ID: 1172702694

View in Genome Browser
Species Human (GRCh38)
Location 20:36862918-36862940
Sequence CGCTGCTCAGCGCCAGCTCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 292}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172702686_1172702694 7 Left 1172702686 20:36862888-36862910 CCGCCGGGCCCCCGGCCGCGGAC 0: 1
1: 0
2: 2
3: 33
4: 344
Right 1172702694 20:36862918-36862940 CGCTGCTCAGCGCCAGCTCCAGG 0: 1
1: 0
2: 1
3: 18
4: 292
1172702689_1172702694 -1 Left 1172702689 20:36862896-36862918 CCCCCGGCCGCGGACTCGGCGTC 0: 1
1: 0
2: 0
3: 19
4: 87
Right 1172702694 20:36862918-36862940 CGCTGCTCAGCGCCAGCTCCAGG 0: 1
1: 0
2: 1
3: 18
4: 292
1172702692_1172702694 -4 Left 1172702692 20:36862899-36862921 CCGGCCGCGGACTCGGCGTCGCT 0: 1
1: 0
2: 0
3: 5
4: 42
Right 1172702694 20:36862918-36862940 CGCTGCTCAGCGCCAGCTCCAGG 0: 1
1: 0
2: 1
3: 18
4: 292
1172702685_1172702694 8 Left 1172702685 20:36862887-36862909 CCCGCCGGGCCCCCGGCCGCGGA 0: 1
1: 0
2: 4
3: 35
4: 331
Right 1172702694 20:36862918-36862940 CGCTGCTCAGCGCCAGCTCCAGG 0: 1
1: 0
2: 1
3: 18
4: 292
1172702679_1172702694 20 Left 1172702679 20:36862875-36862897 CCCGTACGGACCCCCGCCGGGCC 0: 1
1: 0
2: 0
3: 6
4: 63
Right 1172702694 20:36862918-36862940 CGCTGCTCAGCGCCAGCTCCAGG 0: 1
1: 0
2: 1
3: 18
4: 292
1172702675_1172702694 28 Left 1172702675 20:36862867-36862889 CCGGCTGCCCCGTACGGACCCCC 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1172702694 20:36862918-36862940 CGCTGCTCAGCGCCAGCTCCAGG 0: 1
1: 0
2: 1
3: 18
4: 292
1172702683_1172702694 9 Left 1172702683 20:36862886-36862908 CCCCGCCGGGCCCCCGGCCGCGG 0: 1
1: 0
2: 9
3: 90
4: 641
Right 1172702694 20:36862918-36862940 CGCTGCTCAGCGCCAGCTCCAGG 0: 1
1: 0
2: 1
3: 18
4: 292
1172702691_1172702694 -3 Left 1172702691 20:36862898-36862920 CCCGGCCGCGGACTCGGCGTCGC 0: 1
1: 0
2: 1
3: 8
4: 99
Right 1172702694 20:36862918-36862940 CGCTGCTCAGCGCCAGCTCCAGG 0: 1
1: 0
2: 1
3: 18
4: 292
1172702680_1172702694 19 Left 1172702680 20:36862876-36862898 CCGTACGGACCCCCGCCGGGCCC 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1172702694 20:36862918-36862940 CGCTGCTCAGCGCCAGCTCCAGG 0: 1
1: 0
2: 1
3: 18
4: 292
1172702687_1172702694 4 Left 1172702687 20:36862891-36862913 CCGGGCCCCCGGCCGCGGACTCG 0: 1
1: 0
2: 2
3: 34
4: 238
Right 1172702694 20:36862918-36862940 CGCTGCTCAGCGCCAGCTCCAGG 0: 1
1: 0
2: 1
3: 18
4: 292
1172702690_1172702694 -2 Left 1172702690 20:36862897-36862919 CCCCGGCCGCGGACTCGGCGTCG 0: 1
1: 0
2: 0
3: 15
4: 121
Right 1172702694 20:36862918-36862940 CGCTGCTCAGCGCCAGCTCCAGG 0: 1
1: 0
2: 1
3: 18
4: 292
1172702693_1172702694 -8 Left 1172702693 20:36862903-36862925 CCGCGGACTCGGCGTCGCTGCTC 0: 1
1: 0
2: 1
3: 4
4: 64
Right 1172702694 20:36862918-36862940 CGCTGCTCAGCGCCAGCTCCAGG 0: 1
1: 0
2: 1
3: 18
4: 292
1172702682_1172702694 10 Left 1172702682 20:36862885-36862907 CCCCCGCCGGGCCCCCGGCCGCG 0: 1
1: 0
2: 8
3: 73
4: 823
Right 1172702694 20:36862918-36862940 CGCTGCTCAGCGCCAGCTCCAGG 0: 1
1: 0
2: 1
3: 18
4: 292
1172702678_1172702694 21 Left 1172702678 20:36862874-36862896 CCCCGTACGGACCCCCGCCGGGC 0: 1
1: 0
2: 0
3: 0
4: 62
Right 1172702694 20:36862918-36862940 CGCTGCTCAGCGCCAGCTCCAGG 0: 1
1: 0
2: 1
3: 18
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172702694 Original CRISPR CGCTGCTCAGCGCCAGCTCC AGG Exonic
900091048 1:920881-920903 CGCTGCTCACCTGCACCTCCTGG + Intergenic
900158870 1:1214052-1214074 CGGTGCTCAGCCCCAGGCCCAGG + Exonic
900460526 1:2800398-2800420 CGCGGGTCAGCCGCAGCTCCAGG + Intronic
900680270 1:3912594-3912616 CTCTCCCCAGGGCCAGCTCCTGG + Intergenic
901064573 1:6488785-6488807 CCCAGCCCAGCCCCAGCTCCAGG + Intronic
901257635 1:7844759-7844781 CCCTGCTCACCGCCAGCAGCAGG - Exonic
901473102 1:9471232-9471254 CCCTCCTCACCTCCAGCTCCGGG - Intergenic
901756761 1:11446120-11446142 CGCAGCACAGCCCCTGCTCCTGG + Intergenic
901985671 1:13073726-13073748 CGCTCCGCCCCGCCAGCTCCAGG - Exonic
901996138 1:13153041-13153063 CGCTCCGCCCCGCCAGCTCCAGG + Intergenic
902433548 1:16382152-16382174 CCCTGCTCAGCACCCTCTCCTGG - Intronic
902625219 1:17672461-17672483 CGCTCCTCCTCGGCAGCTCCTGG - Intronic
903222950 1:21878976-21878998 CGCAGGTCAGCCCCAGCTCCGGG - Exonic
903295676 1:22341908-22341930 CTGGGCTCAGAGCCAGCTCCGGG + Intergenic
903760435 1:25694329-25694351 CCCTGCTCTGAGCCAGCCCCAGG + Intronic
904681158 1:32230307-32230329 CTCTGCTCACCGCAACCTCCTGG + Intronic
904751249 1:32742293-32742315 CGCTTTCCAGCACCAGCTCCTGG - Intronic
904771718 1:32884732-32884754 CGCTGCTCAGCCCCCACCCCAGG - Intergenic
906319066 1:44805639-44805661 CTATGCTCTGCGCCTGCTCCGGG + Exonic
906344111 1:45004540-45004562 CCCTCCTGAGCCCCAGCTCCTGG - Intronic
906636336 1:47412835-47412857 GCCTGCTCGGCTCCAGCTCCGGG + Intergenic
907258329 1:53197011-53197033 GGCCCCTCAGCGCCGGCTCCGGG + Exonic
907368203 1:53979930-53979952 GACTGCTCAGCGCCGCCTCCTGG + Intergenic
909034780 1:70584491-70584513 CTCGGCTCACCGCAAGCTCCCGG + Intergenic
911101831 1:94101543-94101565 ACCTGGTCAGCACCAGCTCCTGG - Intronic
912517087 1:110223263-110223285 GGCCGCTCAGCCCCACCTCCAGG - Exonic
915469123 1:156115221-156115243 CTTTGCTCAGCTCCAGCTGCAGG - Exonic
915640783 1:157224340-157224362 CTCTACTCAGCACCAGGTCCTGG + Intergenic
920347092 1:205313524-205313546 CCCTCCTCAGCAGCAGCTCCTGG + Intronic
921709979 1:218364287-218364309 AGCTCCTCAGAGCCAGCACCAGG + Intronic
922167672 1:223129390-223129412 CGCTGCTGAGGGCCAGGGCCTGG - Intronic
922581828 1:226703774-226703796 CGCTGCTGGCCGCCAGCTTCCGG + Intronic
922804252 1:228377454-228377476 AGCTGCTCAGCCCAGGCTCCGGG - Intronic
1064199785 10:13274587-13274609 CCAAGCTCAGCGCCAGCTCTGGG + Intergenic
1064286474 10:13995876-13995898 CCCTGCTGAGCCCCAGCTCTGGG - Intronic
1067078393 10:43200807-43200829 GGCTGCCCGGAGCCAGCTCCAGG - Exonic
1067407581 10:46037008-46037030 GGCTGCTCAGAGCAGGCTCCTGG - Intronic
1068665873 10:59675548-59675570 AGCTGCTGATCACCAGCTCCAGG - Intronic
1071430420 10:85602431-85602453 AGCTGCTCAGCGGCAGCGGCAGG + Exonic
1071464305 10:85925537-85925559 TGCTGTTCAGCTCCAGCTTCAGG + Intronic
1072190809 10:93074853-93074875 CGCAGCTCAGCCACTGCTCCAGG - Exonic
1074688128 10:115978394-115978416 CACTGCTCAGCGCCAGAGCTGGG + Intergenic
1074867732 10:117554523-117554545 CCCTGCTCCCAGCCAGCTCCAGG + Intergenic
1076891757 10:133288167-133288189 TCATGCGCAGCGCCAGCTCCAGG + Exonic
1077036679 11:498777-498799 GGCTGCTCCACCCCAGCTCCAGG - Exonic
1077094267 11:792686-792708 GGCTGCCCAGGGCCAGCTCTCGG - Exonic
1077124084 11:924904-924926 GGCTGCACAGCTCCAGGTCCCGG - Intronic
1077533440 11:3107904-3107926 AGCAGCGCAGGGCCAGCTCCAGG + Exonic
1078341615 11:10501381-10501403 CACAGCTCAGGGCCAGCTCCGGG - Intronic
1079135099 11:17771964-17771986 GGCCGCTCAGCCCCACCTCCAGG - Exonic
1079787303 11:24689471-24689493 AGCGGCTGATCGCCAGCTCCAGG + Intronic
1081691268 11:45080232-45080254 CCCACCCCAGCGCCAGCTCCAGG + Intergenic
1083160701 11:60852546-60852568 TGCTGCTCAGCGCCCGGTTCAGG + Exonic
1083674046 11:64315799-64315821 CGCCGCTCAGCACCCCCTCCGGG - Exonic
1083782690 11:64926243-64926265 CCCTGCCAAGCGCCTGCTCCAGG - Intronic
1083808207 11:65087550-65087572 CTCTGCACAGCCCCAGCACCAGG - Intronic
1083901934 11:65647407-65647429 CGCGGGGCAGCGCCAGCTCGCGG - Exonic
1085319284 11:75564234-75564256 AGCAGCTTAGCGCCTGCTCCTGG - Intronic
1087015065 11:93546620-93546642 TTCTGCTCTGAGCCAGCTCCAGG - Intergenic
1088057987 11:105609429-105609451 CTCTGCTCCACGCCACCTCCAGG - Intergenic
1088231580 11:107678513-107678535 CCCTGGTCAGCGCCAGCCCAGGG - Intergenic
1089440031 11:118507533-118507555 TGCTGCTCAGCCTCTGCTCCTGG - Exonic
1089922783 11:122226697-122226719 AGCTGCTGAGAGCCAGCTCCAGG + Intergenic
1091306825 11:134541642-134541664 CCCTGCTCAGGGACAGCCCCAGG - Intergenic
1092545515 12:9448335-9448357 CGCTGCTTTCCGCCAGCTGCGGG + Intergenic
1094507438 12:31073716-31073738 CGCTGCTTTCCGCCAGCTGCGGG - Intergenic
1095349125 12:41188650-41188672 GGCTGCGCAGCGGCAGCACCCGG - Exonic
1096080221 12:48828015-48828037 CCCTGCCCAGCCCCAGCTTCAGG + Exonic
1100758356 12:97777226-97777248 AGCTGCTCATCGCCAGCTTCAGG - Intergenic
1101998650 12:109543008-109543030 TGCTGCTCAGCCCCAGCAGCTGG + Intergenic
1104088871 12:125497835-125497857 GGCTGCTCAACCCCAACTCCTGG - Intronic
1104617290 12:130281372-130281394 CGCTGCGCACCGCCACCGCCAGG + Intergenic
1104914386 12:132257384-132257406 CTCTGCTCAGCCCCTGCACCAGG + Intronic
1105927914 13:25024268-25024290 TGTTGCTCACAGCCAGCTCCAGG - Intergenic
1108635958 13:52334303-52334325 CGCTGGGCAGCGCCTCCTCCCGG + Intergenic
1108651852 13:52488945-52488967 CGCTGGGCAGCGCCTCCTCCCGG - Intergenic
1113542810 13:111122169-111122191 CTCTGGTCAGCGCCAGATCTGGG + Intronic
1115701219 14:35955000-35955022 AGCTGCCCAGCACCAGCTGCTGG + Intergenic
1119474593 14:74919862-74919884 CACTGCTCAGCGGCCGCTGCAGG + Exonic
1119531162 14:75362327-75362349 AGCTGCTCACCCCTAGCTCCTGG + Intergenic
1119728849 14:76938488-76938510 CTCTCCCTAGCGCCAGCTCCAGG + Intergenic
1122630261 14:103104397-103104419 CCCTTCTCAGCCCCTGCTCCCGG - Intronic
1122666621 14:103334449-103334471 CGCTGCTCGGCGGCGGCACCTGG + Exonic
1122707324 14:103629419-103629441 CGCTGCTCCGCGCGCGCGCCCGG + Intronic
1123197055 14:106627154-106627176 TGCTGCTCAGCGCCAGCAGGGGG - Intergenic
1123699207 15:22902231-22902253 AGCTGCTCAGAGCCATCTGCTGG - Intronic
1124156136 15:27226531-27226553 CCCTGCACAGCTCCTGCTCCCGG + Intronic
1124688316 15:31800618-31800640 TGCTGCACAGAGCCAGGTCCGGG + Intronic
1127963685 15:63908426-63908448 CCCAGCTCAGCACCAGCACCCGG - Exonic
1129457244 15:75682552-75682574 CTCAGCTCCGCCCCAGCTCCTGG + Intronic
1129604443 15:77018012-77018034 CCCTGCTCAGGGCAAGCTCTTGG - Intronic
1129726540 15:77904393-77904415 CTCAGCTCCGCCCCAGCTCCCGG - Intergenic
1129871580 15:78944943-78944965 CGCTGCTCTGCGCCGGGGCCTGG - Exonic
1129894036 15:79090642-79090664 CGCGGCTCGGCGCCAGATCCTGG - Exonic
1130608318 15:85337598-85337620 CCCTTCTCAGCTCCTGCTCCGGG + Intergenic
1131179502 15:90230356-90230378 GGCTGCACAGCGCCAGCTCCAGG + Exonic
1132046857 15:98570769-98570791 CACCCCTCAGCCCCAGCTCCTGG - Intergenic
1132809720 16:1791736-1791758 TCCTGCTCAGGTCCAGCTCCCGG + Exonic
1132862726 16:2079547-2079569 CTCTTCTCAGCTCCAGCCCCGGG + Exonic
1133100415 16:3475964-3475986 CACTGCTCAGCCCCAGCTGAAGG - Intronic
1134106460 16:11488913-11488935 CTCTGGACAGCGCCAGCTCCTGG - Intronic
1134640102 16:15823218-15823240 GGCTGCACGGGGCCAGCTCCAGG - Intronic
1134761770 16:16720857-16720879 AGCTGCTGAGTGGCAGCTCCTGG - Intergenic
1134984288 16:18638313-18638335 AGCTGCTGAGTGGCAGCTCCTGG + Intergenic
1135118403 16:19743379-19743401 CCTTGCCCAGCTCCAGCTCCAGG - Intronic
1136776379 16:32873996-32874018 CTCTGCCCTGGGCCAGCTCCAGG - Intergenic
1136894236 16:33987516-33987538 CTCTGCCCTGGGCCAGCTCCAGG + Intergenic
1137564466 16:49524633-49524655 AGCTGCTCTGGGCCACCTCCTGG - Intronic
1138533198 16:57646198-57646220 CGCTGCCCAGGCCAAGCTCCTGG - Intronic
1141587111 16:85041705-85041727 CTCTGCTCAGTGCCAAGTCCGGG - Intronic
1141662283 16:85447902-85447924 AGCTTCTCACTGCCAGCTCCTGG + Intergenic
1141687650 16:85579468-85579490 GGCTGCCCAGCGCCAGGGCCAGG - Intergenic
1141987220 16:87587864-87587886 CTCAGCTCAGCCCCAGCCCCTGG + Intergenic
1142188013 16:88703659-88703681 AGCTGCTCAGCACCAGCCCCTGG - Intronic
1142193044 16:88726637-88726659 CCCTGCTCTCCCCCAGCTCCTGG - Exonic
1142247760 16:88977564-88977586 CTCTCCTCAGCCCCTGCTCCGGG + Intergenic
1203078794 16_KI270728v1_random:1136105-1136127 CTCTGCCCTGGGCCAGCTCCAGG - Intergenic
1142810294 17:2392913-2392935 CGCTGCTTCGCGACTGCTCCAGG - Intronic
1143023957 17:3930169-3930191 CACTCCTCGGCCCCAGCTCCAGG + Intronic
1143023988 17:3930261-3930283 CACTCCTCGGCCCCAGCTCCAGG + Intronic
1143937430 17:10501394-10501416 CGCTGATCTCCTCCAGCTCCCGG + Exonic
1143939841 17:10528974-10528996 CGCTGATCTCCTCCAGCTCCCGG + Exonic
1144408007 17:14971666-14971688 AGCTGCTGATCGCCAGCTTCAGG + Intergenic
1145019436 17:19417959-19417981 GGCTGATCAGGTCCAGCTCCAGG + Intergenic
1147313306 17:39607211-39607233 CGCCGCCCAGAGCCGGCTCCGGG - Intronic
1148339726 17:46866199-46866221 GGCTGCTCAACACCAACTCCAGG - Intronic
1148505447 17:48123470-48123492 AGCTGCTGAGCACCAACTCCAGG - Intergenic
1149772564 17:59332501-59332523 CGCCCCTAAGCGCCAGCTCCGGG - Intronic
1151591715 17:75048645-75048667 AGCTGCTCAGAGCCAAGTCCTGG + Intronic
1151680396 17:75619921-75619943 CGCTCTTCAGTGACAGCTCCAGG - Intergenic
1152758642 17:82097513-82097535 GGCTGCCCCGGGCCAGCTCCAGG + Intronic
1156896793 18:42255866-42255888 CAATGCTCAGTTCCAGCTCCTGG + Intergenic
1157618690 18:49002969-49002991 ATCTGCTGAGCACCAGCTCCGGG - Intergenic
1159892787 18:73968366-73968388 AGCTGCTCATCACCAGCTTCAGG + Intergenic
1160592780 18:79953048-79953070 CGCTGCGGAGCCCCAGCACCAGG + Intergenic
1160600625 18:80009995-80010017 AGCTGCTCATCACCAGCTTCAGG + Intronic
1160618912 18:80156101-80156123 AGCTGCTCAGCGTGAGCTCAAGG - Intronic
1160703646 19:519303-519325 CGCGGTCCAGCGCCAGCGCCAGG - Exonic
1160765417 19:805426-805448 CGCAGCACAGCGCCCGCTCGCGG + Intronic
1161006795 19:1941200-1941222 CGCTCCGCCGCGCCCGCTCCGGG - Exonic
1161730907 19:5959946-5959968 CCAAGCTCAGCCCCAGCTCCAGG + Intronic
1161736929 19:5997179-5997201 CGCTGCGCAGGGTCAGGTCCCGG + Exonic
1162101757 19:8343139-8343161 CGCAGCGCAGCGCCGGGTCCCGG + Intronic
1162754268 19:12847773-12847795 CGGTGCGCAGCGCAGGCTCCTGG + Intronic
1162932318 19:13963241-13963263 CGCTGCGCAGGGTCAGGTCCCGG + Exonic
1163598329 19:18233237-18233259 CGCTCCTCGGCGCCCGCTCACGG - Exonic
1165423478 19:35733326-35733348 CACTGCTCAGCACCAGCGTCAGG - Exonic
1167129293 19:47573544-47573566 CGCTGCTCAGAGGCCCCTCCGGG - Intergenic
1167291690 19:48628391-48628413 GGATGCTCACCCCCAGCTCCTGG + Intronic
1167905717 19:52658969-52658991 AGCTGCTCAGGGCCGGCTCTTGG + Intronic
1167934227 19:52893195-52893217 CCCTGCCCAGTGCCAGCCCCTGG - Intronic
925323720 2:2998755-2998777 CCCTGCTCATCACCATCTCCAGG - Intergenic
925532847 2:4883781-4883803 AGCTGCTCATCACCAGCTTCAGG - Intergenic
927150169 2:20191044-20191066 GACTGCTGAGCGCCAGCTCTGGG + Intergenic
927682200 2:25147014-25147036 CGCTGCGCTCCGCCATCTCCAGG + Intronic
927904885 2:26848878-26848900 CCCGGCTCGGCGCCCGCTCCGGG - Intronic
928196408 2:29219590-29219612 GCCTGCTCAGCTCCAGTTCCTGG + Intronic
929545084 2:42850522-42850544 CTCTGCCCAGCTCCAGCCCCTGG + Intergenic
929556962 2:42931639-42931661 AGCTGCTCAGCGCCCCCACCAGG - Intergenic
933139776 2:78779033-78779055 CGCAGGCCAGCGCGAGCTCCCGG + Intergenic
933895574 2:86807713-86807735 CCCTCCTCCGCGCCTGCTCCGGG - Exonic
935271221 2:101435975-101435997 CGCTGCTCAGCCACCTCTCCAGG + Intronic
935809423 2:106782605-106782627 CGCAGCCCAGCCCCATCTCCAGG - Intergenic
936103108 2:109600768-109600790 CTCTGCTCATCGCCAGCCCCAGG + Intronic
936401033 2:112164612-112164634 CCGGGCTCAGCCCCAGCTCCAGG - Intronic
936746472 2:115582408-115582430 AGCTGCTCATCACCAGCTTCAGG + Intronic
937989187 2:127653016-127653038 TGCTGGTCAGCACGAGCTCCTGG + Intronic
938060775 2:128252692-128252714 CCCTGCTCAGTGCCACCTCCTGG + Intronic
938265108 2:129922964-129922986 AGCTGCTGGGCTCCAGCTCCGGG + Intergenic
938795904 2:134718456-134718478 CCCTCCTCTCCGCCAGCTCCAGG - Intronic
940510709 2:154610841-154610863 CACTGCTCACCTCCACCTCCCGG + Intergenic
940883273 2:158968392-158968414 CGCCTCTCGGCGCCAGGTCCGGG - Intergenic
944058515 2:195547633-195547655 TGCAGGCCAGCGCCAGCTCCGGG - Intergenic
945907921 2:215615207-215615229 CGCTGGCCAGCGCAAGTTCCGGG - Intergenic
946160999 2:217836044-217836066 CGATGGTAAGAGCCAGCTCCGGG + Exonic
946165673 2:217862420-217862442 CCCTGCTCAGGGCCACCTCAGGG - Intronic
946225755 2:218263294-218263316 CACTGCCCACCGCCAGCTGCAGG + Exonic
947626532 2:231622663-231622685 CTCTGCCCAGCCCCAGCTCCAGG + Intergenic
948420801 2:237859193-237859215 CGCTCCCCAGCGCCTGCACCTGG + Intronic
948461162 2:238130631-238130653 CGAGGCCCAGCGCCAGATCCAGG + Exonic
948570794 2:238915904-238915926 CCCTGCTCAATGCCAGCTGCTGG + Intergenic
948620504 2:239231665-239231687 GGCTGCTGAGCACCTGCTCCCGG + Intronic
948620538 2:239231805-239231827 GGCTGCTGAGCACCTGCTCCCGG + Intronic
948620571 2:239231945-239231967 GGCTGCTGAGCACCTGCTCCCGG + Intronic
948620587 2:239232015-239232037 GGCTGCTGAGCACCTGCTCCCGG + Intronic
948808509 2:240463212-240463234 CTCTGCTCTGCCCCAGCTCGTGG - Intronic
949072718 2:242035654-242035676 CTCTGCTCAGGCCCAGATCCAGG - Intergenic
1170042453 20:12052843-12052865 TGCTGCTCAACTCCAGGTCCTGG - Intergenic
1170562784 20:17570634-17570656 AGCGCCTCAGCGCCAGCTCTGGG - Intronic
1170843862 20:19945955-19945977 CGCTGCTCAGCTCCAGCCTCAGG - Intronic
1170847587 20:19975180-19975202 CTGTGCCCAGCTCCAGCTCCGGG - Exonic
1172512549 20:35510441-35510463 CACAGCTCAGCACAAGCTCCAGG + Intronic
1172702694 20:36862918-36862940 CGCTGCTCAGCGCCAGCTCCAGG + Exonic
1174035281 20:47664941-47664963 GGCTGCGCAGAGCCGGCTCCAGG - Intronic
1174278958 20:49424638-49424660 GGCTGCTCAGCCCCAGCAGCCGG - Intronic
1175333375 20:58179579-58179601 TGCTGCTCAGGTCCGGCTCCTGG - Intergenic
1175997190 20:62817138-62817160 CGCAGGTGAGCGCGAGCTCCGGG + Exonic
1179138245 21:38699374-38699396 TGCTGCTCAGCTCCAGCCCATGG - Intergenic
1179612126 21:42559228-42559250 CGCTGCACAGTGCTAGCTTCAGG + Intronic
1179997570 21:44981075-44981097 TGGTGCTCAGCTCCAGCTGCAGG - Intergenic
1180096249 21:45556406-45556428 CGCTGCTCCCCACCAGCGCCCGG + Intergenic
1181038690 22:20181904-20181926 CCCTGCTCAGCAGCATCTCCTGG - Intergenic
1181782390 22:25202540-25202562 CCCACCTCAGTGCCAGCTCCAGG + Intronic
1183538720 22:38417581-38417603 CCCTGCCCAGCCCCTGCTCCAGG + Intergenic
1183697014 22:39429163-39429185 CGCTGCCCAGCACCAGCACAGGG - Intronic
1184067149 22:42127402-42127424 CCCAGCTCAGCACCAGCACCTGG - Intronic
1184069874 22:42141107-42141129 CCCAGCTCAGCACCAGCCCCTGG - Intergenic
1184071621 22:42150710-42150732 CCCAGCTCAGCACCAGCCCCTGG - Intergenic
1184101472 22:42343661-42343683 CGCTGCGCAGGGCCTGCCCCCGG - Intergenic
950100070 3:10351258-10351280 CTCTGCTCAGGGCCAGCTGCTGG - Intronic
950812138 3:15659051-15659073 CCTTGCTCAGCACCAGCCCCAGG - Intergenic
952706232 3:36380541-36380563 GGCTGCTCAGCTCCGGGTCCTGG - Exonic
954443850 3:50536124-50536146 AGCTGCTGAGCACCAGCTCAGGG - Intergenic
956428060 3:69157051-69157073 TGCTTCTCTGTGCCAGCTCCTGG - Intergenic
957970361 3:87375358-87375380 CGCGGGCCAGCGCAAGCTCCGGG + Intergenic
961211944 3:125132143-125132165 CCATGCTCTGCACCAGCTCCAGG - Intronic
961501427 3:127338439-127338461 GGCTGCTCCGCGCCCGCTCATGG - Intergenic
961863081 3:129933662-129933684 ACCTGCTCAGGGCCAGCACCTGG + Intergenic
963729524 3:148957859-148957881 TGCTGCTCAGCTCCAGCACATGG + Intergenic
967921524 3:194617647-194617669 CGCTGCCCAGCGTCAGGTGCTGG - Exonic
968707941 4:2092031-2092053 TGCTGCTCTGGGCCAGCTCCTGG + Intronic
968908605 4:3465669-3465691 GGCTGCTCAGCCACAGCGCCTGG + Intronic
968923138 4:3532867-3532889 GGCTCCTCAGCGCCAGGCCCGGG - Intergenic
968954445 4:3711056-3711078 AGCTCCTCAGCTGCAGCTCCTGG + Intergenic
969057990 4:4413974-4413996 TCCGGCTCAGGGCCAGCTCCTGG - Intronic
969330606 4:6471931-6471953 CGCTGCCCAGCGCCGGCACAGGG - Intronic
969463484 4:7341246-7341268 CGCTGCTCTGTTCCAGCCCCTGG + Intronic
969519089 4:7665399-7665421 CTCTGCTGAGCCCCAGCCCCTGG + Intronic
973878093 4:55241541-55241563 TGCTGCCCAGCGCAAGTTCCGGG + Intergenic
974629295 4:64462654-64462676 CTCGGCTCACTGCCAGCTCCCGG + Intergenic
982125158 4:152177983-152178005 CTCTGCTCCTCCCCAGCTCCTGG + Intergenic
982745602 4:159102649-159102671 CGCTGCTCCCCGCCCGCTCCTGG - Intergenic
983578622 4:169285596-169285618 CTCTGCTCAGTGCAACCTCCTGG + Intergenic
984557031 4:181226642-181226664 CTCTGGTCAGGGTCAGCTCCTGG + Intergenic
984765800 4:183399435-183399457 CCCTGCTCAGCGACAGAGCCTGG - Intergenic
985387812 4:189465480-189465502 GGCTGCTTAGCTCCACCTCCAGG - Intergenic
985387826 4:189465543-189465565 GGCTGCTTAGCTCCACCTCCAGG - Intergenic
985387853 4:189465648-189465670 GGCTGCTTAGCTCCACCTCCAGG - Intergenic
985387857 4:189465669-189465691 GGCTGCTTAGCTCCACCTCCAGG - Intergenic
985387861 4:189465690-189465712 GGCTGCTTAGCTCCACCTCCAGG - Intergenic
985387881 4:189465774-189465796 GGCTGCTTAGCTCCACCTCCAGG - Intergenic
985387911 4:189465900-189465922 GGCTGCTTAGCTCCACCTCCAGG - Intergenic
985387925 4:189465963-189465985 GGCTGCTTAGCTCCACCTCCAGG - Intergenic
985387929 4:189465984-189466006 GGCTGCTTAGCTCCACCTCCAGG - Intergenic
985387941 4:189466047-189466069 GGCTGCTTAGCTCCACCTCCAGG - Intergenic
985387945 4:189466068-189466090 GGCTGCTTAGCTCCACCTCCAGG - Intergenic
985388023 4:189466404-189466426 GGCTGCTTAGCTCCACCTCCAGG - Intergenic
985388062 4:189466572-189466594 GGCTGCTTAGCTCCACCTCCAGG - Intergenic
985388093 4:189466698-189466720 GGCTGCTTAGCTCCACCTCCAGG - Intergenic
985388196 4:189467118-189467140 GGCTGCTTAGCTCCACCTCCAGG - Intergenic
985779710 5:1863962-1863984 AGCTGCTCATCACCAGCTTCAGG + Intergenic
986016782 5:3764240-3764262 TGCTGCTCAGGGCCACCTCCCGG + Intergenic
988509710 5:31854936-31854958 GGCTGCTCTCCGCCGGCTCCAGG - Intronic
988664914 5:33315909-33315931 CTCTACTCAGGGCCAGCTTCAGG + Intergenic
990247677 5:53879374-53879396 CTCGGCTCACCGCAAGCTCCCGG - Intergenic
995271691 5:110227518-110227540 GGCTTCTCAGCCCCAGCTGCAGG - Intergenic
997271794 5:132545680-132545702 TGCTGCTCAGCTCCAGCTGATGG + Intronic
997975563 5:138439679-138439701 CGCAGCTCAGAGCCATCACCAGG + Intronic
998140317 5:139696395-139696417 CTCGGCTCAGGGCCAGCTGCTGG - Intergenic
1000003495 5:157162503-157162525 CACTGATCATCTCCAGCTCCTGG + Exonic
1001237192 5:170040042-170040064 CACTGCTCAGTGCCGGCTACAGG + Intronic
1001237572 5:170043076-170043098 TGCTGCTCAGCTCCAGCCTCTGG + Intronic
1001403412 5:171459930-171459952 GGCTGCCCAGCGCCAGAGCCTGG + Intergenic
1001764305 5:174233260-174233282 GGCTTCTCAGTGCCTGCTCCTGG + Intronic
1002429602 5:179195306-179195328 TGCTGGTCAGTGCCAACTCCCGG - Intronic
1004467712 6:15901418-15901440 AGCTGCTGATCACCAGCTCCAGG + Intergenic
1006020061 6:31112507-31112529 CGCTCCTCTGGGCCTGCTCCTGG - Exonic
1006116683 6:31779482-31779504 TGATGCTTAGCGCCAGCTCAAGG + Exonic
1006370850 6:33642836-33642858 CTCTTCTCTGCCCCAGCTCCTGG + Intronic
1007152559 6:39708491-39708513 AGCTGTTCAGCACCAGCTACTGG + Intronic
1010440896 6:75892610-75892632 CAATCCTCAGGGCCAGCTCCCGG - Exonic
1015669658 6:135673987-135674009 CTCTGCTCTGCACCAGCTCCTGG - Intergenic
1015724828 6:136289503-136289525 CACTGCTCAGCGCCCCCGCCCGG + Intronic
1016194003 6:141309351-141309373 AGCTGCTGATCACCAGCTCCAGG + Intergenic
1017947208 6:159105261-159105283 TGCTCCTCAGTGCCAGCTGCTGG - Intergenic
1019379623 7:714027-714049 TGCTGGTCAGCAGCAGCTCCAGG - Intronic
1020270158 7:6590036-6590058 GGCTGCGCGGCGGCAGCTCCCGG + Exonic
1022103724 7:27184138-27184160 CCCCGCTCGGGGCCAGCTCCAGG - Intronic
1023038635 7:36153721-36153743 CCCTTCTCAGTGCCCGCTCCGGG + Intronic
1023125812 7:36953038-36953060 CTCGGCTCAGGGCAAGCTCCCGG + Intronic
1024565368 7:50675845-50675867 AGCTGCACAGCCCTAGCTCCTGG - Intronic
1024865076 7:53896160-53896182 CGCTGCTTTGCTCCAGCTGCTGG - Intergenic
1025777907 7:64575080-64575102 AGCTGCCCAGCGAGAGCTCCAGG - Intergenic
1026086608 7:67268143-67268165 CTGTGCTCAGGGTCAGCTCCAGG + Intergenic
1029879970 7:103797860-103797882 AGCTGCACAGGGCCAGCCCCAGG - Intronic
1034101910 7:148457662-148457684 AGCTGCCCAGCTGCAGCTCCAGG - Intergenic
1034188282 7:149195703-149195725 CCCCGCGCAGCGCCGGCTCCTGG - Exonic
1034916463 7:155043992-155044014 AGCTGCTGATCACCAGCTCCAGG - Intergenic
1035459297 7:159029439-159029461 GGCTGCTGAGCGCCAGCTCTGGG + Exonic
1035654525 8:1295552-1295574 CTCTGGTCAGCCCCCGCTCCTGG + Intergenic
1039936625 8:42051746-42051768 CGCTGCTCTGCGCCAGGCCTCGG - Intronic
1040951137 8:52939955-52939977 AGCAGCTCAGCGCCGGGTCCGGG - Exonic
1043306624 8:78804313-78804335 CCTTCCTCAGCGCCAGCCCCAGG + Intronic
1047888232 8:129277065-129277087 GGATGTTCAGTGCCAGCTCCTGG - Intergenic
1048658991 8:136575064-136575086 AGCTGCTCTGCCCCAGCTCTGGG + Intergenic
1048941655 8:139405388-139405410 GGCTGCTTAGGTCCAGCTCCTGG + Intergenic
1049194103 8:141306180-141306202 GGCTGCCCAGGGCCACCTCCCGG - Intronic
1049721712 8:144119411-144119433 CACTGCTCTGCGCCAACACCTGG + Intergenic
1053283081 9:36834172-36834194 CACTTCTCAGCCCCAGCTGCTGG - Exonic
1057273535 9:93664250-93664272 CTCTGCTCAGTGCCGTCTCCAGG - Intronic
1059344098 9:113616599-113616621 CTCTGCTCAGTACCAGCTGCAGG - Intergenic
1060434281 9:123580468-123580490 TGCTGCTCAGTGCCAGCACAGGG + Intronic
1187273799 X:17801503-17801525 CGAGGCCCAGCCCCAGCTCCTGG - Exonic
1189780414 X:44508508-44508530 AGCTGCTGATCACCAGCTCCAGG + Intergenic
1190339613 X:49286310-49286332 CGCTGTTCAGGGCCCGCTCAGGG - Exonic
1192656638 X:73000883-73000905 CGCTGTTAAGAGCCATCTCCTGG - Intergenic
1192665482 X:73082118-73082140 CGCTGTTAAGAGCCATCTCCTGG + Intergenic
1198451126 X:136767716-136767738 CGCTGCTCGGCTCCGGCTGCGGG - Intronic
1198682227 X:139194992-139195014 AGCTGCCCGGCGCCGGCTCCGGG - Intronic
1199274650 X:145926694-145926716 TGCTGCTCAGAGCCAATTCCAGG - Intergenic
1199581589 X:149365945-149365967 CCATGCTCAGCCCCAGCTCAAGG - Intergenic
1200103489 X:153700049-153700071 CTCTGCCCTGGGCCAGCTCCAGG + Intergenic