824 22:45249144-45249166 TGGAGCTCACAGAATTTTGAGGG + Intergenic
1184833761 22:47008260-47008282 TGGAGCTCTCAGTGTGCTGTGGG + Intronic
1185171943 22:49299364-49299386 TGGAGCTCGGAGCAGGCTCCCGG - Intergenic
949137227 3:581989-582011 TGGTGTTCCCAGCATGCAGCTGG - Intergenic
949154327 3:810018-810040 TGGCTCTCCCAGCATGCAGCTGG + Intergenic
949201743 3:1388186-1388208 TGGTTCTCCCAGCATGCAGCTGG + Intronic
949383919 3:3478585-3478607 TGAAGCTTACCTCATGCTGCAGG + Intergenic
949425189 3:3908816-3908838 TGGTTCTCCCAGCATGCAGCTGG - Intronic
949717512 3:6950544-6950566 TGGTTCTCCCAGCATGCAGCTGG - Intronic
950968243 3:17161441-17161463 AGGGGCTCACAAGATGCTGCTGG - Intronic
951042665 3:18005176-18005198 TGGTTCTCCCAGCATGCAGCTGG - Intronic
951381409 3:21988536-21988558 TGGTTCTCCCAGCATGCAGCTGG - Intronic
952104222 3:30050767-30050789 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
952514399 3:34089896-34089918 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
952514986 3:34094712-34094734 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
952574962 3:34763728-34763750 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
953116215 3:39994691-39994713 TGGTTCTCCCAGCATGCAGCTGG + Intronic
953354020 3:42239130-42239152 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
953458890 3:43065408-43065430 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
954448821 3:50560866-50560888 TGGAGGACAGAGGATGCTGCAGG + Intronic
954986908 3:54802705-54802727 TGGTTCTCCCAGCATGCAGCTGG + Intronic
955014105 3:55051472-55051494 TGGTTCTCCCAGCATGCAGCTGG - Intronic
955211523 3:56945781-56945803 TGGTTCTCCCAGCATGCAGCTGG + Intronic
955268980 3:57477577-57477599 TGGTTCTCCCAGCATGCAGCTGG + Intronic
955385125 3:58473201-58473223 TGGAGCTCATAGCATGAGCCTGG - Intergenic
955606534 3:60710921-60710943 TGGTTCTCCCAGCATGCAGCTGG + Intronic
956173321 3:66450330-66450352 TGAAGCTCCCAGCATTCTGTGGG - Intronic
956279416 3:67540667-67540689 TGGATCTCCCAGCACACTGCTGG + Intronic
956954316 3:74318844-74318866 TGGTTCTCCCAGCATGCAGCTGG - Intronic
957227501 3:77468854-77468876 TGGAGTTGTCAGCATGCTACAGG + Intronic
957565453 3:81878764-81878786 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
957967967 3:87345857-87345879 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
958205661 3:90387796-90387818 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
958512374 3:95065298-95065320 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
958555029 3:95662681-95662703 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
958829876 3:99074010-99074032 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
958961074 3:100510243-100510265 TGGTTCTCCCAGCATGCAGCTGG + Intronic
959744403 3:109759916-109759938 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
959812645 3:110637391-110637413 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
960448609 3:117778620-117778642 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
960839055 3:121938132-121938154 TGGTTCTCCCAGCATGCAGCTGG - Intronic
961291537 3:125850449-125850471 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
962004257 3:131332113-131332135 TGGTTCTCCCAGCATGCAGCTGG + Intronic
962629822 3:137264464-137264486 TGGAGCTCGGAGCTTACTGCGGG - Intergenic
963303194 3:143621268-143621290 TGGTTCTCCCAGCATGCAGCTGG + Intronic
963435175 3:145257976-145257998 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
963567334 3:146946156-146946178 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
963978522 3:151510128-151510150 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
964376899 3:156056825-156056847 TGGTCAACACAGCATGCTGCTGG + Intronic
964536267 3:157725332-157725354 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
964550567 3:157879970-157879992 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
964686061 3:159397688-159397710 TGGTTCTCCCAGCATGCAGCTGG - Intronic
964688478 3:159423706-159423728 TGGTTCTCCCAGCATGCAGCTGG + Intronic
964694459 3:159491754-159491776 TGGTTCTCCCAGCATGCAGCTGG + Intronic
965035216 3:163429742-163429764 TGGCTCTCCCAGCATGCAGCTGG + Intergenic
965271110 3:166618076-166618098 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
965827990 3:172750327-172750349 TACAGCTCACAGCAAGCAGCAGG + Intergenic
965974555 3:174605816-174605838 TGGTTCTCCCAGCATGCAGCTGG + Intronic
967000574 3:185330346-185330368 GGGAGCTCAGATCATGGTGCTGG + Intronic
968832377 4:2939683-2939705 TGGAGCTCAGGGCACGCAGCAGG - Intronic
969151748 4:5175790-5175812 TGGTTCTCCCAGCATGCAGCTGG - Intronic
969188257 4:5496070-5496092 TGGTTCTCCCAGCATGCAGCTGG - Intronic
969222036 4:5767267-5767289 TGGTTCTCCCAGCATGCAGCTGG - Intronic
969638010 4:8380607-8380629 AGCACCTCACAGCCTGCTGCTGG - Intronic
969807191 4:9618247-9618269 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
970278295 4:14426020-14426042 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
970348248 4:15174642-15174664 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
970611542 4:17729401-17729423 TGGTTCTCCCAGCATGCAGCTGG + Intronic
970623291 4:17849179-17849201 TGGTTCTCCCAGCATGCAGCTGG + Intronic
970689177 4:18602610-18602632 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
970823053 4:20241911-20241933 GAGGGCTCACAGCATGCTTCTGG + Intergenic
971463014 4:26923000-26923022 TGGTTCTCCCAGCATGCAGCTGG + Intronic
971476286 4:27075606-27075628 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
971880619 4:32365922-32365944 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
972086275 4:35220734-35220756 TGGATCTCACAGCCTAATGCAGG - Intergenic
972119522 4:35682655-35682677 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
973274915 4:48296619-48296641 TGTAACTCCCAGCATGCTGTGGG + Intergenic
973311225 4:48711713-48711735 TGGTTCTCCCAGCATGCAGCTGG + Intronic
973347114 4:49068479-49068501 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
973362070 4:49175299-49175321 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
973569470 4:52223718-52223740 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
973597262 4:52504842-52504864 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
973806798 4:54534432-54534454 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
973858980 4:55041929-55041951 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
974238039 4:59207091-59207113 TGGCTCTCCCAGCATGCAGCTGG + Intergenic
974427537 4:61760146-61760168 TGGTTCTCCCAGCATGCAGCTGG - Intronic
974690639 4:65293605-65293627 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
974798500 4:66783407-66783429 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
975144116 4:70948883-70948905 TGAAGCTCAGAGCATGGTGGAGG - Intronic
975250163 4:72169265-72169287 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
975277608 4:72520333-72520355 TGGTTCTCCCAGCATGCAGCTGG - Intronic
975368035 4:73551269-73551291 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
975531291 4:75401833-75401855 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
975535687 4:75447904-75447926 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
975992327 4:80269290-80269312 GGGAGCTCAGAGAATGCTTCTGG + Intronic
976025968 4:80688314-80688336 TGGTTCTCCCAGCATGCAGCTGG + Intronic
976356759 4:84127423-84127445 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
976529481 4:86135310-86135332 TGGATCTCCCAGCATACAGCTGG + Intronic
976565593 4:86547638-86547660 TGGAGCTCCCTGCCTGCCGCCGG - Intronic
976998257 4:91463010-91463032 TGGTTCTCCCAGCATGCAGCTGG + Intronic
977023908 4:91791397-91791419 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
977480231 4:97565928-97565950 TGGTTCTCCCAGCATGCAGCTGG - Intronic
977619143 4:99117161-99117183 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
977655816 4:99519452-99519474 TGGAGCTCACAGCTTAGTGGAGG - Intronic
977775703 4:100916816-100916838 TGGTCCTCCCAGCATGCAGCTGG + Intergenic
978216715 4:106213992-106214014 TGGTTCTCCCAGCATGCAGCTGG + Intronic
978246300 4:106576414-106576436 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
978336290 4:107672720-107672742 TGGTTCTCCCAGCATGCAGCTGG + Intronic
978736228 4:112087105-112087127 TGGATCTCTCAGCATGCAGCTGG + Intergenic
979196195 4:117922624-117922646 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
979299168 4:119067404-119067426 TGGTTCTCCCAGCATGCAGCCGG - Intergenic
979693103 4:123581465-123581487 TGGAGCTCACAGCCAGCAGCTGG + Intergenic
979886148 4:126030383-126030405 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
980018207 4:127677248-127677270 TGGTTCTCCCAGCATGCAGCTGG + Intronic
981150929 4:141378414-141378436 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
981158643 4:141470790-141470812 TGGAGATCAGATCATGCCGCTGG + Intergenic
981330267 4:143500106-143500128 TGGAGCTCCAAGCATGCTGTAGG - Intergenic
981607764 4:146558416-146558438 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
982651182 4:158089611-158089633 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
982675253 4:158368042-158368064 TGGTTCTCCCAGCATGCAGCTGG - Intronic
982691221 4:158549939-158549961 TGGTTCTCCCAGCATGCAGCTGG - Intronic
982836491 4:160125576-160125598 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
983069338 4:163250777-163250799 TGGAACTCAGAGAATGGTGCAGG + Intergenic
983173717 4:164563781-164563803 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
983326618 4:166266038-166266060 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
983672876 4:170258827-170258849 TGGTCCTCAGAGCATGCTGCAGG + Intergenic
984659919 4:182362212-182362234 TGGTTCTCCCAGCATGCAGCTGG - Intronic
985161704 4:187051141-187051163 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
985234900 4:187862259-187862281 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1202759409 4_GL000008v2_random:96767-96789 TGGATCTCTCAGCACGCAGCTGG - Intergenic
985662285 5:1163318-1163340 TGGAGCTGTCAGCTTGGTGCTGG + Intergenic
986326424 5:6678591-6678613 AAGAGCTCCCAGCAGGCTGCTGG - Intergenic
987172405 5:15272039-15272061 TGGTTCTCCCAGCATGCAGCCGG + Intergenic
987482125 5:18472454-18472476 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
988086066 5:26476679-26476701 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
988514522 5:31892886-31892908 TGGAGCTCACAGCCTGACGGTGG + Intronic
988724255 5:33909946-33909968 CGGAGCTCACAGATTACTGCAGG + Intergenic
988880298 5:35494810-35494832 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
988880306 5:35494878-35494900 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
989214012 5:38885009-38885031 TGTGGCTCACAGAATGCTTCGGG - Intronic
989449473 5:41570027-41570049 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
989544792 5:42660257-42660279 TGGTTCTCCCAGCATGCAGCTGG + Intronic
989569540 5:42932369-42932391 TGGTACTCCCAGCATGCAGCTGG + Intergenic
989660503 5:43792276-43792298 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
989682078 5:44041543-44041565 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
989779093 5:45243323-45243345 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
989794090 5:45445534-45445556 TGGTTCTCCCAGCATGCAGCTGG + Intronic
989816929 5:45748539-45748561 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
989824576 5:45838188-45838210 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
989949517 5:50280856-50280878 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
989956558 5:50367406-50367428 TGGCTCTCCCAGCATGCAGCTGG + Intergenic
989965116 5:50458356-50458378 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
989966407 5:50470770-50470792 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
990179222 5:53141705-53141727 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
990340095 5:54813601-54813623 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
990648377 5:57870228-57870250 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
990684762 5:58288687-58288709 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
990838568 5:60049733-60049755 TGGTTCTCCCAGCATGCAGCTGG - Intronic
990842966 5:60104509-60104531 TGGTTCTCCCAGCATGCAGCTGG + Intronic
991052967 5:62292176-62292198 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
991086938 5:62656258-62656280 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
991253918 5:64594230-64594252 TGGCCCTCTCAGCATGCAGCAGG - Intronic
991415487 5:66388108-66388130 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
991451045 5:66750920-66750942 TGGTTCTCCCAGCATGCAGCTGG + Intronic
991543707 5:67758189-67758211 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
992863644 5:80936971-80936993 CAGCGCTCAGAGCATGCTGCTGG + Intergenic
993790194 5:92198835-92198857 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
993917597 5:93761709-93761731 TGGTTCTCCCAGCATGCAGCTGG + Intronic
994983364 5:106904528-106904550 TGGATCTCCCAGCATGCAGCTGG - Intergenic
995905430 5:117117277-117117299 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
996162383 5:120181515-120181537 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
996751693 5:126895679-126895701 TGGTTCTCCCAGCATGCAGCTGG - Intronic
996753094 5:126909187-126909209 TGGTTCTCCCAGCATGCAGCTGG - Intronic
997107207 5:131034202-131034224 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
997112230 5:131087793-131087815 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
997591126 5:135072938-135072960 AGGAGCTCACTCCAGGCTGCAGG - Intronic
997815927 5:137017020-137017042 TGGGGGCCACAGCATGCTGCAGG - Intronic
998182581 5:139955826-139955848 TGGAGTGCAGAGCATGCTCCAGG - Intronic
998252434 5:140562034-140562056 TGGGGATCACAGCCTGCAGCCGG + Intronic
998455577 5:142270067-142270089 TGGAGCTAAAAGCAGGGTGCTGG - Intergenic
998460646 5:142307635-142307657 TGGAGCTCACTTCAAGTTGCAGG + Intergenic
998803214 5:145891786-145891808 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
999025869 5:148231239-148231261 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
999286104 5:150395178-150395200 CCAAGCTCACTGCATGCTGCAGG + Intronic
999605110 5:153305927-153305949 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
999815224 5:155168976-155168998 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1000424211 5:161071986-161072008 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1000540282 5:162531021-162531043 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1000587859 5:163122318-163122340 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1001280249 5:170381598-170381620 TGGTGCTGATAGCAGGCTGCAGG - Intronic
1002307534 5:178292619-178292641 TGGAGGCTACTGCATGCTGCAGG + Intronic
1002335681 5:178476655-178476677 TGGAGTTCACAGAATGCTGCTGG - Intronic
1002450652 5:179316551-179316573 TGGAGCTCACAGGTTCCTGGAGG - Intronic
1002974909 6:2065047-2065069 TGGTTCTCCCAGCATGCAGCTGG + Intronic
1003367465 6:5489000-5489022 TGGAGCTTACAGTATGGTGGGGG + Intronic
1003446560 6:6190591-6190613 TGGTTCTCCCAGCATGCAGCTGG - Intronic
1004205357 6:13587189-13587211 TGTACCTCACTGCCTGCTGCAGG - Intronic
1004303688 6:14480607-14480629 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1006672856 6:35740409-35740431 TGGAGCCTACTGCATGCTGATGG - Intronic
1006854450 6:37123463-37123485 TGGAGCACCCAGCAGGGTGCAGG + Intergenic
1007858762 6:44885264-44885286 TGGTTCTCCCAGCATGCAGCTGG + Intronic
1008329564 6:50228811-50228833 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1008452761 6:51671915-51671937 TGGTTCTCCCAGCATGCAGCTGG - Intronic
1008961799 6:57274115-57274137 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1009060679 6:58394428-58394450 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1009190293 6:60621858-60621880 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1009221236 6:60986418-60986440 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1009662422 6:66631466-66631488 TGGATCTCCCAGCACGCAGCTGG + Intergenic
1010129083 6:72470070-72470092 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1010263287 6:73840777-73840799 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1010361851 6:75004339-75004361 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1010460680 6:76110983-76111005 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1010513945 6:76751007-76751029 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1010679645 6:78783767-78783789 TGGTCCTCCCAGCATGCAGCTGG + Intergenic
1010856622 6:80848378-80848400 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1010901580 6:81433988-81434010 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1011107884 6:83803110-83803132 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1011200600 6:84831915-84831937 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1011244480 6:85307676-85307698 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1011358488 6:86497596-86497618 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1011364836 6:86570212-86570234 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1011373949 6:86670579-86670601 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1011538722 6:88407135-88407157 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1011550371 6:88526690-88526712 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1011949909 6:92952510-92952532 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1011956713 6:93032657-93032679 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1012089507 6:94873787-94873809 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1012508370 6:99975061-99975083 TGGTTCTCCCAGCATGCAGCTGG - Intronic
1013690182 6:112632676-112632698 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1013762227 6:113531755-113531777 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1013886639 6:114975744-114975766 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1014381558 6:120748991-120749013 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1014465849 6:121755866-121755888 TGAAGTTCTCAGCATGGTGCTGG + Intergenic
1015617065 6:135088500-135088522 TGGTGCTTACAGCTTGCTGGAGG - Intronic
1016901696 6:149109024-149109046 TGGAGCTCACAGCCTGGTGAAGG - Intergenic
1017282516 6:152639281-152639303 TGGAGCTTACAGTATGATGGGGG + Intergenic
1017596548 6:156034772-156034794 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1018749356 6:166789516-166789538 TGGTTCTCCCAGCATGCAGCTGG + Intronic
1018783044 6:167086424-167086446 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1020330321 7:7011292-7011314 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1020449259 7:8303482-8303504 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1020454151 7:8352370-8352392 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1020486936 7:8731708-8731730 TGGTTCTCCCAGCATGCAGCTGG - Intronic
1021143259 7:17053581-17053603 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1021520679 7:21536670-21536692 AGGAGCCCACAGCATGGTGGGGG + Intergenic
1022576900 7:31506568-31506590 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1022586735 7:31620256-31620278 TGGTTCTCCCAGCATGCAGCTGG + Intronic
1022765576 7:33407929-33407951 TGGTTCTCCCAGCATGCAGCTGG - Intronic
1022842130 7:34174932-34174954 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1023717632 7:43059732-43059754 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1024007929 7:45241227-45241249 TGGAGATCAGACCATGCTGATGG + Intergenic
1024022236 7:45382868-45382890 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1024030470 7:45456020-45456042 TGGAGCCCACAGCAGGCACCAGG + Intergenic
1024892390 7:54218764-54218786 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1024916341 7:54504226-54504248 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1025184108 7:56843872-56843894 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1025590946 7:62859546-62859568 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1025687820 7:63733096-63733118 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1026811036 7:73465181-73465203 TGAGGCTCACAGCTTGGTGCTGG + Intronic
1027989179 7:85335089-85335111 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1028446401 7:90928711-90928733 TGGTTCTCCCAGCATGCAGCTGG - Intronic
1028468029 7:91174081-91174103 TGGTTCTCCCAGCATGCAGCTGG + Intronic
1028489434 7:91394848-91394870 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1028507935 7:91590288-91590310 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1029922194 7:104277170-104277192 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1031029937 7:116723850-116723872 TGGTTCTCCCAGCATGCAGCTGG - Intronic
1031231914 7:119118189-119118211 AGGAGCTCACAGCCTGATGCAGG - Intergenic
1031706322 7:124984830-124984852 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1032238265 7:130142252-130142274 TGGTCCTCCCAGCATACTGCAGG - Intergenic
1032456929 7:132080225-132080247 AGGAGCTCACAGAAAGCTGGAGG - Intergenic
1032910133 7:136419554-136419576 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1033484502 7:141775429-141775451 TGGTTCTCCCAGCATGCAGCTGG - Intronic
1033962252 7:146929085-146929107 TGGCTCTCCCAGCATGCAGCTGG + Intronic
1034382171 7:150706876-150706898 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1035464644 7:159066499-159066521 TGAATCCCACAGAATGCTGCAGG - Intronic
1035533239 8:372060-372082 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1035884367 8:3276289-3276311 TGGTTCTCCCAGCATGCAGCTGG - Intronic
1035917561 8:3641692-3641714 AGGAGCTCAGAACAGGCTGCAGG + Intronic
1036968501 8:13327767-13327789 TGAAGCTCACAGCATAGTGGGGG + Intronic
1037703573 8:21296694-21296716 TGGAGCTCAGAGCTTGCAGGTGG + Intergenic
1038107636 8:24454145-24454167 TGGTTCTCCCAGCATGCAGCTGG - Intronic
1038116274 8:24559334-24559356 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1038226180 8:25660291-25660313 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1038929004 8:32171999-32172021 TGGTTCTCCCAGCATGCAGCTGG + Intronic
1039423068 8:37460919-37460941 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1040078629 8:43265940-43265962 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1040084516 8:43325926-43325948 TGGTCCTCCCAGCATGCAGCTGG - Intergenic
1040090743 8:43396425-43396447 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1040092990 8:43417710-43417732 TGGTCCTCGCAGCATGCAGCTGG - Intergenic
1040099041 8:43480698-43480720 TGGTTCTCTCAGCATGCAGCTGG + Intergenic
1040363730 8:46692435-46692457 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1040368527 8:46745369-46745391 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1040369716 8:46757593-46757615 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1040427406 8:47302934-47302956 TGGTTCTCCCAGCATGCAGCTGG - Intronic
1040591715 8:48799273-48799295 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1040992742 8:53369644-53369666 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1041200897 8:55451427-55451449 TGGAGCTGACAACAGCCTGCAGG + Intronic
1041485431 8:58370796-58370818 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1041613149 8:59875168-59875190 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1041613819 8:59882489-59882511 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1041817837 8:61994940-61994962 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1042434160 8:68744008-68744030 TGGTTCTCCCAGCATGCAGCTGG + Intronic
1042750449 8:72152811-72152833 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1042861497 8:73318594-73318616 GGGATCCCAGAGCATGCTGCTGG + Intronic
1042987352 8:74599593-74599615 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1043181290 8:77089049-77089071 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1043547441 8:81331221-81331243 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1043757379 8:84020205-84020227 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1044042337 8:87385770-87385792 TGGTTCTCCCAGCATGCAGCTGG + Intronic
1044211626 8:89557706-89557728 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1044225031 8:89708822-89708844 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1044284801 8:90398875-90398897 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1044746342 8:95375075-95375097 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1044968291 8:97595069-97595091 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1045775207 8:105794573-105794595 TGGTTCTCCCAGCATGCAGCTGG - Intronic
1046422652 8:114005659-114005681 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1046704475 8:117434955-117434977 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1046879529 8:119292673-119292695 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1046896501 8:119479236-119479258 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1046968424 8:120193541-120193563 TGGTTCTCCCAGCATGCAGCTGG - Intronic
1047127458 8:121977912-121977934 TGGAGCTCAGAGCAGGTTGGGGG - Intergenic
1047238800 8:123066304-123066326 AGGAGCACACAACATGGTGCTGG - Intronic
1047579674 8:126200042-126200064 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1047804440 8:128344280-128344302 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1047877739 8:129157493-129157515 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1048138709 8:131771539-131771561 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1048540343 8:135336029-135336051 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1048594549 8:135852886-135852908 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1048603352 8:135942607-135942629 GAGAGCTCACAGCAGGCTGCTGG - Intergenic
1048626903 8:136195562-136195584 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1048952468 8:139507806-139507828 TAGAGCTAACAGCATGGTGGAGG + Intergenic
1049535964 8:143182274-143182296 TGCAGGGCACAGCTTGCTGCAGG + Intergenic
1049586115 8:143433091-143433113 TGGTCCTCACAGAATTCTGCAGG + Intergenic
1050178955 9:2899570-2899592 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1051584432 9:18711871-18711893 TGGTTCTCCCAGCATGCAGCTGG + Intronic
1051597951 9:18844530-18844552 TGGTTCTCCCAGCATGCAGCTGG - Intronic
1051727539 9:20103345-20103367 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1051913148 9:22177664-22177686 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1052013651 9:23440763-23440785 TGGAGCTTACAGTATGATGCTGG - Intergenic
1052478343 9:28990503-28990525 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1052724867 9:32217319-32217341 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1052726149 9:32230399-32230421 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1054425467 9:65062630-65062652 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1055556927 9:77483559-77483581 TGGTTCTCCCAGCATGCAGCTGG - Intronic
1055918531 9:81432930-81432952 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1057086476 9:92215046-92215068 TGGTTCTCCCAGCATGCAGCTGG + Intronic
1057163112 9:92905412-92905434 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1057322313 9:94025835-94025857 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1057385776 9:94604904-94604926 TGGTGTTCCCAGCAGGCTGCAGG - Intronic
1057844159 9:98508922-98508944 TGGTTCTCCCAGCATGCAGCTGG + Intronic
1058080026 9:100691351-100691373 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1058490601 9:105494996-105495018 TGGCTCTCCCAGCATGCAGCTGG - Intronic
1059422746 9:114202597-114202619 AGGAGGTCAGAGCATGCTGGCGG - Intronic
1059922017 9:119169755-119169777 TGGTTCTCCCAGCATGCAGCTGG + Intronic
1059967150 9:119626696-119626718 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1060833920 9:126740556-126740578 TGGAGATCACTGCATGCTTGGGG - Intergenic
1061340089 9:129973205-129973227 AGGGGCTGACAGCATGCTTCAGG - Intronic
1062031138 9:134362524-134362546 TCGTGGTCACAGCATGGTGCTGG + Intronic
1062342950 9:136101887-136101909 TGGAGCTCACCTGCTGCTGCAGG - Intergenic
1062636457 9:137494081-137494103 TGTGGCCCACAGCATGTTGCAGG - Intronic
1203374160 Un_KI270442v1:349194-349216 TGGTCCTCCCAGCATGCAGCTGG - Intergenic
1203540185 Un_KI270743v1:81662-81684 TGGATCTCTCAGCACGCAGCTGG - Intergenic
1186480813 X:9895114-9895136 TGGAGCTTCCAGTAGGCTGCAGG + Exonic
1187116839 X:16360714-16360736 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1189996915 X:46647611-46647633 TGGAGCTCACAGTCCGCTGCGGG - Intronic
1190135102 X:47789040-47789062 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1190545098 X:51517689-51517711 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1190615174 X:52222731-52222753 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1190800518 X:53783990-53784012 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1190807622 X:53853936-53853958 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1190962912 X:55269733-55269755 TGGTTCTCCCAGCATGCAGCTGG + Intronic
1191020198 X:55851257-55851279 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1191032620 X:55990988-55991010 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1191064197 X:56330487-56330509 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1191076635 X:56460688-56460710 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1191134545 X:57049555-57049577 TGGCTCTCCCAGCATGCAGCTGG + Intergenic
1191180616 X:57559240-57559262 TGGCTCTCCCAGCATGCAGCTGG - Intergenic
1191194807 X:57709163-57709185 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1191232743 X:58108724-58108746 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1191273498 X:58511001-58511023 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1191567281 X:62556076-62556098 TGGATCTCCCAGCGTGCAGCTGG + Intergenic
1191588868 X:62858723-62858745 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1191751638 X:64549281-64549303 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1191935909 X:66426891-66426913 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1191990203 X:67026820-67026842 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1192096513 X:68217553-68217575 TGGTTCTCCCAGCATGCAGCTGG + Intronic
1192525844 X:71843410-71843432 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1192528545 X:71868007-71868029 TGGGGCTCTCAGAATGCTGGAGG - Intergenic
1192598959 X:72441183-72441205 TGGTTCTCCCAGCATGCAGCTGG + Intronic
1192662856 X:73060302-73060324 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1192716117 X:73644372-73644394 TGGTTCTCCCAGCATGCAGCTGG - Intronic
1192854959 X:74999511-74999533 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1192884061 X:75319004-75319026 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1192931393 X:75810287-75810309 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1193011026 X:76675039-76675061 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1193015245 X:76725398-76725420 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1193033550 X:76925002-76925024 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1193038496 X:76979244-76979266 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1193050061 X:77089913-77089935 TGGCTCTCCCAGCATGCAGCTGG + Intergenic
1193054646 X:77137474-77137496 TGGCTCTCCCAGCATGCAGCTGG - Intergenic
1193154331 X:78157372-78157394 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1193157486 X:78189489-78189511 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1193249577 X:79273315-79273337 TGGAGCTTACAGTATACTGTGGG + Intergenic
1193627557 X:83839202-83839224 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1193735109 X:85147469-85147491 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1193766034 X:85529845-85529867 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1193785655 X:85757207-85757229 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1193817205 X:86118688-86118710 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1194303589 X:92215701-92215723 TGGTTCTCCCAGCATGCAGCTGG + Intronic
1194951797 X:100135576-100135598 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1195117687 X:101716446-101716468 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1195126051 X:101811178-101811200 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1195233662 X:102876663-102876685 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1195340543 X:103902603-103902625 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1195452806 X:105034729-105034751 TGGTTCTCCCAGCATGCAGCTGG - Intronic
1195456784 X:105078521-105078543 TGGTTCTCCCAGCATGCAGCTGG - Intronic
1195666310 X:107434200-107434222 GGCAGCACACAGCTTGCTGCCGG + Intergenic
1195832253 X:109072113-109072135 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1196146766 X:112326780-112326802 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1196172306 X:112602952-112602974 TGAAGCTCAAAGCATTTTGCAGG - Intergenic
1196350705 X:114725882-114725904 TGGTTCTCCCAGCATGCAGCTGG - Intronic
1196359517 X:114836073-114836095 TGGTTCTCACAGCACGCAGCTGG - Intronic
1196380660 X:115085951-115085973 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1196478832 X:116121841-116121863 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1196489902 X:116253345-116253367 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1196596952 X:117556317-117556339 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1196824680 X:119731815-119731837 GGGAGCTGTCAGCAGGCTGCTGG + Intergenic
1196972979 X:121129985-121130007 TGGAGCTCACAGTATAGTGGGGG - Intergenic
1197000925 X:121438282-121438304 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1197432509 X:126383786-126383808 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1197649048 X:129044856-129044878 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1197917645 X:131553325-131553347 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1198544108 X:137672740-137672762 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1198553483 X:137768803-137768825 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1200092230 X:153641419-153641441 TGATGCTCACAGCCTCCTGCCGG + Intergenic
1200179463 X:154141464-154141486 CGGGGCACACACCATGCTGCTGG + Intergenic
1200751945 Y:6954162-6954184 TGGTTCTCCCAGCATGCAGCTGG - Intronic
1200774623 Y:7159474-7159496 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1200820230 Y:7575413-7575435 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1201014838 Y:9590355-9590377 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1201051625 Y:9941766-9941788 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1201053697 Y:9967100-9967122 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1201080743 Y:10242464-10242486 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1201230567 Y:11860434-11860456 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1201249312 Y:12040019-12040041 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1201347893 Y:13004867-13004889 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1201419442 Y:13782312-13782334 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1201435341 Y:13952459-13952481 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1201450142 Y:14102774-14102796 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1201476816 Y:14391394-14391416 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1201588712 Y:15590332-15590354 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1201614878 Y:15886071-15886093 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1201626793 Y:16023921-16023943 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1201627128 Y:16026688-16026710 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1201663911 Y:16427649-16427671 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1201886860 Y:18894536-18894558 TGGCCCTCTCAGCATGCAGCTGG + Intergenic
1201936708 Y:19418364-19418386 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1201967416 Y:19753457-19753479 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1201988266 Y:19993356-19993378 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1201991457 Y:20031582-20031604 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1202064612 Y:20925347-20925369 TGGCTCTCCCAGCATGCAGCTGG - Intergenic
1202105057 Y:21355053-21355075 TGGTTCTCTCAGCATGCAGCTGG + Intergenic
1202166555 Y:21995616-21995638 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1202224803 Y:22590757-22590779 TGGTTCTCCCAGCATGCAGCTGG + Intergenic
1202318311 Y:23604903-23604925 TGGTTCTCCCAGCATGCAGCTGG - Intergenic
1202552456 Y:26065154-26065176 TGGTTCTCCCAGCATGCAGCTGG + Intergenic