ID: 1172702693

View in Genome Browser
Species Human (GRCh38)
Location 20:36862903-36862925
Sequence GAGCAGCGACGCCGAGTCCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 64}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172702693_1172702695 1 Left 1172702693 20:36862903-36862925 CCGCGGACTCGGCGTCGCTGCTC 0: 1
1: 0
2: 1
3: 4
4: 64
Right 1172702695 20:36862927-36862949 GCGCCAGCTCCAGGCCCAGCAGG 0: 1
1: 0
2: 8
3: 67
4: 445
1172702693_1172702694 -8 Left 1172702693 20:36862903-36862925 CCGCGGACTCGGCGTCGCTGCTC 0: 1
1: 0
2: 1
3: 4
4: 64
Right 1172702694 20:36862918-36862940 CGCTGCTCAGCGCCAGCTCCAGG 0: 1
1: 0
2: 1
3: 18
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172702693 Original CRISPR GAGCAGCGACGCCGAGTCCG CGG (reversed) Exonic
901426019 1:9182750-9182772 TCGCCGCGACGCCCAGTCCGAGG + Intergenic
902334402 1:15746806-15746828 GAGCAGGGAGGTCCAGTCCGGGG + Intronic
921945659 1:220884368-220884390 GAGCAGCGACTCCGAGTCCCTGG + Exonic
1066746094 10:38604908-38604930 CAGCAGCGCAGCCGAGTCCCAGG + Intergenic
1070151986 10:73811079-73811101 GAGCAGCGGCGCGGAGGCTGCGG + Intronic
1071598111 10:86942623-86942645 GTGCTGCGAGGCCGAGGCCGGGG - Exonic
1073288798 10:102403243-102403265 GAGCTGTGACGCTGAGCCCGGGG + Exonic
1074564397 10:114564170-114564192 GAGCAACGAGGCCGGGTCCAGGG - Intronic
1075519872 10:123136876-123136898 GAGAAGGGACGCCGAGTCCTGGG - Intronic
1083856794 11:65396937-65396959 CAGCAGCGACGGCGGGTGCGAGG + Exonic
1084225326 11:67711663-67711685 GAGGAGGGAGGCTGAGTCCGGGG + Intergenic
1084263140 11:67991510-67991532 GAGGAGGGAGGCTGAGTCCGGGG + Exonic
1084810254 11:71607611-71607633 GAGGAGGGAGGCTGAGTCCGTGG - Intergenic
1089499913 11:118925799-118925821 GTGCAGCGGCCCCGGGTCCGGGG + Intronic
1096599222 12:52717684-52717706 GAGGAGCTAGGCCGAGGCCGAGG - Intergenic
1105919659 13:24950170-24950192 GAGCCACCACGCCCAGTCCGTGG - Intergenic
1124966672 15:34437246-34437268 CCGCAGCCCCGCCGAGTCCGGGG + Intronic
1124983291 15:34583364-34583386 CCGCAGCCCCGCCGAGTCCGGGG + Intronic
1125594270 15:40874170-40874192 GCGCAGCGAAGCCGAGACCCGGG - Exonic
1125674325 15:41494307-41494329 GAGCAGCGACGAGGAGCCAGTGG - Exonic
1128482767 15:68054386-68054408 CAGCAGCGGCGCCGTCTCCGCGG - Intronic
1128944017 15:71809539-71809561 GAGCTGTGAGGCCGAGTTCGGGG + Intronic
1131252334 15:90838758-90838780 AAGCAGGGACGCTGAGTCCCTGG + Intergenic
1137247136 16:46714856-46714878 GATCAGCGACTCCCAGTCAGGGG + Intronic
1138527277 16:57616381-57616403 GAGCAGAGAGGCTGAGCCCGCGG + Intronic
1139590365 16:67929732-67929754 GAGTAGCCATGCCGAGGCCGGGG - Exonic
1143053076 17:4142772-4142794 GAGCCGCGACGCCCGGGCCGGGG + Exonic
1144961532 17:19046914-19046936 GAGCAGCGGCATGGAGTCCGTGG - Exonic
1144973628 17:19127610-19127632 GAGCAGCGGCATGGAGTCCGTGG + Exonic
1155030411 18:21979022-21979044 GAGCAGGGCCGCTGTGTCCGTGG + Intergenic
1161684064 19:5694501-5694523 CAGCGGCGAGGCCGAGTCCGTGG - Exonic
1163828855 19:19538342-19538364 CAGCAGCGACGCCATGGCCGGGG - Exonic
1166983913 19:46648796-46648818 GGGCAGCGACTCCGAGTGCTCGG - Exonic
1167105954 19:47429961-47429983 GAGAAGGGAGGCCGAGTCCCAGG + Exonic
1167426567 19:49432690-49432712 GGGCAGAGACGCCGAGCCGGCGG - Intronic
927606563 2:24491495-24491517 GAGCCGCGGCGCCGGGCCCGAGG + Intergenic
934655141 2:96113392-96113414 GAGCAGCGTGGCTGGGTCCGAGG + Exonic
937993108 2:127675027-127675049 TGGCAGCGACGCCGAGCCCTGGG + Intronic
947718185 2:232352193-232352215 GAGCCGCGCCGCTCAGTCCGTGG + Intergenic
1169486833 20:6041451-6041473 GACCAGCGCCGACGTGTCCGTGG + Exonic
1172702693 20:36862903-36862925 GAGCAGCGACGCCGAGTCCGCGG - Exonic
1176235108 20:64050302-64050324 GAGCAGGGACGCAGAGGCTGTGG + Intronic
1183661180 22:39222366-39222388 CAGCAGCGCAGCAGAGTCCGTGG - Intergenic
1183987933 22:41579512-41579534 GAGCAGCTATGCCCAGTCTGAGG + Intronic
1184759862 22:46537904-46537926 GAGCCGCGGCCCCGAGCCCGAGG - Intergenic
1185206287 22:49541091-49541113 GAGGAGCGAGGCCGGGTTCGGGG - Intronic
953055336 3:39383460-39383482 GAGCAGAGCCGCGGAGTCTGCGG + Exonic
954028664 3:47802974-47802996 GAGCGGCTACGACGAGTCCCAGG + Exonic
955818776 3:62874801-62874823 GAGCAGCGGCGGCGGGGCCGGGG - Exonic
957078579 3:75619447-75619469 GAGGAGGGAGGCTGAGTCCGGGG + Intergenic
957270938 3:78029813-78029835 GACCCGAGACGCCGAGGCCGAGG - Intergenic
960454579 3:117854820-117854842 GAGCAGCACCGCAGAGTCCCTGG + Intergenic
966592272 3:181696064-181696086 GCGCAGCGGCGCCAGGTCCGAGG - Intergenic
969021662 4:4143420-4143442 GAGGAGGGAGGCTGAGTCCGGGG + Intergenic
969732206 4:8963995-8964017 GAGGAGGGAGGCTGAGTCCGGGG - Intergenic
978529946 4:109703094-109703116 GAGTAGCGACGCCGGCGCCGGGG - Intronic
978885371 4:113761516-113761538 GTGCAGCGGGGCCGAGGCCGCGG + Intronic
992321980 5:75622487-75622509 GAGCAGCAACCCCGAGTCCTGGG + Intronic
996900459 5:128537722-128537744 GAGCAGGGAGCCCGAGCCCGAGG - Exonic
1003198809 6:3939828-3939850 GAGCAGGGACGCTGAGCCCAGGG + Intergenic
1007115768 6:39342178-39342200 GAGCAGCTACGCCGCGTTCTGGG - Intronic
1012996541 6:105981255-105981277 GGGCAGGGACCCCGAATCCGGGG + Intergenic
1017073734 6:150599844-150599866 GAGCAGTGGGGCCGAGCCCGAGG + Exonic
1020309075 7:6855450-6855472 GAGGAGCGAGGCTGAGTCCGGGG + Intergenic
1056902558 9:90613410-90613432 GAGCAGCGAGGCGGAGGCCTTGG - Exonic
1060484985 9:124041103-124041125 GAGCTGGGACGCCGGGTCTGGGG + Intergenic
1062080006 9:134618821-134618843 GGGCAGCGAGGCCGAGTGAGAGG + Intergenic
1062569239 9:137177212-137177234 GAGCAGAGCCGCCGAGGCCAAGG + Intronic
1191251906 X:58263838-58263860 CAGCAGCGAGGCCGAGTGCTAGG + Intergenic
1200238080 X:154478759-154478781 GGGCAGAGACGCCGCGTCTGCGG - Exonic