ID: 1172702695

View in Genome Browser
Species Human (GRCh38)
Location 20:36862927-36862949
Sequence GCGCCAGCTCCAGGCCCAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 521
Summary {0: 1, 1: 0, 2: 8, 3: 67, 4: 445}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172702689_1172702695 8 Left 1172702689 20:36862896-36862918 CCCCCGGCCGCGGACTCGGCGTC 0: 1
1: 0
2: 0
3: 19
4: 87
Right 1172702695 20:36862927-36862949 GCGCCAGCTCCAGGCCCAGCAGG 0: 1
1: 0
2: 8
3: 67
4: 445
1172702685_1172702695 17 Left 1172702685 20:36862887-36862909 CCCGCCGGGCCCCCGGCCGCGGA 0: 1
1: 0
2: 4
3: 35
4: 331
Right 1172702695 20:36862927-36862949 GCGCCAGCTCCAGGCCCAGCAGG 0: 1
1: 0
2: 8
3: 67
4: 445
1172702678_1172702695 30 Left 1172702678 20:36862874-36862896 CCCCGTACGGACCCCCGCCGGGC 0: 1
1: 0
2: 0
3: 0
4: 62
Right 1172702695 20:36862927-36862949 GCGCCAGCTCCAGGCCCAGCAGG 0: 1
1: 0
2: 8
3: 67
4: 445
1172702680_1172702695 28 Left 1172702680 20:36862876-36862898 CCGTACGGACCCCCGCCGGGCCC 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1172702695 20:36862927-36862949 GCGCCAGCTCCAGGCCCAGCAGG 0: 1
1: 0
2: 8
3: 67
4: 445
1172702693_1172702695 1 Left 1172702693 20:36862903-36862925 CCGCGGACTCGGCGTCGCTGCTC 0: 1
1: 0
2: 1
3: 4
4: 64
Right 1172702695 20:36862927-36862949 GCGCCAGCTCCAGGCCCAGCAGG 0: 1
1: 0
2: 8
3: 67
4: 445
1172702687_1172702695 13 Left 1172702687 20:36862891-36862913 CCGGGCCCCCGGCCGCGGACTCG 0: 1
1: 0
2: 2
3: 34
4: 238
Right 1172702695 20:36862927-36862949 GCGCCAGCTCCAGGCCCAGCAGG 0: 1
1: 0
2: 8
3: 67
4: 445
1172702679_1172702695 29 Left 1172702679 20:36862875-36862897 CCCGTACGGACCCCCGCCGGGCC 0: 1
1: 0
2: 0
3: 6
4: 63
Right 1172702695 20:36862927-36862949 GCGCCAGCTCCAGGCCCAGCAGG 0: 1
1: 0
2: 8
3: 67
4: 445
1172702692_1172702695 5 Left 1172702692 20:36862899-36862921 CCGGCCGCGGACTCGGCGTCGCT 0: 1
1: 0
2: 0
3: 5
4: 42
Right 1172702695 20:36862927-36862949 GCGCCAGCTCCAGGCCCAGCAGG 0: 1
1: 0
2: 8
3: 67
4: 445
1172702691_1172702695 6 Left 1172702691 20:36862898-36862920 CCCGGCCGCGGACTCGGCGTCGC 0: 1
1: 0
2: 1
3: 8
4: 99
Right 1172702695 20:36862927-36862949 GCGCCAGCTCCAGGCCCAGCAGG 0: 1
1: 0
2: 8
3: 67
4: 445
1172702682_1172702695 19 Left 1172702682 20:36862885-36862907 CCCCCGCCGGGCCCCCGGCCGCG 0: 1
1: 0
2: 8
3: 73
4: 823
Right 1172702695 20:36862927-36862949 GCGCCAGCTCCAGGCCCAGCAGG 0: 1
1: 0
2: 8
3: 67
4: 445
1172702683_1172702695 18 Left 1172702683 20:36862886-36862908 CCCCGCCGGGCCCCCGGCCGCGG 0: 1
1: 0
2: 9
3: 90
4: 641
Right 1172702695 20:36862927-36862949 GCGCCAGCTCCAGGCCCAGCAGG 0: 1
1: 0
2: 8
3: 67
4: 445
1172702686_1172702695 16 Left 1172702686 20:36862888-36862910 CCGCCGGGCCCCCGGCCGCGGAC 0: 1
1: 0
2: 2
3: 33
4: 344
Right 1172702695 20:36862927-36862949 GCGCCAGCTCCAGGCCCAGCAGG 0: 1
1: 0
2: 8
3: 67
4: 445
1172702690_1172702695 7 Left 1172702690 20:36862897-36862919 CCCCGGCCGCGGACTCGGCGTCG 0: 1
1: 0
2: 0
3: 15
4: 121
Right 1172702695 20:36862927-36862949 GCGCCAGCTCCAGGCCCAGCAGG 0: 1
1: 0
2: 8
3: 67
4: 445

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172702695 Original CRISPR GCGCCAGCTCCAGGCCCAGC AGG Exonic
900617861 1:3573362-3573384 GAGCCAGCTCCAGGCCCAGATGG + Intronic
900955460 1:5883867-5883889 TCGCCTGCCCCAGGCCCAGTTGG - Intronic
901136498 1:7000201-7000223 GCGCCAGCTCCAGGGTGAGCAGG - Intronic
901497598 1:9630848-9630870 GTCCCGGCTCCTGGCCCAGCAGG + Intergenic
901646208 1:10718105-10718127 GGGCCAGGGGCAGGCCCAGCTGG + Intronic
902449313 1:16486517-16486539 GGCCCTGCTGCAGGCCCAGCTGG - Intergenic
902450075 1:16491235-16491257 GCGCAAGCTGCAGGCCTACCTGG - Intergenic
902472250 1:16657094-16657116 GCGCAAGCTGCAGGCCTACCTGG - Intergenic
902486553 1:16750352-16750374 GCGCAAGCTGCAGGCCTACCTGG + Intronic
902504391 1:16929962-16929984 GCGCAAGCTGCAGGCCTACCAGG + Exonic
902505435 1:16936760-16936782 GGCCCTGCTGCAGGCCCAGCTGG + Exonic
902659679 1:17892379-17892401 GGGCCAGCTCCAGGAGCACCTGG + Intergenic
903135610 1:21307625-21307647 GCCCCAGCCCCAGACCCAGTGGG - Intronic
903216949 1:21848627-21848649 GCACCAGGTACAGGGCCAGCAGG - Exonic
905403404 1:37718383-37718405 GCTCCAGCTGCAGGGCCAGGGGG - Exonic
905868827 1:41391498-41391520 GTCCCAGCTCCAGGCCCTGGTGG + Intergenic
905937214 1:41834108-41834130 GACCCAGCCCCAGGCCCAGAGGG - Intronic
906193589 1:43914788-43914810 GTCCCTTCTCCAGGCCCAGCAGG - Intronic
906401690 1:45509154-45509176 GAGCCAGCTCCGGGCTCTGCTGG - Exonic
906544781 1:46613324-46613346 ACAGCAGCCCCAGGCCCAGCTGG - Exonic
907401710 1:54228671-54228693 GCCTCAGCTCCTGGCTCAGCTGG - Intronic
907430025 1:54406251-54406273 GCGGCACCCCCAGGCCGAGCCGG - Exonic
907540888 1:55214910-55214932 GCCCCAGCCCCGGGCCCGGCGGG - Exonic
908128159 1:61050572-61050594 GCCGCAGCTCCTGGCCCTGCAGG - Intronic
908186037 1:61654258-61654280 GCGGCAGCTGGAGGCCGAGCTGG + Intergenic
913476630 1:119244551-119244573 AGCCCAGCTCCAGGCCCAGAGGG - Intergenic
914755790 1:150561044-150561066 CCGCCAGCCCCAGGCCCTGCAGG + Intergenic
914878851 1:151532437-151532459 GCAGCAGCTCCAGGCCCAGCTGG + Exonic
915111215 1:153565701-153565723 GTGCCAGCTCCACCACCAGCTGG + Exonic
915367820 1:155325303-155325325 GCGCCACCTCCAGGCCCAGTTGG + Exonic
915727744 1:158030709-158030731 TCACCTGCTCCAGGCCTAGCAGG - Intronic
916028856 1:160859236-160859258 GAGCGAGGTCCAGGACCAGCAGG + Intronic
916575603 1:166064011-166064033 GGGCCATTCCCAGGCCCAGCTGG + Intronic
918040851 1:180913057-180913079 GGGCCAGCTCCCGGCTCTGCTGG - Intergenic
920038657 1:203082122-203082144 GCACCAGCTCCGGGCTCAGCTGG - Intergenic
921472679 1:215567583-215567605 GCGACGGCTGCAGGGCCAGCGGG - Exonic
921802762 1:219419944-219419966 GCACCAGCTTCAGGCCTACCAGG - Intergenic
923171399 1:231421306-231421328 GCGCCAGCTTCAGCGCCGGCAGG + Exonic
923448371 1:234093694-234093716 GCTCCAGCCCCGGGCCCTGCCGG + Intronic
1062767920 10:79781-79803 GGGGCAGCTCCAGGGACAGCAGG - Intergenic
1062769541 10:88002-88024 GGGGCAGCTCCAAGCTCAGCAGG + Intergenic
1063396538 10:5692973-5692995 GAGCCCGCCCCAGGCACAGCGGG - Intronic
1065223638 10:23521192-23521214 GTGCCATCTCCAGGCCCAGAAGG + Intergenic
1065808812 10:29421810-29421832 AAGCCAGCTCCAGTACCAGCAGG - Intergenic
1066335455 10:34473048-34473070 GAGGGAGCTCCAGGCCCTGCGGG + Intronic
1066439831 10:35427891-35427913 GAGCCACCACCAGGCCCAGGTGG - Intronic
1067062027 10:43082485-43082507 GCCCCAGCACCAGGCCCTCCAGG - Intronic
1067750587 10:48968772-48968794 GAGCCACCCCCAGCCCCAGCTGG - Intronic
1069568043 10:69476886-69476908 GCCCCACCTCCAGGACCACCAGG - Intronic
1069957950 10:72063055-72063077 CAGTCAGCTCCAGGCCCAGCTGG + Exonic
1070754244 10:78981831-78981853 CCCCCAGCCCCAGGCCCTGCAGG + Intergenic
1070933754 10:80278134-80278156 GGGCCAGCTCCAGTCTCAGGGGG - Intronic
1071602206 10:86963787-86963809 TACCCAGCTCCAGGTCCAGCGGG - Intronic
1075021524 10:118956062-118956084 GTGCCAGCTTGAGGCACAGCTGG - Intergenic
1075557767 10:123445686-123445708 GCGCCCGCTCTAGGCTGAGCTGG - Intergenic
1075561800 10:123473694-123473716 GCGGCAGGTGCAGGCCCAGGAGG - Intergenic
1075644025 10:124085923-124085945 TAGCCAGGTCCAGGCCCGGCTGG + Intronic
1075944839 10:126423933-126423955 GCTCCAGCACCAGGCCCTGCAGG + Intergenic
1076110466 10:127855763-127855785 CAGCCAGCTCCAGCCCCTGCAGG - Intergenic
1076316945 10:129548864-129548886 CCTCCAGGTCCAGGCCCTGCAGG + Intronic
1076408776 10:130231329-130231351 GGGCCAGCCCCATGCCGAGCCGG - Intergenic
1076569769 10:131425031-131425053 GAGCCAGGGCCAGGCCCTGCTGG - Intergenic
1076605978 10:131690109-131690131 GTAGCTGCTCCAGGCCCAGCAGG + Intergenic
1076779187 10:132714585-132714607 CCGGCAGCACCAGGCCCAGGAGG + Intronic
1076809548 10:132879491-132879513 GCGACAGCACCAGGGCCAGCAGG + Exonic
1076875349 10:133213149-133213171 GAGGCAGGGCCAGGCCCAGCGGG - Intronic
1076917750 10:133432993-133433015 GCGGCTGCTCCAGGCCCACCTGG + Intergenic
1076937745 10:133577068-133577090 GCGGCTGCTCCAGGCCCACCTGG + Intergenic
1076981480 11:207207-207229 GCGCCTGCCTCTGGCCCAGCTGG - Intronic
1077015440 11:397154-397176 AGGCCAGCTCCAGCTCCAGCCGG + Exonic
1077017559 11:403635-403657 GCTCCTGCTCCAGGGCCAGGCGG - Exonic
1077094261 11:792677-792699 GGGCCAGCTCTCGGCCCAGGGGG - Exonic
1077332346 11:1989168-1989190 GAGCCGCCCCCAGGCCCAGCTGG - Intergenic
1077799310 11:5522400-5522422 CCTCCAGCTCCAGGCACAGCAGG + Intronic
1077976315 11:7252029-7252051 GCCCGAGCCCCAGACCCAGCCGG - Exonic
1078107262 11:8366172-8366194 GGGCCCACTCCAGGCCTAGCTGG - Intergenic
1078514111 11:12008540-12008562 CCGCCAGCAGCAGGCACAGCAGG + Exonic
1078519275 11:12050456-12050478 GCCCCAGCTCCAGGCCTAAAAGG - Intergenic
1081637092 11:44727967-44727989 GCGCCGGCTCCGGGTCCTGCTGG + Intronic
1082808367 11:57463882-57463904 GTGCTCGCTCCAGCCCCAGCAGG + Intronic
1083264966 11:61542383-61542405 GGGCCAGCTGCAGGCCCACATGG - Intronic
1083341551 11:61961686-61961708 GGCTCAGCTCCAGACCCAGCTGG - Intronic
1083746027 11:64736896-64736918 GTGCCAGCTGCAGGGCCACCAGG + Exonic
1083750547 11:64758497-64758519 CCTCCATGTCCAGGCCCAGCTGG + Exonic
1083752404 11:64767732-64767754 GGGCCACCTCCGGGCCCACCAGG + Exonic
1083885817 11:65572981-65573003 GCGTCAGCCCCCCGCCCAGCTGG - Intronic
1083899638 11:65637308-65637330 GCCCCAGGTCCAGGCCAAGGGGG - Exonic
1083934453 11:65863077-65863099 GGGCCAGCTCCAGGCCCTCTGGG - Exonic
1083960365 11:66011923-66011945 GCCCCAGCTCCAGGCCGCGGGGG + Exonic
1084028180 11:66466189-66466211 TCGCAAGCCCCAGGCCCAGAAGG + Intronic
1084044942 11:66563061-66563083 GCGCGAGCTCCCTGCCAAGCAGG + Exonic
1084172950 11:67409442-67409464 GCGGGAGATCAAGGCCCAGCTGG + Exonic
1084190648 11:67497261-67497283 GAGCCAGCACCAGGCCCAGTGGG + Exonic
1084226159 11:67715894-67715916 GTGGCAGCCACAGGCCCAGCAGG + Intergenic
1084263999 11:67995773-67995795 GTGGCAGCCACAGGCCCAGCAGG + Exonic
1084463632 11:69309678-69309700 GCCTCCACTCCAGGCCCAGCTGG + Intronic
1084777503 11:71387195-71387217 CAGCCAGCTCAAGGGCCAGCTGG + Intergenic
1085176548 11:74493304-74493326 GTGCGAGCTCCAGGGCCTGCAGG - Exonic
1085202217 11:74708580-74708602 GCCCCACTTCCAGGCCCTGCAGG + Intronic
1085699113 11:78730490-78730512 GCCCCAGCTCCAGTGCCAGATGG + Intronic
1088754899 11:112877769-112877791 CAGCCAGCCCCAGGCCCTGCTGG + Intergenic
1089002073 11:115060286-115060308 ATGCCAGCCCCACGCCCAGCAGG + Intergenic
1089519257 11:119052795-119052817 GCTCCATCTCCAGGCCCCCCAGG + Exonic
1089556599 11:119318703-119318725 AAGCCAGCTCCATGCCCAGCCGG - Intronic
1089619744 11:119715276-119715298 CCTTCAGCTGCAGGCCCAGCTGG + Intronic
1202815327 11_KI270721v1_random:44344-44366 GAGCCGTCCCCAGGCCCAGCTGG - Intergenic
1091727362 12:2855314-2855336 GCGGCAGCTTCAGAGCCAGCTGG + Intronic
1091795955 12:3297655-3297677 TCCCCACCTCCAGGCCCTGCAGG + Intergenic
1092159604 12:6308936-6308958 TCTCCTGCTCCTGGCCCAGCTGG - Intergenic
1092240164 12:6831298-6831320 GAACCAGTACCAGGCCCAGCTGG + Exonic
1092342765 12:7690576-7690598 GCCCCAAGTCCAGGCCCAGCTGG + Exonic
1092526104 12:9311227-9311249 GCGCCAGGTCCATGCCCACTGGG + Intergenic
1092541176 12:9420556-9420578 GCGCCAGGTCCATGCCCACTGGG - Intergenic
1094511867 12:31101919-31101941 GCGCCAGGTCCATGCCCACTGGG + Exonic
1095307084 12:40651306-40651328 GGCCCAGCTGCAGGCTCAGCTGG - Intergenic
1096500831 12:52063089-52063111 CCGCCGGCTCCAAGTCCAGCTGG - Intergenic
1097181732 12:57175536-57175558 GCCCCAGCTCCATGCCCAGAGGG - Exonic
1101253429 12:102956455-102956477 GCGCCAGCACGCGGCCCCGCCGG + Intronic
1101865526 12:108517080-108517102 GCGGCAGCAGCAGGGCCAGCAGG - Exonic
1102299082 12:111758162-111758184 GCCTCAGCTCTGGGCCCAGCAGG + Intronic
1102695956 12:114799708-114799730 GCCCCTGCTCTAGGGCCAGCGGG + Intergenic
1103542944 12:121678938-121678960 GGGCCGACTCCAGACCCAGCTGG - Intergenic
1103703352 12:122859110-122859132 GGGGCAGCTGCAGGACCAGCAGG + Exonic
1104222982 12:126803746-126803768 GTGCCAGCTTCAGGAACAGCTGG - Intergenic
1104458054 12:128931735-128931757 GAGTCAGCTCCCGGCCCTGCAGG - Intronic
1104647357 12:130506671-130506693 ACACCAGCTCCAAGCCAAGCTGG - Exonic
1105209399 13:18249028-18249050 GCCCCAGCCCCAGCCCCAGCAGG + Intergenic
1105281369 13:18964622-18964644 GCTCCAGCTCCAGCTCCAGCAGG + Intergenic
1106141464 13:27015304-27015326 CCGCCAGCTCCAGGACCTGCTGG + Intergenic
1109110942 13:58318485-58318507 GCTCCAGCTGCAGCCCCAGTGGG - Intergenic
1111781803 13:92737354-92737376 GCTCCAGCTTCAGGCCCGTCAGG + Intronic
1112505138 13:99970817-99970839 CCGCCAGCCCCAGGCGCATCTGG + Exonic
1113520422 13:110936673-110936695 GCGGAAGCTCCAGGCGCAGGCGG + Intergenic
1113672272 13:112183250-112183272 GTGACATCTCCAGGCCCAGGTGG + Intergenic
1113672688 13:112185648-112185670 GCCCCAGCTGCAGTCCTAGCTGG + Intergenic
1113899522 13:113788472-113788494 GCGCCAGTGCCAGGCCACGCAGG - Intronic
1114191909 14:20445955-20445977 GCACCACCTCCAGGCCCAGTGGG + Intergenic
1114221251 14:20699419-20699441 GGACCAGCCCCAGCCCCAGCAGG - Exonic
1114483371 14:23048511-23048533 CCGCCCGCTCCCGGCCCTGCTGG - Intronic
1114648643 14:24269536-24269558 GCCCCAGCTGCACCCCCAGCCGG - Exonic
1116874078 14:50094082-50094104 GCGTGAGCACCACGCCCAGCCGG + Intergenic
1116895680 14:50312635-50312657 GCCCCCGCTCCAGCTCCAGCCGG + Exonic
1117507828 14:56420151-56420173 GGGGCAGCTCCAGGCCAAGGAGG - Intergenic
1117776451 14:59189084-59189106 CCGCCAGCTCCTCGGCCAGCCGG - Intronic
1118206449 14:63727914-63727936 GAGGCAGCGCCTGGCCCAGCTGG - Exonic
1118471224 14:66077044-66077066 GCCCCAGCTCCAAGCCCTGCTGG + Intergenic
1118966912 14:70595559-70595581 GCTCCAACTCCAGGTACAGCAGG - Intronic
1119330007 14:73786845-73786867 GGGCCAGCTCCAGGCGCCGTTGG - Intronic
1119999054 14:79282082-79282104 GAGCCAACACCAGACCCAGCAGG - Intronic
1121320260 14:92987952-92987974 GCGCCAGCTGCAGACCAGGCCGG - Intronic
1121413268 14:93762334-93762356 GCAACAGCTCCAATCCCAGCAGG - Intronic
1122061507 14:99139419-99139441 GCACCAGCTGGAGGCCCTGCTGG - Intergenic
1122217908 14:100215870-100215892 GAGCAAACTCCAGGCCCAGATGG + Intergenic
1122283122 14:100635963-100635985 GTGCCTGCTCCAGGCTCAGGGGG + Intergenic
1122363213 14:101179694-101179716 TCCCCAGCCCCAGCCCCAGCAGG - Intergenic
1122363295 14:101180085-101180107 GGGCCAACTTCAGGCCCTGCTGG - Intergenic
1122610009 14:102975851-102975873 GCGCCGGCTCCGGGGCCAGGCGG - Intronic
1122818678 14:104328758-104328780 GCCCAGGCACCAGGCCCAGCTGG - Intergenic
1122937824 14:104968067-104968089 TCGCCTGAGCCAGGCCCAGCTGG + Intronic
1122947957 14:105021755-105021777 GCGCCTGCAGCAGGCCCGGCAGG + Intergenic
1124014256 15:25862757-25862779 GCGCCAGTGCCAGGCCGGGCTGG + Exonic
1124363386 15:29054690-29054712 AGGCCAGCTGCAGCCCCAGCAGG + Exonic
1124427103 15:29571101-29571123 GCTCCCGCTCCCGCCCCAGCTGG - Intergenic
1124962737 15:34410450-34410472 AGGCCAGCTGCAGCCCCAGCAGG + Intronic
1124979363 15:34556672-34556694 AGGCCAGCTGCAGCCCCAGCAGG + Intronic
1125919581 15:43517647-43517669 GCGGCAGCTCCGGCCTCAGCCGG - Exonic
1127692999 15:61415809-61415831 GCTCCAGCTCCAGCCTCAGCTGG - Intergenic
1128149841 15:65355882-65355904 GCGCCGGGGCCGGGCCCAGCTGG - Intronic
1129834868 15:78695998-78696020 GCGCCAGCTCCCTCACCAGCAGG + Intronic
1130087145 15:80787214-80787236 GAGCTGGCTCCAGGCCCAGAAGG - Intronic
1130135222 15:81176660-81176682 GGGCGGGCTCCAGGCCCAACAGG + Intronic
1130670900 15:85911615-85911637 GGGTAAGCTCCAGGCCTAGCTGG + Intergenic
1130701736 15:86190571-86190593 TAACCAGCTCCAGGCCCACCTGG + Intronic
1131094889 15:89648812-89648834 GCTCCAGGCCCAGGGCCAGCGGG + Intronic
1131261458 15:90890164-90890186 GGCCAAGCTGCAGGCCCAGCAGG + Exonic
1131267303 15:90924269-90924291 GAGCCAACTGCAGACCCAGCTGG - Intergenic
1132085922 15:98908115-98908137 GCCCCAGCTCCAGTCCCTGGAGG - Intronic
1132215320 15:100057885-100057907 GCACCAGCTTCAGGCACTGCTGG - Intronic
1132356395 15:101174318-101174340 GGATCAGTTCCAGGCCCAGCAGG + Intergenic
1132497548 16:270947-270969 GCCCCTGCTCCAGTCCCAGCGGG - Intronic
1132518155 16:375506-375528 GCACCAGCACCAGGCTGAGCTGG - Intronic
1133023401 16:2976798-2976820 GCACCAGCTGCAGCCCCGGCGGG - Exonic
1133216754 16:4297234-4297256 CCCCCAGCTGCAGCCCCAGCTGG + Intergenic
1134245237 16:12534807-12534829 TCCCCAGTTCCAGGCACAGCTGG + Intronic
1135120965 16:19766386-19766408 GGGCTGGCTCCAGGCCCACCAGG - Intronic
1135225812 16:20656724-20656746 GAAACAGATCCAGGCCCAGCGGG - Intronic
1136419596 16:30123330-30123352 GTGACAGCTCCAGGCCCACGCGG - Intronic
1137553763 16:49457327-49457349 GTGGCTGCTCCAGCCCCAGCAGG - Intergenic
1137582357 16:49641004-49641026 GCCCCCGCTCCAGGCCAGGCTGG + Intronic
1137671727 16:50283268-50283290 GCGTAAGCTTCAGGCACAGCTGG + Intronic
1137788504 16:51155271-51155293 TCCCCAGCTCAAGGCCCCGCTGG + Intergenic
1138553339 16:57758851-57758873 GGCCCAGCTTCAGGCCCAGCGGG + Exonic
1138894405 16:61185471-61185493 GCTCCAGCCCCAGTTCCAGCTGG - Intergenic
1139335229 16:66226652-66226674 GGGCCAGGGCCAGGGCCAGCAGG - Intergenic
1139592719 16:67942441-67942463 GCGCCAGCCCCAGGCCTGGAAGG - Exonic
1140077251 16:71711933-71711955 GCGCCAGTTCCTGTCACAGCTGG + Intronic
1140479052 16:75252746-75252768 GGGGCAGCTGCAGGCCCACCTGG - Intronic
1140908583 16:79430691-79430713 GCACCAGCTGCAGGCCTAGCCGG - Intergenic
1141262239 16:82464241-82464263 CCCCGAGCACCAGGCCCAGCAGG + Intergenic
1141426990 16:83951181-83951203 GCCCCAGCCCCAGCCCCTGCTGG + Exonic
1141548321 16:84787074-84787096 GCCCCAGCCCCAGGCCCTCCTGG - Intergenic
1141886881 16:86898477-86898499 ACGCCAGCCCCAGGGCCAGGTGG + Intergenic
1141934380 16:87227615-87227637 GCACCACCTCCAGGCAGAGCAGG - Intronic
1142067135 16:88069033-88069055 GCTCCAGCCCCAGGCCCAGATGG + Intronic
1142154827 16:88528177-88528199 CCTCCAGCTCCTGCCCCAGCAGG + Exonic
1142270306 16:89085553-89085575 GCGCCCGGTCCAGGCACAGGAGG - Intergenic
1142407647 16:89899829-89899851 TCCCCAGCCCCAGGCCCTGCTGG - Intronic
1142558424 17:795352-795374 GCGTGAGCTCCAGGCACATCTGG - Intergenic
1142638266 17:1270928-1270950 GCGCCAGCCCCGCGCCCCGCGGG + Exonic
1142764506 17:2057743-2057765 GCGGCGGCGCCAGGCCGAGCGGG - Exonic
1143174255 17:4947631-4947653 TCCCCTGCTCCAGGCCCCGCCGG + Intronic
1143444029 17:6996617-6996639 GCATCAGCTCCAGGCGCTGCGGG + Intronic
1143508753 17:7383963-7383985 GCGCCAGCTCCATCACCTGCAGG - Exonic
1143606365 17:7988712-7988734 GCGCTACCTTCAGGCACAGCTGG - Intergenic
1143606813 17:7991698-7991720 GCGCTACCTTCAGGCACAGCTGG + Intergenic
1144589512 17:16512374-16512396 CAGCCTGCTCCAGGCACAGCAGG - Intergenic
1144788605 17:17845341-17845363 GCTCCAGCGCCAGCGCCAGCTGG - Intronic
1145413583 17:22694667-22694689 GCTCCAGCTCCAGGGGCTGCTGG + Intergenic
1147613340 17:41813817-41813839 GCGCTACCCCCAGGTCCAGCCGG - Intronic
1147661866 17:42121138-42121160 GCCCCAGCTGCAGCCCCAGCCGG - Exonic
1147705639 17:42423124-42423146 GCTCCAGCTCCAGCCCCACCCGG - Exonic
1148051530 17:44772207-44772229 GGGCCTGCTCCAGGCCCACTTGG - Intronic
1148066668 17:44875998-44876020 GCTTCAGCTCCAGGATCAGCCGG + Exonic
1148225973 17:45897798-45897820 GCTCAGGCTCCAGGCTCAGCAGG + Intronic
1148327110 17:46789768-46789790 GGGCCAGGGCCAGGCCCAGCTGG - Intronic
1148875319 17:50683696-50683718 GCACCAGGTCTAGGCCCGGCCGG - Exonic
1149655497 17:58307812-58307834 GCTCTAGCTCCAGCCCCATCAGG + Intronic
1150209645 17:63435102-63435124 GTGCCTCCTTCAGGCCCAGCAGG + Exonic
1150265758 17:63831493-63831515 TTGCCATCTCCAGGCCCGGCTGG + Exonic
1150568265 17:66362320-66362342 GAGCCACCACCATGCCCAGCTGG + Intronic
1151491049 17:74432462-74432484 GGGCCAACTCCAGCCCCAGGCGG - Intronic
1151557561 17:74854351-74854373 GCACCACCTCCATGCCCGGCTGG + Intronic
1151698667 17:75731119-75731141 GAGCCAGGGCCAGGCCCAGGTGG - Intronic
1151745221 17:76008287-76008309 GCGAGAGCTCCTGGCCCCGCTGG + Exonic
1151840904 17:76616709-76616731 GAGCCGGCTCCAGGCCCACAAGG + Intergenic
1151948017 17:77330001-77330023 GCCCCCGCTCCATCCCCAGCTGG + Intronic
1152105384 17:78325600-78325622 GAGCCTGCCCCAGGCCCACCTGG + Intergenic
1152371396 17:79890872-79890894 GCTCCCGCTCCAGGCTCAGAGGG + Intergenic
1152420782 17:80191955-80191977 GCTCCAGCTCCAGGCCCCCGGGG + Intronic
1152528487 17:80903144-80903166 GGGCCGGCTCCAGGCTCCGCAGG - Intronic
1152589474 17:81204298-81204320 GCCCCACCTGCAGGGCCAGCTGG - Intronic
1152610544 17:81313139-81313161 GCCCCAGCCCCAGCCCCACCGGG - Exonic
1152615249 17:81334837-81334859 GTGCCAGCGGCAGGCTCAGCAGG + Intergenic
1152644248 17:81461452-81461474 GCGCCAGCCCCATGGGCAGCGGG - Exonic
1152686541 17:81696472-81696494 GCGCCAGCGCCAGATCCAGCTGG + Exonic
1152870037 17:82748896-82748918 GCACCGGCTCCAGGCGCAGCTGG + Exonic
1152901559 17:82943978-82944000 GCGCCTGTTCCACACCCAGCAGG - Exonic
1153377334 18:4395509-4395531 GAACCAGCTGCATGCCCAGCAGG - Intronic
1160256217 18:77250539-77250561 CCGCCAGCTCCATGGCCCGCGGG - Exonic
1160699322 19:498404-498426 GCCCCAGCTCCAAGCCCCTCCGG + Intronic
1160710350 19:548548-548570 GCCCCAGCACCAGCCTCAGCTGG - Exonic
1160758279 19:769748-769770 GGGCCAGCTTCAGGCTCAGCTGG + Intergenic
1160780788 19:877123-877145 GCGCCAGCCCCACCTCCAGCGGG + Exonic
1160846198 19:1167311-1167333 GCGCCCTCTCTGGGCCCAGCAGG + Intronic
1161264986 19:3359869-3359891 GCGCCAGCTCCGCCCCCAGCCGG - Intronic
1161378895 19:3954175-3954197 GCGGCAGCTGGAGGCCCTGCCGG - Intergenic
1161384318 19:3982908-3982930 GCTCCAGCTGCAGCTCCAGCAGG + Exonic
1161428667 19:4218004-4218026 GCTCCAGCTCCGCGCGCAGCCGG - Exonic
1161431448 19:4234713-4234735 GCGCCAGCTACAGGTGCAGTGGG + Exonic
1161714198 19:5866338-5866360 GCACCATCCCCAGCCCCAGCTGG + Exonic
1161793823 19:6375434-6375456 GGGCCAGCGCCAGGCCATGCTGG + Exonic
1162017268 19:7852371-7852393 GCTCCTGCACCCGGCCCAGCTGG - Intronic
1162781733 19:13010231-13010253 GGGCCAGATCCGGGCTCAGCTGG + Intronic
1162799979 19:13104954-13104976 GCGGCAGCCCCAGGTCCAGGGGG + Exonic
1162909423 19:13841397-13841419 GTGCCAGCCCCAGGCCAGGCCGG + Intergenic
1162951320 19:14073465-14073487 GCGCCCGCTCCAGGGCGCGCGGG - Exonic
1163368650 19:16889832-16889854 GGGGCAGCGCCAGGGCCAGCAGG - Exonic
1163462619 19:17448162-17448184 GCGCCAGCTCGGCGCCCAGGTGG + Exonic
1163668892 19:18616230-18616252 GGGCGAGCTTCAGGCACAGCTGG + Intronic
1164649759 19:29883142-29883164 TCCCCAGCTCCAGGCCCTCCTGG - Intergenic
1164840694 19:31390191-31390213 GACCCAGCCCCAGGCCCTGCTGG - Intergenic
1164918584 19:32071767-32071789 GTTCCAGCTCCTGGCCCAGAAGG - Intergenic
1165471401 19:36006764-36006786 CTGGCAGCTGCAGGCCCAGCTGG - Exonic
1165699845 19:37929176-37929198 GCCCCAGCCCCAGCCCCAGAGGG - Intronic
1166042925 19:40214058-40214080 TCTCCAGCTCCAGGTCCACCAGG - Exonic
1166364651 19:42272380-42272402 GCGGCAGCTGCGGTCCCAGCGGG + Intronic
1166708847 19:44924453-44924475 GCCCCAGCTCCAAGGTCAGCAGG - Intergenic
1167380161 19:49133831-49133853 TCGGCAGCTGGAGGCCCAGCTGG + Exonic
1167432297 19:49461659-49461681 GCCCCTCCTCCTGGCCCAGCTGG + Exonic
1202704646 1_KI270713v1_random:13888-13910 GCGCAAGCTGCAGGCCTACCTGG - Intergenic
925118383 2:1398927-1398949 GAGGAAGCTCCAGGCCCAGGAGG + Intronic
925780619 2:7378518-7378540 CCGCCAGCTCCTGGCTTAGCCGG + Intergenic
925832811 2:7912646-7912668 GCACCATGCCCAGGCCCAGCAGG - Intergenic
926058257 2:9789393-9789415 ACAGCAGCCCCAGGCCCAGCTGG + Intergenic
927499252 2:23571305-23571327 GTGCCAGCTGCAGGCAGAGCTGG + Intronic
927726920 2:25432638-25432660 CTCCCAGCTCCAGGACCAGCAGG - Intronic
927963479 2:27255142-27255164 GCCCCAGCCCCAGCCCCAGTGGG - Exonic
928432700 2:31234099-31234121 GCGCCGGCTTCCTGCCCAGCTGG + Intergenic
929071789 2:38038536-38038558 GCTTTAGCTCCAGGCGCAGCTGG - Intronic
929958851 2:46480816-46480838 GCGCCTGCTCCAGGCCCCATGGG - Intronic
931348689 2:61470405-61470427 GCGCCCGGGCCAGGCCGAGCCGG + Intronic
931637637 2:64355127-64355149 GCTCCAGCTCCGGGCCCTGTGGG - Intergenic
931707272 2:64957702-64957724 TCCCCAGTCCCAGGCCCAGCTGG + Intergenic
932562782 2:72887573-72887595 GCGCCAGCTGGAGGCCGAGCTGG + Exonic
932591714 2:73071480-73071502 GCGCTAGCTGCAGGCTCCGCTGG + Intronic
932621723 2:73268907-73268929 GGGCCGGCTGCAGGCCGAGCTGG - Exonic
932705241 2:74019710-74019732 GCCCTGGCTCCAGGCCCTGCAGG + Intronic
932758057 2:74422321-74422343 GCGCCAGCTCCACGCTAAGGAGG + Exonic
933835087 2:86239601-86239623 GCGCCACATCCAAGCCAAGCAGG + Intronic
934063448 2:88318458-88318480 GCCCCAGCTCAGGTCCCAGCTGG - Intergenic
934553199 2:95274615-95274637 GCCCCAGGCCCAGGCCCAGCAGG - Exonic
935062645 2:99621827-99621849 GGGCAAGCTCCAGGCAAAGCGGG + Intronic
938297119 2:130185330-130185352 GCGCCACCACCATGCCCACCTGG - Intronic
938377812 2:130820067-130820089 CCGCCAGCCCCAGGCCCAGCTGG + Intergenic
938459651 2:131489342-131489364 GCGCCACCACCACGCCCACCTGG + Intronic
940453681 2:153871696-153871718 GCGCCAGCTCCAGAAGCAGCTGG + Intergenic
942556539 2:177177896-177177918 CAGCCAGGTCCGGGCCCAGCAGG + Intergenic
942942969 2:181640897-181640919 GTGCCAGTTCCAGCCCCAGAGGG + Intronic
942967919 2:181919377-181919399 GCTGCTCCTCCAGGCCCAGCAGG - Exonic
943747700 2:191479563-191479585 TAGCCAGCTCCAGGCTCCGCTGG - Intergenic
944431043 2:199633927-199633949 GGGCCAGCTCTAGGCCCTGTTGG + Intergenic
945188886 2:207166431-207166453 GCGCCAGCTCCCGGGACGGCTGG + Intronic
946186484 2:217983534-217983556 GCCCCAGCTCCCACCCCAGCTGG + Intronic
946193539 2:218020322-218020344 GGGCCAACTCCTGGCTCAGCAGG + Intergenic
947156007 2:227164018-227164040 GCGGCAGCTCCTGGCGCTGCGGG - Exonic
947167378 2:227276411-227276433 ACACCAGTTCCAGGCCCACCAGG + Exonic
947541931 2:230985686-230985708 GACACAGCTCCACGCCCAGCTGG + Intergenic
947712947 2:232326197-232326219 GCGCCACCTGCTGGCCCACCAGG + Intronic
947732630 2:232439653-232439675 GCGCCACCTGCTGGCCCACCAGG + Intergenic
947749548 2:232525308-232525330 TGGCCGGCTCCAGGCCCACCAGG - Exonic
947835205 2:233170176-233170198 GCCCCAGCCCCAGCCCCAGGCGG - Intronic
948860563 2:240750797-240750819 CAGCCAGGTCCGGGCCCAGCTGG - Intronic
948894664 2:240922532-240922554 TCCCCAGCTGCAGGCCCGGCTGG + Exonic
948920905 2:241065477-241065499 GCACCAGCTCCAGGCCCTGGCGG + Exonic
949026280 2:241767897-241767919 GCAGCAGCTCAAGGCCCTGCTGG + Exonic
1168803870 20:661850-661872 TGCTCAGCTCCAGGCCCAGCGGG - Exonic
1169059540 20:2652044-2652066 GCGCGAGCTACATTCCCAGCAGG + Intergenic
1169342825 20:4809523-4809545 GAGGAAGCTCCAGGCCCAGGAGG - Intronic
1171179826 20:23084386-23084408 GCCCCAGAGCCAGGGCCAGCAGG + Exonic
1171290554 20:23980695-23980717 GCGCCAGCCCCAGCCCCAGAAGG + Intergenic
1172127650 20:32634463-32634485 TAGCCAGCTCCGGGCCCAGCAGG + Intergenic
1172502064 20:35434472-35434494 CCTCCAGCTCCAGGCACAGCTGG + Exonic
1172510544 20:35497937-35497959 GGCCCAGGCCCAGGCCCAGCTGG + Exonic
1172529211 20:35618651-35618673 GCAGCAGCTCCAGGCCGAGCTGG + Exonic
1172702695 20:36862927-36862949 GCGCCAGCTCCAGGCCCAGCAGG + Exonic
1173871239 20:46343500-46343522 GGGCCGGTTCCAGGCCCAGACGG + Intergenic
1174148409 20:48468622-48468644 GCACCTGCTCCAGGCCATGCAGG - Intergenic
1174204124 20:48827291-48827313 GCGCCAGCTCCCGGCGCCGCCGG + Intronic
1175091455 20:56507783-56507805 GCCACAGCTCCAGGCCCCACTGG + Intronic
1175820760 20:61907586-61907608 GCGCCAGCTCCTTGTCCTGCTGG + Intronic
1175829488 20:61954340-61954362 GCTCCAGCTCCAGGCCTGGAAGG - Intronic
1175870693 20:62208194-62208216 GAGACTGCTCCAGGCCCAGGCGG - Intergenic
1175895573 20:62334287-62334309 CCTCCAGCTCCAGGCGCAGGTGG + Exonic
1176184605 20:63771417-63771439 GCGGGAGCGCCAGGCCCGGCGGG - Intronic
1179470269 21:41605642-41605664 GGGCCAGCCTCAGGCCCAGCCGG + Intergenic
1179615049 21:42578195-42578217 TGGCCAGCTCCAGGGCCTGCAGG + Intronic
1179987922 21:44931693-44931715 GCGCCAGGTCCCCGCCCAGCCGG + Intronic
1180050231 21:45327699-45327721 GTGCCAGCTCCCGGTCCACCTGG - Intergenic
1180766871 22:18350372-18350394 GCCCCAGCCCCAGCCCCAGCAGG - Intergenic
1180779442 22:18512006-18512028 GCCCCAGCCCCAGCCCCAGCAGG + Intergenic
1180812158 22:18769327-18769349 GCCCCAGCCCCAGCCCCAGCAGG + Intergenic
1180987837 22:19915941-19915963 GCCACAGCACCAGGCCCTGCTGG - Intronic
1181051862 22:20241737-20241759 GCACCAGCGCCAGGCCCAGGGGG + Exonic
1181198317 22:21203574-21203596 GCCCCAGCCCCAGCCCCAGCAGG + Intergenic
1181401425 22:22652225-22652247 GCGCCAGCCCCAGCCCCAGCAGG - Intergenic
1181633909 22:24165551-24165573 CCGCCAGGTCCTGGCGCAGCGGG + Exonic
1181648105 22:24244668-24244690 GCGCCAGCCCCAGACCCAGCAGG + Exonic
1181703392 22:24633307-24633329 GCACAAGCCCCAGCCCCAGCAGG - Intergenic
1182442751 22:30373743-30373765 ATGCCAGCTCAGGGCCCAGCAGG + Exonic
1183290667 22:36999922-36999944 GGGCAAGCTCATGGCCCAGCAGG - Exonic
1183486426 22:38089566-38089588 GCCCCAGCGCGGGGCCCAGCAGG + Exonic
1183498234 22:38162778-38162800 ACCCCACCTCCAGGCCCAGTGGG + Intronic
1183829234 22:40409199-40409221 GGGGCAGCTCCAGGCCCTTCTGG - Intronic
1184455711 22:44608535-44608557 GCCCCACCTCCAAGCCCACCAGG + Intergenic
1184478678 22:44735171-44735193 GCCCCAGCCCAAGGCCCAGGCGG - Intronic
1184493006 22:44820846-44820868 GCGCCAGCACCAGCGCCAGGTGG - Intronic
1184570107 22:45317682-45317704 GGCCCAGGTCCCGGCCCAGCAGG + Intronic
1184620465 22:45672365-45672387 GCGCCCGCCCCAGGCCCCGCGGG - Intronic
1184636375 22:45835257-45835279 GCGCCCGCGCCAGGCAAAGCAGG - Intronic
1184671515 22:46014258-46014280 CAGCCAGCTCCAGGCCTGGCCGG + Intergenic
1184784852 22:46666721-46666743 GGGCCCCCTCCAAGCCCAGCTGG + Intronic
1184850066 22:47114983-47115005 GAGCCACCTCCAGGGCCTGCTGG + Intronic
1185400010 22:50610804-50610826 CCGTCTGCTCCAGGCGCAGCTGG + Exonic
1203228490 22_KI270731v1_random:91263-91285 GCCCCAGCCCCAGCCCCAGCAGG - Intergenic
950010712 3:9721793-9721815 GCTCCAGCTTCAGGCTCAGCTGG + Intronic
950403270 3:12787629-12787651 GTGCCAGCTCCAGGTGCAGCAGG + Intergenic
950426522 3:12927503-12927525 TGACCAGGTCCAGGCCCAGCCGG + Intronic
950572612 3:13811378-13811400 GACTCAGCCCCAGGCCCAGCAGG - Intergenic
952883195 3:37998111-37998133 TCGCCAACTCCAGGACCACCAGG - Exonic
952919914 3:38277095-38277117 GCCCCAGCTCCAGGTCCTGGAGG - Exonic
953023948 3:39134214-39134236 GCGCCAGCTCCAGCATCACCTGG - Exonic
953464368 3:43105930-43105952 GCGCCAGCTTCTGGCCCAGGAGG + Exonic
953589998 3:44242132-44242154 GCGCCAGGGCCAGGCGCGGCGGG + Exonic
954415039 3:50389145-50389167 GCCCCCGCCCCAGGCCCACCGGG - Intronic
956290325 3:67654344-67654366 GCGCCGGGTCCAGGCGCAGCAGG - Intronic
957079432 3:75623738-75623760 GTGGCAGCCACAGGCCCAGCAGG + Intergenic
960811601 3:121632148-121632170 GCCCCAGCCCCAGCCCCAGCCGG + Exonic
961449520 3:126996178-126996200 GCTCCAGCTCCAGGCCCCGCAGG - Intronic
961811282 3:129523260-129523282 CCAGCACCTCCAGGCCCAGCTGG + Intergenic
963814280 3:149812756-149812778 GCGCCAGGGCCAGGCCCGCCCGG + Exonic
963920145 3:150897530-150897552 GGGCCTGCTCCATGCACAGCTGG - Intronic
965404245 3:168250016-168250038 GCGCCACTTACATGCCCAGCCGG - Intergenic
966247667 3:177826539-177826561 GAGGCAGCACCAGGACCAGCTGG + Intergenic
966775660 3:183540892-183540914 GACCCTGCTCCAGGCCCAGAGGG - Intronic
967859749 3:194141724-194141746 GCCCCACCCCCAGGCCCGGCGGG - Intergenic
967947298 3:194814158-194814180 GCCCCTTCTCCAGGCCCAGAGGG - Intergenic
968451657 4:678831-678853 GGGCTGGCTCCAGGGCCAGCAGG + Intronic
968473726 4:793291-793313 ATGCCAGCTCCTGCCCCAGCAGG - Intronic
968742702 4:2339577-2339599 GCGTCAGCTCCTTGGCCAGCGGG + Exonic
968965951 4:3769215-3769237 GCTCCACCGTCAGGCCCAGCAGG + Intergenic
969022513 4:4147683-4147705 GTGGCAGCCACAGGCCCAGCAGG + Intergenic
969050496 4:4369600-4369622 GCCCCAGATCAAGGCCCGGCAGG + Intronic
969213919 4:5708397-5708419 GCGCCAGCTCACGTCCCCGCTGG - Exonic
969227429 4:5808034-5808056 GCCCCAGCTCCAGTCCCCACAGG - Intronic
969256846 4:6008133-6008155 GCGCCAGCTCCGCGGGCAGCTGG - Intergenic
969256901 4:6008379-6008401 GCTCCCGCACCAGGCCCAGCTGG + Intergenic
969611189 4:8228565-8228587 CCGCCAGGGCCCGGCCCAGCAGG + Exonic
970600728 4:17639266-17639288 GGCCCAGCTCCAGGCCCGGCTGG - Exonic
973590334 4:52434404-52434426 GCTCCAGCTCCAGGCCAGGGAGG - Intergenic
977693796 4:99946299-99946321 GCCCCAGCCCCAGGCCCGGTGGG - Intronic
979264519 4:118685579-118685601 GCGACAGCTCCTCGCGCAGCAGG + Exonic
980625600 4:135371427-135371449 GCTCCAACTCCAGGTGCAGCAGG + Intergenic
983985960 4:174060867-174060889 ACGCCAGCTCCAGCTCCAGCTGG - Intergenic
985005792 4:185534898-185534920 GCGCCAGCTCCAGGGAATGCCGG + Intronic
985533270 5:446262-446284 GCTCCAGCGCCCGGACCAGCTGG + Exonic
985574313 5:666449-666471 CCCCCAGCTCCCGGCGCAGCTGG - Intronic
985783655 5:1883349-1883371 GCGCCAGCGCGAGGCCGGGCCGG - Intronic
987201406 5:15581406-15581428 GCGGCAGCACCAGGCTAAGCAGG - Intronic
988110558 5:26813533-26813555 GCGATACCTCCAGGCGCAGCAGG + Intergenic
989146721 5:38257759-38257781 CCCCCTGCCCCAGGCCCAGCTGG + Intergenic
992671892 5:79069646-79069668 GCGCCTGCTCCGAGGCCAGCGGG + Exonic
994110382 5:95996318-95996340 GCGACAGCTTGAAGCCCAGCTGG - Intergenic
997319206 5:132963740-132963762 GCGTCGCCTCCCGGCCCAGCCGG - Intergenic
998096068 5:139396079-139396101 GCTCTTGCTCCAGGGCCAGCTGG - Intergenic
998417132 5:141954237-141954259 GCCCCATCCGCAGGCCCAGCCGG + Intronic
999715321 5:154355508-154355530 GGGCCAGGGCCAGGTCCAGCGGG + Intronic
1000337773 5:160254242-160254264 GGGCCAGCTCCATCCCCAGCGGG + Intronic
1001293969 5:170485794-170485816 GCCCCAGCCCCAGCCCCAGCTGG + Intronic
1002080632 5:176735207-176735229 GAGCTGGCTTCAGGCCCAGCTGG - Intergenic
1002140350 5:177133922-177133944 GCGCCCCCTCCCGGGCCAGCTGG - Exonic
1002278878 5:178119587-178119609 GCCACAGCCCCAGGCCCTGCTGG + Exonic
1002426003 5:179176356-179176378 CCCCCAGCTCCAGACCCCGCAGG + Intronic
1002942932 6:1733700-1733722 ACACCACCACCAGGCCCAGCTGG - Intronic
1006119374 6:31795028-31795050 GCCCCTGCTCCAGGGCCGGCAGG + Exonic
1006304672 6:33211829-33211851 GCGCCCCCTCCAGGCCCTCCTGG - Exonic
1006460261 6:34153983-34154005 GCGCCAGGTCCAGGACCACATGG + Intronic
1006465357 6:34190799-34190821 GCTCCAACTCCAGGTGCAGCAGG - Intergenic
1006502444 6:34467102-34467124 GCCCCAGCCCCTGGCACAGCTGG + Intronic
1006925527 6:37652260-37652282 GCTTCAGGTCCTGGCCCAGCTGG + Exonic
1007682638 6:43645116-43645138 ACGCCAGCTCCAGAGACAGCAGG - Exonic
1018642267 6:165915554-165915576 GACCCAGCTCCACTCCCAGCAGG - Intronic
1018792401 6:167158525-167158547 GGGCCCACTCCAGGCCCTGCTGG - Intronic
1019145055 6:169970988-169971010 GCCCCAGCTGCTGGCCAAGCAGG - Intergenic
1019297898 7:288826-288848 GCGACAGCTCCAGGCACCCCTGG + Intergenic
1019472666 7:1229735-1229757 GCGCGCGCGCCCGGCCCAGCCGG - Intergenic
1019619195 7:1981432-1981454 GCACCAGCTCCAGGGCCCGGGGG + Intronic
1020236643 7:6361037-6361059 GGGCCAGGCCCAGGCCCTGCTGG + Intergenic
1020278189 7:6637192-6637214 GCCCCGGCCCGAGGCCCAGCTGG + Intergenic
1021668622 7:23013518-23013540 GCTCCCGCCCCAGGCCCACCCGG + Intronic
1023405824 7:39833315-39833337 GCGGCACCCCCAGGCCGAGCCGG + Intergenic
1025819144 7:64946960-64946982 GAGCCGGCTAGAGGCCCAGCAGG - Intergenic
1026945514 7:74313588-74313610 TGGCCAGCTTCAGGCTCAGCTGG + Intronic
1027361789 7:77416569-77416591 GCGCCAGGACCAGGCCCGCCGGG + Intergenic
1029569755 7:101361844-101361866 GACCCTGCTCCAGGCCCAGGTGG - Intergenic
1031372885 7:120988718-120988740 GCGCCCGCTGCACGCCCGGCGGG - Exonic
1032223106 7:130009052-130009074 GGCCTAGCTCCAGGCCCAGGTGG + Intergenic
1032453082 7:132051505-132051527 GGGGCAGGTCCAGGCCCAGATGG + Intergenic
1032454843 7:132065498-132065520 GTGCCTGCTCCTGGTCCAGCTGG + Intergenic
1033110796 7:138573621-138573643 GTGCCATCTCCAGGCCTTGCAGG + Exonic
1034225479 7:149477675-149477697 GCTCCAGCTCCAGGAGCAGCAGG - Exonic
1034898665 7:154893900-154893922 TCGCCAGCTCCCAGCCCTGCGGG + Intronic
1035131339 7:156656865-156656887 CCACCAGCGCCAGGCCCTGCGGG - Intronic
1035266381 7:157692250-157692272 GCGCCCGCTCCCGGCCCCTCCGG + Intronic
1035714971 8:1747045-1747067 AGGCCAGATCCAGGCCCAGCTGG + Intergenic
1036453568 8:8890613-8890635 GCCTCATGTCCAGGCCCAGCAGG - Exonic
1036621471 8:10426969-10426991 GAGCCAGCAGAAGGCCCAGCAGG - Intronic
1036788784 8:11704283-11704305 GCGGAACCTCCAGGCCCAGCAGG + Exonic
1037579859 8:20238735-20238757 GGGCCAGCTCCAGGGAGAGCTGG - Intergenic
1037877423 8:22554821-22554843 GCGGCAGCTCAGGGCCCAGCAGG - Intronic
1038160341 8:25031228-25031250 GGTCCAGCTCCAGCTCCAGCTGG - Intergenic
1040278731 8:46026861-46026883 GCCCCTGCGCCAGGCCCAGGAGG - Intergenic
1040386497 8:46918107-46918129 CCGCCAGCTGCCGGCCCAGGGGG + Intergenic
1041390265 8:57341510-57341532 GAGCCTGCTCCACTCCCAGCTGG + Intergenic
1042560614 8:70070372-70070394 GCGACAGCTCCAGGCGCTCCTGG + Intronic
1043052747 8:75404085-75404107 GCTATTGCTCCAGGCCCAGCGGG + Intergenic
1043969624 8:86514829-86514851 GCGCGAGCGCCAGGCCCAGGCGG - Intronic
1044995990 8:97838649-97838671 GCCCCAGCTGCAGTCCCAACTGG - Intronic
1045290187 8:100826259-100826281 GCTCCAGCTCCAGCCCCAGCAGG - Intergenic
1046108168 8:109691405-109691427 GCACCGGCACCCGGCCCAGCCGG - Exonic
1048469963 8:134696791-134696813 GAGCCCGCTCCAGTCCCAGGAGG + Intronic
1048517059 8:135120744-135120766 GCTCCACCGCCAGGCCCAGTGGG - Intergenic
1049096322 8:140550401-140550423 GTGCCAGGTACGGGCCCAGCGGG - Intronic
1049180762 8:141220870-141220892 CCGGCAGCTCCGCGCCCAGCAGG + Intronic
1049356897 8:142193445-142193467 GTGCCAGCTTCAGGCCCACCTGG + Intergenic
1049532014 8:143159652-143159674 GCGCCGCCCCCAGGCCCACCCGG - Exonic
1049533132 8:143166388-143166410 TCCCCAGCTCCCGGCCCAGGAGG - Intergenic
1049592816 8:143470287-143470309 GCTCCTGCTCCTGCCCCAGCCGG - Intronic
1049605156 8:143525933-143525955 GGGCCAGTGCCAGGCCCAGGCGG - Intronic
1049657113 8:143803802-143803824 GCGACAGCTCCAGGCAGGGCCGG + Exonic
1049710546 8:144061073-144061095 GCCCCAGCTCCCGGCCCCGTGGG + Intronic
1049725237 8:144142721-144142743 GCACCAGCTCCAGCACGAGCCGG + Intergenic
1050402015 9:5266290-5266312 TCTCAAGCTTCAGGCCCAGCAGG + Intergenic
1054940857 9:70739896-70739918 GCATGAGCACCAGGCCCAGCTGG + Intronic
1055654816 9:78441634-78441656 GGGCCAGCTTCAGGAACAGCTGG - Intergenic
1056687423 9:88778120-88778142 GCCCAGGCTGCAGGCCCAGCTGG + Intergenic
1057271451 9:93653875-93653897 CCCCCAGATCCAGGTCCAGCTGG - Intronic
1057592803 9:96388305-96388327 GCGCCGGCTGCAGGAGCAGCGGG - Exonic
1057759912 9:97863609-97863631 GGCCCAGCTGCAGGCCCAGACGG - Intergenic
1057941158 9:99286153-99286175 GCTCCAGCTCCAGCTCCAGAAGG + Intergenic
1060602798 9:124889256-124889278 ACACCAGCTGCAGGCCGAGCTGG - Exonic
1060725157 9:126001484-126001506 GCACAGGCTCCAGGACCAGCTGG + Intergenic
1060766156 9:126296255-126296277 GCTCAAGCTCCAGGCCCTGCAGG + Intergenic
1060934736 9:127508427-127508449 GCACCCGCTCCAGGACCCGCTGG + Exonic
1060951802 9:127608656-127608678 GTCCCAGCGCCAGGGCCAGCCGG - Intergenic
1060965911 9:127712211-127712233 GCTCCAGCTGCAGGCTCAGCTGG - Exonic
1061134952 9:128728516-128728538 AGGCCAGGTCCAGGCCCTGCAGG + Intergenic
1061193679 9:129096084-129096106 CCTGCAGCTTCAGGCCCAGCAGG + Exonic
1061273685 9:129557877-129557899 GCGCCAGTGCTAGGCCCACCCGG + Intergenic
1061752846 9:132792725-132792747 GAGCCAGCGCCTGGACCAGCAGG - Exonic
1062069406 9:134547466-134547488 CCGGCAGCTCCAGGCCCGCCTGG + Intergenic
1062425344 9:136503670-136503692 GAGCCATCCCCAGGCCCTGCAGG + Intronic
1186768085 X:12791560-12791582 TGCCCAGCTCCAGGCCCAGGCGG - Exonic
1187098820 X:16171356-16171378 GCGCCAGGGCCAGGGCTAGCAGG + Exonic
1188360114 X:29242973-29242995 GGCCCCTCTCCAGGCCCAGCTGG + Intronic
1189336145 X:40172005-40172027 TCGCCAACCCCAGGCCCAGAGGG - Intronic
1190407958 X:50106249-50106271 GCGCCAGATCCAGGGCCACTTGG - Intergenic
1192316714 X:70057973-70057995 GCTACCGCTCCTGGCCCAGCCGG - Intergenic
1198420696 X:136468669-136468691 GTCCCAGATCAAGGCCCAGCAGG - Intergenic
1200105538 X:153710031-153710053 CCTCCAGCTGCCGGCCCAGCCGG - Intronic
1200827439 Y:7659092-7659114 GCCCCAGCTCCAGGACCCACAGG - Intergenic
1202197151 Y:22307687-22307709 GCGGCAGCAGGAGGCCCAGCAGG - Intergenic