ID: 1172702799

View in Genome Browser
Species Human (GRCh38)
Location 20:36863280-36863302
Sequence GCGGGTGCAGGCGCGGGCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 630
Summary {0: 1, 1: 0, 2: 6, 3: 53, 4: 570}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172702792_1172702799 -7 Left 1172702792 20:36863264-36863286 CCTCTCCGGGGCAGGCGCGGGTG 0: 1
1: 0
2: 1
3: 15
4: 180
Right 1172702799 20:36863280-36863302 GCGGGTGCAGGCGCGGGCTGGGG 0: 1
1: 0
2: 6
3: 53
4: 570
1172702785_1172702799 21 Left 1172702785 20:36863236-36863258 CCGGCGACGGCGCGCGGTGGCTC 0: 1
1: 0
2: 3
3: 38
4: 531
Right 1172702799 20:36863280-36863302 GCGGGTGCAGGCGCGGGCTGGGG 0: 1
1: 0
2: 6
3: 53
4: 570
1172702783_1172702799 26 Left 1172702783 20:36863231-36863253 CCGGGCCGGCGACGGCGCGCGGT 0: 1
1: 0
2: 1
3: 9
4: 107
Right 1172702799 20:36863280-36863302 GCGGGTGCAGGCGCGGGCTGGGG 0: 1
1: 0
2: 6
3: 53
4: 570

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172702799 Original CRISPR GCGGGTGCAGGCGCGGGCTG GGG Exonic
900118912 1:1040405-1040427 GCGCCTGCAGGTGCGGGGTGGGG + Intronic
900147938 1:1166538-1166560 GGGGGTGCAGGCGGGGGTGGGGG - Intergenic
900162883 1:1232608-1232630 GCGGGAGCAGGCGCGGCACGGGG + Exonic
900406151 1:2493921-2493943 GTGTGTGCAGGGGCGTGCTGTGG + Intronic
900610095 1:3541056-3541078 GTGGGGCCAGGCGCAGGCTGGGG + Intronic
900967262 1:5967320-5967342 GCGGGTGCAGGAGGGCTCTGGGG + Exonic
901050827 1:6425143-6425165 GCCGTTGCGGGCGCGGGCCGCGG - Exonic
901196236 1:7441526-7441548 ACTGGTGCAGGGGTGGGCTGCGG + Intronic
901269699 1:7942318-7942340 GCTGGGGCAGGCGTGGGCTGGGG + Intronic
901303700 1:8217412-8217434 CCGCGTGGAGGCGCCGGCTGCGG - Intergenic
901646173 1:10717952-10717974 GCGGGTGCAGGGACGGGCCGAGG + Intronic
901762661 1:11480662-11480684 GTGTGTGCACGCGCGCGCTGGGG - Intronic
902089583 1:13892864-13892886 CGGGGTGGCGGCGCGGGCTGGGG + Intergenic
902131338 1:14263636-14263658 GCGGGGGCAGGGTGGGGCTGGGG + Intergenic
902465192 1:16613217-16613239 GCGGGGGCGGGTGGGGGCTGTGG - Intronic
902630249 1:17700560-17700582 GCTGGAGCAGGTGCGGGCGGGGG + Intergenic
902889359 1:19430713-19430735 GCGGGTGCAGGTGCGGGTGCGGG - Intronic
903624285 1:24720118-24720140 GCGAGAGCAGGGGCCGGCTGTGG + Intergenic
904618879 1:31763906-31763928 GCGGGGGCCGGCGCTGGCGGGGG + Exonic
904772258 1:32886784-32886806 GCGGATGGAGGCGGGGGCTGGGG + Intronic
905553066 1:38859489-38859511 GCAGGGGCAGGCGGTGGCTGTGG - Exonic
905584341 1:39105329-39105351 GCGGCTGCAGCGGCGGGCGGCGG - Intronic
905639106 1:39576477-39576499 GCCGGGGCAGGCGCGGGGCGCGG + Intronic
905933204 1:41804239-41804261 GCAGGTACAGGCAGGGGCTGTGG - Intronic
908702846 1:66920667-66920689 GAGTGTGCAGGCGCTGGCAGGGG - Intronic
910237271 1:85048523-85048545 GCGGGAGGATGCGCGGGCGGCGG - Intronic
911096944 1:94062513-94062535 GGGGGTGCTGGAGTGGGCTGGGG - Intronic
911219736 1:95234168-95234190 GCCGGTGGAGGCGGCGGCTGCGG + Exonic
914490908 1:148149613-148149635 GTGGGGGCCGGCGCGGGGTGAGG - Intronic
914908067 1:151763074-151763096 GCCGGTGCAGGCGCGGCTTCCGG + Exonic
915235178 1:154475104-154475126 GGGGGTACAGGGGAGGGCTGAGG + Intronic
915637039 1:157194793-157194815 TGGGGTGCGGGCGCGGGCCGTGG + Intergenic
916890013 1:169105812-169105834 GCAGGTGCAGGAGCGGGAGGCGG + Exonic
919742662 1:200990227-200990249 GGGGCTGCAGGAGCTGGCTGAGG - Exonic
919929920 1:202214424-202214446 GCGCGGGCAGGGGCGGGCAGGGG + Intronic
922221117 1:223609287-223609309 GTAGGTGCTGGTGCGGGCTGAGG + Exonic
922496524 1:226062287-226062309 GCGGGTGAACGCCCGGCCTGCGG - Intronic
922831689 1:228557586-228557608 CCGGGTGAAGGGGCGGGCAGGGG - Intergenic
923631160 1:235650110-235650132 GGGGGCGCGGGCCCGGGCTGGGG - Intronic
924383469 1:243483395-243483417 GCGGGAGCAGGGGCGGGTCGCGG - Intronic
924775200 1:247111441-247111463 GCGGGCGCAGGGCCGGGCTACGG + Exonic
924778401 1:247126821-247126843 GGGGCTGCGGGCGCGGGCCGGGG - Intronic
924783257 1:247171599-247171621 GGGGCTGCGGGCGCGGGCCGGGG + Intronic
924893111 1:248306421-248306443 GCGGGTGCTGGAGCCGCCTGAGG + Intergenic
1063380757 10:5584079-5584101 GGAGGCGCAGGCGCAGGCTGGGG - Intergenic
1064167883 10:13001831-13001853 GCGGGTCCCGGCGCCGGCTGGGG + Intronic
1065022322 10:21510377-21510399 GGGGCTGCTGGCGCGGGCTAGGG - Intergenic
1065099100 10:22316304-22316326 GCTGGCGGCGGCGCGGGCTGCGG - Exonic
1065520575 10:26567297-26567319 GCGGGCGCGGGCGCGGGCGGCGG - Exonic
1067047539 10:42992965-42992987 GGGGGTGCTGGCGCAGGCTGAGG - Intergenic
1071086828 10:81875248-81875270 GCGGGCGCGGGCGCGGGCTCCGG - Intergenic
1071695113 10:87862619-87862641 GCGGGCGCAGGAGAGGCCTGCGG + Exonic
1072206136 10:93206834-93206856 GCGGCTGCACGCGCGGCCTCTGG + Intergenic
1073060210 10:100729492-100729514 GCGGGGGCAGGGGTGGGGTGGGG - Intergenic
1073287761 10:102398828-102398850 GGGGGTGCAGCCGGGGGCTACGG + Exonic
1074532308 10:114305860-114305882 GCGGGTGCAGGAGGGGGCGCAGG + Intronic
1074761542 10:116670330-116670352 GCGGGAGGAGGCGAGGCCTGGGG + Intergenic
1076374052 10:129971881-129971903 GCGGGAGGAGGAGCGGGCTCTGG - Intergenic
1076670357 10:132117605-132117627 GAGGGTGCAGGGGCGGGCGTGGG + Intronic
1076670366 10:132117629-132117651 GAGGGTGCAGGGGCGGGCGTGGG + Intronic
1076670373 10:132117653-132117675 GAGGGTGCAGGCGTGGGCTCGGG + Intronic
1076993922 11:289320-289342 GCTGGGGCAGGCGCGGGTGGGGG - Intronic
1077024267 11:432334-432356 GTGGTTGCAGGTGCGGGCTGTGG - Intronic
1077154914 11:1086995-1087017 GCGGGTGCAGGTGCGGGTCTGGG - Intergenic
1077419743 11:2444739-2444761 GGGGGCGCAGGCGGGGGCGGGGG + Intronic
1077923105 11:6655891-6655913 GCGGGTGGGGGCGGGGGCGGGGG - Intergenic
1078421871 11:11219272-11219294 GCAGCTGCAGGATCGGGCTGTGG + Intergenic
1078474989 11:11622217-11622239 GCCTGTGCAGGCGCGGGTGGAGG - Intergenic
1080779677 11:35419078-35419100 GCGGGTGGAAGGGCGGGCAGAGG - Exonic
1081733886 11:45390546-45390568 GCCCGTGCAGGGGCTGGCTGAGG - Intergenic
1081994580 11:47355202-47355224 GCGGGGCCCGGCGGGGGCTGCGG + Exonic
1082076603 11:47980421-47980443 GCGGGGGCAGCGGCGGGCGGCGG + Intergenic
1082996887 11:59262157-59262179 GGTGCTGCAGGCGGGGGCTGGGG - Intergenic
1083272956 11:61581189-61581211 GCGGGCGCAGGCGGTGGCTGTGG - Intergenic
1083317843 11:61827629-61827651 GCGGGTGGACCGGCGGGCTGCGG - Intronic
1083325033 11:61868958-61868980 GGGGAAGCAGGCGGGGGCTGAGG - Intergenic
1083621600 11:64051990-64052012 GGGGGTCCAGGCGAGAGCTGGGG + Intronic
1083684543 11:64368606-64368628 GAGGGCCCAGGCGCGGGCAGGGG + Intronic
1083697660 11:64453472-64453494 GAGGGGGCAGGAGGGGGCTGGGG + Intergenic
1083741602 11:64714215-64714237 GAGGGTGAGGGAGCGGGCTGAGG - Intronic
1083933271 11:65857564-65857586 GCGGGTGCTGGCGCGGCGAGGGG - Intronic
1084072356 11:66744715-66744737 GCGGGCGCAGGCGCGCGCGCGGG + Intronic
1084161713 11:67353711-67353733 GCGGGAGGAGGGGCAGGCTGGGG + Intronic
1085261054 11:75204943-75204965 GCGAGTGCAGACCTGGGCTGGGG - Exonic
1085535038 11:77212523-77212545 GCGGGTGGAGGAGGGGTCTGAGG + Intronic
1087146887 11:94821660-94821682 GAGGCGGCAGGCGGGGGCTGTGG - Exonic
1087634508 11:100687456-100687478 GCGAGCGCAGGCGCGGGCGGCGG - Intergenic
1089169277 11:116500853-116500875 GCGGGTGCACGCGGGGGCCGGGG - Intergenic
1089273363 11:117316132-117316154 GCGGGCGGCGGCGCGGGCAGGGG + Exonic
1091286767 11:134412297-134412319 GCCGGCGCTGGCGCGGGCTCGGG - Intergenic
1091649304 12:2298045-2298067 GAGGGTCCAGGCAAGGGCTGTGG + Intronic
1092184840 12:6471037-6471059 GCGAGTCCCGGCGCGGGGTGGGG - Intergenic
1092204389 12:6606671-6606693 GCTGGTGCAAGCGCGGGGAGGGG + Intronic
1094495686 12:30987984-30988006 GCGGCTGCAGGCTGGGGCAGAGG + Intronic
1096258866 12:50078716-50078738 GGGGGTGCAGGCGGGAACTGAGG - Intronic
1096461072 12:51821674-51821696 GGCGGTGCCGGCGCGGGCAGGGG + Intergenic
1096647588 12:53047181-53047203 GCGGGCGCGGGCGCGGGGCGCGG + Intronic
1096710468 12:53452133-53452155 GCGGGAGAGGGCGCAGGCTGCGG - Exonic
1096774795 12:53957280-53957302 GCGGGATCAGGAGAGGGCTGGGG - Exonic
1096789124 12:54034190-54034212 GCGGGTGGGGGCCTGGGCTGGGG + Intronic
1096878144 12:54646260-54646282 GAGGGTGCAGGTGTGTGCTGTGG + Intronic
1096993271 12:55822065-55822087 GCGGCTCCAGGGGCAGGCTGAGG + Exonic
1097180091 12:57166924-57166946 GGGGGGGCAGGTGCGGGCTGGGG - Exonic
1097232953 12:57523117-57523139 GCGGGGGCAGGTGAGGGCGGGGG - Intronic
1098255437 12:68611094-68611116 GCGGGGCCGGGCGCCGGCTGAGG + Intronic
1099956083 12:89353623-89353645 GCGGCGGCAGGAGAGGGCTGGGG - Intergenic
1101680017 12:106955811-106955833 GCGGGAGGAGGCGGGAGCTGAGG + Exonic
1101731593 12:107431609-107431631 GCGGGTGCGGGGGCGGGTAGTGG - Intronic
1101963611 12:109267446-109267468 GAGGGTGCATGCGCAGGCTGGGG - Exonic
1102029029 12:109729449-109729471 GGCGGTGAAGGCGCTGGCTGGGG - Intronic
1102243706 12:111341853-111341875 GGGGCTGCAGGCAGGGGCTGGGG - Exonic
1103348348 12:120265742-120265764 GCGGGCGCGGGCGCGCGCGGCGG - Exonic
1103392467 12:120584564-120584586 GAGGGTGCAGACGCCGGCGGTGG + Intergenic
1103736899 12:123066322-123066344 GCTGGTGCAGGCAGGGGCAGAGG + Intronic
1103800319 12:123533632-123533654 GCGGGCGCGGGCGCGGGCACGGG + Exonic
1103800321 12:123533638-123533660 GCGGGCGCGGGCACGGGCGGCGG + Exonic
1103909849 12:124346218-124346240 GAGGGTCCAGGTGCGGCCTGAGG - Intronic
1103918432 12:124387712-124387734 GCTGCTGCTGGCGCGGGCGGAGG - Intronic
1103994007 12:124817509-124817531 GAGGGTGGAGGGGCCGGCTGAGG - Intronic
1104846880 12:131851357-131851379 GGAGGTGCTGGCGCGGGATGAGG + Exonic
1105539846 13:21306929-21306951 GCTGGAGCAGGCTCTGGCTGAGG + Intergenic
1105752402 13:23433557-23433579 GCAGCTGCAGGAGCGGCCTGGGG - Intronic
1105890721 13:24680716-24680738 GCTGGTGGCGCCGCGGGCTGCGG - Exonic
1107467548 13:40664828-40664850 GCGGGGGCGGGCGCGGGCGGTGG - Intronic
1108542073 13:51453637-51453659 GCGCGAGCGGGCGCGGGCGGGGG + Intronic
1109548467 13:63860432-63860454 GCGGGTGTAGGTACTGGCTGTGG - Intergenic
1110596483 13:77326401-77326423 GCGGGTGCACGCGCGGCATGGGG + Intronic
1112402079 13:99086368-99086390 GCGGGAGCAGGCGGAGGCGGAGG - Intronic
1113626740 13:111853329-111853351 GCGCGTCCTGGAGCGGGCTGGGG + Intergenic
1113661275 13:112107855-112107877 GCGGGTGCAGGAGAGGCCTTGGG - Intergenic
1113709682 13:112455109-112455131 GGGGGTGCAGGGGCCGCCTGAGG + Intergenic
1113743265 13:112725387-112725409 GCTGGTGCATGCCCGGGCAGTGG - Intronic
1113799502 13:113079023-113079045 GCGGGTGGAGGCTCTTGCTGGGG - Intronic
1113874260 13:113584802-113584824 GCGCGGAGAGGCGCGGGCTGGGG - Exonic
1113907041 13:113824214-113824236 TCGGGAGCACGCGCGGTCTGGGG + Intronic
1113907054 13:113824278-113824300 TCGGGAGCACGCGCGGTCTGGGG + Intronic
1113913761 13:113857917-113857939 GCGGGCACAGGAGAGGGCTGCGG + Intronic
1113945120 13:114039650-114039672 GCTGGTGCAGGCTTGGGCTCCGG + Intronic
1113976967 13:114234985-114235007 GCGGCTGCAGGCACGGGCACGGG + Exonic
1114492258 14:23110564-23110586 GTGGGTTCAAGCGCGTGCTGAGG - Intergenic
1117374430 14:55107957-55107979 GAGGCTGCAGGCGTGAGCTGGGG + Intergenic
1119519998 14:75278421-75278443 GCGGGGGGAGGCGGGGGCCGCGG - Intergenic
1121437150 14:93927494-93927516 GCGGGTGTGGGGGCAGGCTGGGG + Intronic
1121453899 14:94026609-94026631 GCGGGTGCACCCGCGGGACGGGG + Intronic
1121645872 14:95516720-95516742 GCGGGTCCCGGCGGGGGCGGGGG - Intronic
1121648171 14:95535183-95535205 GCGGGCTCGGGCGCGGGCGGCGG + Exonic
1122153251 14:99735845-99735867 GCGGGTGGAGCAGCGTGCTGGGG - Intergenic
1122445040 14:101761841-101761863 GCGGGGGCAGGCGGCGGCAGGGG + Exonic
1122620824 14:103056928-103056950 GCGTGGGGATGCGCGGGCTGGGG + Intronic
1122648029 14:103207758-103207780 GCGAGCGCCTGCGCGGGCTGTGG + Intergenic
1122718962 14:103711730-103711752 GCTGGGCCAGGCTCGGGCTGTGG - Exonic
1122719895 14:103716090-103716112 GCGGGGGCGGGGGCCGGCTGGGG - Intronic
1122774226 14:104110151-104110173 CCGGGTGCAGGTGGTGGCTGGGG + Intronic
1122786483 14:104166520-104166542 GCGGCTGCAGGTGGGGGATGAGG + Intronic
1122804111 14:104248045-104248067 GGGGGTGCTGGAGAGGGCTGGGG + Intergenic
1122828438 14:104383578-104383600 CCCGGTGCAGGTGGGGGCTGGGG - Intergenic
1122883342 14:104699831-104699853 GCTGGTGAGGGCCCGGGCTGGGG + Intronic
1122975180 14:105168130-105168152 GCGGAGGGAGGCGCGGGCCGGGG + Intronic
1123131188 14:105986847-105986869 GCTGGTGCAGTCTGGGGCTGAGG - Intergenic
1123184884 14:106507261-106507283 GCTGGTGCAGTCTGGGGCTGAGG - Intergenic
1123185340 14:106511380-106511402 GCTGGTGCAGTCTGGGGCTGAGG - Intergenic
1123206102 14:106714947-106714969 GCTGGTGCAGTCTGGGGCTGAGG - Intergenic
1123211186 14:106762357-106762379 GCTGGTGCAGTCTGGGGCTGAGG - Intergenic
1202899787 14_GL000194v1_random:28386-28408 GCCGGCGCAGGCGCGGGGGGCGG - Intergenic
1123581420 15:21718073-21718095 GCTGGTGCAGTCTGGGGCTGAGG - Intergenic
1123618069 15:22160696-22160718 GCTGGTGCAGTCTGGGGCTGAGG - Intergenic
1124248728 15:28094254-28094276 GAGAGTGCAGCCACGGGCTGGGG - Intronic
1124427031 15:29570902-29570924 GCGGGCACCGGCGGGGGCTGCGG - Intergenic
1124640021 15:31391594-31391616 GCGGGGGCGGGGGCGGGGTGGGG - Intronic
1124640355 15:31392810-31392832 GCGGGGGCGGGGGCGGGGTGGGG - Intronic
1125677643 15:41511403-41511425 GCAGGTGAGGGCGCGGGCCGCGG - Exonic
1125730876 15:41892295-41892317 GCTGGTGCAGGGGTGGGGTGGGG - Intronic
1126348356 15:47718826-47718848 GCGGCTGCCGGCGCGAGCGGCGG - Exonic
1128061871 15:64740513-64740535 GTGGGTGCAGGGGCGGGGCGAGG + Exonic
1128144817 15:65327202-65327224 GCTGGGGCAGGAGGGGGCTGGGG - Exonic
1128967776 15:72077644-72077666 GCGGGGGGCGGCGCGGGCAGAGG + Intronic
1129274087 15:74434015-74434037 GCGGGGGGAGGGGCGGGGTGGGG - Exonic
1129468499 15:75737688-75737710 GCGGGGGCGGGGGCGGGGTGGGG + Intergenic
1129676047 15:77632838-77632860 GCGGGAGCCGGAGCGGGCGGCGG - Intronic
1129711818 15:77824250-77824272 GAGGGTGCAGGTGAGGTCTGGGG - Intergenic
1129759513 15:78121354-78121376 AGGGGTGCAGGCCAGGGCTGTGG + Intronic
1129948242 15:79560596-79560618 GCGCGGGGAGGCGCGGGCCGGGG + Intergenic
1130295726 15:82646440-82646462 GGGGCTGCAGGCGCGGGGCGGGG + Intronic
1130656497 15:85795042-85795064 CCCGGTGCCGGCGCGGCCTGGGG - Intergenic
1130938868 15:88491413-88491435 GTCAGTGCAGGTGCGGGCTGAGG + Intergenic
1132460905 16:54059-54081 GTGTGTGCGGGCGGGGGCTGGGG + Intronic
1132476104 16:138728-138750 GCAGGCGCAGGCGCAGGCAGCGG + Intronic
1132589737 16:721427-721449 GCGGCTGCAGGTGCGGGGCGGGG + Exonic
1132678226 16:1129446-1129468 GCAGGGGCAGGCCCGGGCGGAGG - Intergenic
1132744907 16:1432541-1432563 GGGGCAGCAGGCGCTGGCTGGGG - Intergenic
1132803106 16:1763780-1763802 GCAGGTGCGGGCGGGCGCTGCGG + Exonic
1132805363 16:1772761-1772783 GCGGCTGCAGGGGCGGGGTGCGG + Intronic
1132915210 16:2340396-2340418 GCGGGCGCGGGCGCGGCCGGAGG + Intronic
1132973939 16:2702260-2702282 GCGGTGGCAGGCGCGTCCTGAGG + Intronic
1133212687 16:4272173-4272195 GCGGCTCCCGGCGCGGGGTGGGG - Intronic
1133328624 16:4957808-4957830 GAAGGTGCATGCGCGGGCCGTGG + Intronic
1134072449 16:11269179-11269201 GCGGGTGCAGGTGCGGCTTTGGG + Exonic
1134566726 16:15258056-15258078 GCGGGGGCAGGAGGGGGCAGGGG - Intergenic
1134656130 16:15949682-15949704 CCGGTTGCTGGCGCGGGCGGCGG - Exonic
1134735767 16:16498643-16498665 GCGGGGGCAGGAGGGGGCAGGGG + Intergenic
1134931759 16:18213579-18213601 GCGGGGGCAGGAGGGGGCAGGGG - Intergenic
1136365393 16:29806972-29806994 GGGGGCGCCGGCGCGGCCTGCGG - Exonic
1136458492 16:30395611-30395633 GCAGGTGCAGGGGCGGCCGGCGG + Intronic
1136517356 16:30775943-30775965 GCTGGTGGAAGCGCGGGCCGCGG + Exonic
1136550412 16:30979738-30979760 GCGGGTGCGGGCACTGGCTCCGG - Exonic
1136693971 16:32059233-32059255 GCTGGTGCAGTCTGGGGCTGAGG + Intergenic
1136707753 16:32202875-32202897 GGGGGGGCCGGCGCGGGGTGAGG - Intergenic
1136760156 16:32726536-32726558 GGGGGGGCCGGCGCGGGGTGAGG + Intergenic
1136794463 16:33002482-33002504 GCTGGTGCAGTCTGGGGCTGAGG + Intergenic
1136807948 16:33143850-33143872 GGGGGGGCCGGCGCGGGGTGAGG - Intergenic
1136875446 16:33851898-33851920 GCTGGTGCAGTCTGGGGCTGAGG - Intergenic
1137665473 16:50246627-50246649 GTGGGCGCAGGACCGGGCTGTGG + Intronic
1137707934 16:50548340-50548362 GCGCGGGGAGGCGCGGGCCGCGG + Exonic
1138383131 16:56617426-56617448 GCGGGTGCAAGCGCGGGGCGGGG + Intergenic
1138385363 16:56632579-56632601 GCGGGTGCAAGCGCGGGGCAGGG + Exonic
1138385938 16:56635665-56635687 GCGGGTGCAAGCGCGGGGCAAGG + Intergenic
1139365190 16:66428284-66428306 GCGGGTGCCGGCGTGGGTGGCGG + Intronic
1139705338 16:68737374-68737396 GCGAGGGCAGGCGCCGGGTGCGG - Exonic
1140409553 16:74733821-74733843 GCGGGGGCAGGCGGGGGACGGGG - Intronic
1141097154 16:81170993-81171015 GAGGGTGCAGGAGCTGGCCGAGG - Intergenic
1141657524 16:85423999-85424021 GTGGATGCAGGTGAGGGCTGAGG - Intergenic
1141662482 16:85448959-85448981 GCGGGTGGAGGGGCGGGGAGAGG - Intergenic
1141708518 16:85683501-85683523 GAGGCTGCAGGAGCAGGCTGTGG - Intronic
1142142778 16:88479887-88479909 GTGGGTGAAGGCCAGGGCTGGGG - Intronic
1142163231 16:88570288-88570310 GCGGGTCCGGGCGCGCGCTGCGG + Intergenic
1203096727 16_KI270728v1_random:1264149-1264171 GCTGGTGCAGTCTGGGGCTGAGG + Intergenic
1142715628 17:1745464-1745486 GGGGGTGGGGGCGCGTGCTGAGG + Intronic
1142855036 17:2724485-2724507 GAGGCGGCTGGCGCGGGCTGCGG + Intergenic
1142855145 17:2724932-2724954 GCAGCTGGAGGCGCGTGCTGCGG - Intergenic
1143139573 17:4733733-4733755 GAGGATGCAGGAGAGGGCTGAGG + Exonic
1143518043 17:7429833-7429855 GCGGGTCCAGGGGTGGGTTGGGG - Intergenic
1143520169 17:7440226-7440248 ACCGGGGCAGGCGGGGGCTGGGG - Intronic
1143779262 17:9220916-9220938 GTGGTTGCAGGCGGTGGCTGAGG + Intronic
1143876740 17:9997242-9997264 GCGGGTGGGGGCGGGGGCGGTGG + Intronic
1143965452 17:10753653-10753675 GCAGGGGCAGGCAAGGGCTGGGG + Intergenic
1144520253 17:15948192-15948214 GCGGTGGCAGGTGGGGGCTGTGG - Intronic
1144767051 17:17738525-17738547 GCGGGTGAAGGCGGGGGCAGAGG + Intronic
1144855249 17:18263951-18263973 CGGGCTGCAGGCGGGGGCTGCGG + Exonic
1145749519 17:27345199-27345221 GGGGGTGCAGGTGGGGGCAGGGG - Intergenic
1146179380 17:30687547-30687569 GTGGGGGCAGGCGCGGGGCGGGG - Intergenic
1146371108 17:32266040-32266062 ATGGGGGCGGGCGCGGGCTGCGG + Intergenic
1147006375 17:37407048-37407070 GGGGGAGGAGTCGCGGGCTGCGG + Intronic
1147193433 17:38749795-38749817 GTGGCTGCAGGCTCGAGCTGGGG - Exonic
1147402863 17:40191544-40191566 GCGGGGTCAGGGGCGGGCGGCGG - Intronic
1147415712 17:40288069-40288091 GCGGGTTCCGGCGAGGCCTGAGG + Exonic
1147419284 17:40314172-40314194 GCGGGTGGAGGGGTGGGGTGGGG + Intronic
1148166929 17:45490405-45490427 GGGGATGCGGGCGCGGGCTGGGG + Intronic
1148553501 17:48564420-48564442 GCGGGGGCGGGGGCGGGGTGGGG - Intronic
1148687017 17:49506688-49506710 GGGGGTGCGGGGGTGGGCTGGGG + Intronic
1148722520 17:49763977-49763999 GGGGGAGCCGGCGGGGGCTGGGG + Exonic
1148749369 17:49935702-49935724 CCGGGTGGAGGCGTGGGGTGGGG + Intergenic
1148793188 17:50184986-50185008 GGGCGGGCAGGAGCGGGCTGAGG + Exonic
1148853267 17:50565027-50565049 GCGGGAGCAGGCGAGGGTGGGGG - Intronic
1148880256 17:50719875-50719897 AGGGGAGCGGGCGCGGGCTGTGG + Intronic
1149449376 17:56737968-56737990 GAGGTAGCAGGCGCTGGCTGTGG - Intergenic
1149626521 17:58083925-58083947 GCTGCTGGAGGCCCGGGCTGCGG + Intronic
1150398108 17:64836809-64836831 GGGGATGCGGGCGCGGGCTGGGG + Intergenic
1151296908 17:73192829-73192851 GCGGGGGCGGGCGCGGGCGCGGG - Intronic
1152040876 17:77901881-77901903 CTGGGTGCAGGAGTGGGCTGGGG + Intergenic
1152175161 17:78782349-78782371 GCGGGCGCAGGCGCAGGCGCGGG - Intergenic
1152223483 17:79081961-79081983 GCGGATGCTGGGGCAGGCTGGGG + Exonic
1152362556 17:79839391-79839413 GCCGGGGCGGGCGCGGGCAGCGG - Exonic
1152524439 17:80879443-80879465 GCAGGTCCAGGCCCGGGATGTGG - Intronic
1152744169 17:82031572-82031594 GCGGGGGCGGGGGCGGGCGGGGG - Intergenic
1153006282 18:500820-500842 GCGAGGGCAGGCGCGGGCCGAGG - Intergenic
1153027015 18:681298-681320 GCAGGTCCAGGCGGGGGCAGTGG - Intronic
1153480490 18:5543111-5543133 GCGGGAGCACGGGCGGGCCGGGG - Intronic
1153565670 18:6414926-6414948 GAGGGTGCACGCGCGGGGTGGGG + Intronic
1154279710 18:12991544-12991566 CCGGGTGGGGGCGCAGGCTGTGG + Intronic
1157609980 18:48950165-48950187 GCGGGCGCCGGCGCGGCCGGGGG - Exonic
1158259098 18:55588115-55588137 GCGGGCGCAGGAGCAGGCGGCGG - Intronic
1158931026 18:62325237-62325259 GCGGGGGCAGGTGCGGGGCGGGG + Intergenic
1159511303 18:69400957-69400979 GCTGGCGGAGGCGCGGGCCGCGG + Intergenic
1160353973 18:78210699-78210721 ACAGGTGAAGGCGCGGGCCGAGG + Intergenic
1160745408 19:709032-709054 GCGGGGGCCGGGGCGGGCTAAGG - Intergenic
1160769123 19:822371-822393 GCGGGCGGAGGCGCGGGGCGGGG - Intergenic
1160838936 19:1137480-1137502 GTGGGGGGAGGCTCGGGCTGGGG + Intronic
1160838969 19:1137554-1137576 GTGGGGGGAGGCTCGGGCTGGGG + Intronic
1160838981 19:1137581-1137603 GTGGGGGGAGGCTCGGGCTGGGG + Intronic
1160838993 19:1137608-1137630 GTGGGGGGAGGCTCGGGCTGGGG + Intronic
1160839004 19:1137635-1137657 GTGGGGGGAGGCTCGGGCTGGGG + Intronic
1160839015 19:1137662-1137684 GTGGGGGGAGGCTCGGGCTGGGG + Intronic
1160839045 19:1137733-1137755 GTGGGGGGAGGCTCGGGCTGGGG + Intronic
1160839057 19:1137760-1137782 GTGGGGGGAGGCTCGGGCTGGGG + Intronic
1160839069 19:1137787-1137809 GTGGGGGGAGGCTCGGGCTGGGG + Intronic
1160839111 19:1137885-1137907 GTGGGGGGAGGCTCGGGCTGGGG + Intronic
1160839123 19:1137912-1137934 GTGGGGGGAGGCTCGGGCTGGGG + Intronic
1160839135 19:1137939-1137961 GTGGGGGGAGGCTCGGGCTGGGG + Intronic
1160839146 19:1137966-1137988 GTGGGGGGAGGCTCGGGCTGGGG + Intronic
1160839176 19:1138037-1138059 GTGGGGGGAGGCTCGGGCTGGGG + Intronic
1160839188 19:1138064-1138086 GTGGGGGGAGGCTCGGGCTGGGG + Intronic
1160839200 19:1138091-1138113 GTGGGGGGAGGCTCGGGCTGGGG + Intronic
1160839212 19:1138118-1138140 GTGGGGGGAGGCTCGGGCTGGGG + Intronic
1160839242 19:1138189-1138211 GTGGGGGGAGGCTCGGGCTGGGG + Intronic
1160904517 19:1446094-1446116 GGGGGTGCTCGCGGGGGCTGGGG - Intergenic
1160966855 19:1750493-1750515 GCGGGTGGAGGGGAGGACTGGGG - Intergenic
1160976839 19:1796889-1796911 GCGGGGGCACGGGCCGGCTGTGG + Intronic
1160994677 19:1877131-1877153 GTGGGGGCCGGCGCGGGGTGAGG + Exonic
1161075933 19:2285789-2285811 GAGGGTGCCGGCATGGGCTGGGG + Intronic
1161170146 19:2808445-2808467 GTGGGTGCGGGCCCGGGCAGGGG + Intronic
1161287986 19:3478651-3478673 GCGGGTGCAAGCCCGGGATCTGG + Intronic
1161337352 19:3721729-3721751 GCAGGTGCAGCCGGGAGCTGCGG + Exonic
1161358186 19:3831430-3831452 GAGCCTGCAGGCGCGGGCGGCGG + Exonic
1161393771 19:4034249-4034271 GCGGGAGCAGGCCCTGCCTGTGG + Intronic
1161509530 19:4662865-4662887 GCTGGTGCAGGTCTGGGCTGGGG - Intronic
1161579557 19:5073341-5073363 GGGGATGCAGGCGCAGCCTGGGG + Intronic
1161795953 19:6386988-6387010 GCGGGTGCAGTTAAGGGCTGTGG - Intronic
1162506773 19:11090392-11090414 GCGGGGGCAGGGGCGGGAGGGGG - Intronic
1163146262 19:15380695-15380717 GTGGGTGCAGGGGCGGGGTGGGG - Intronic
1163314979 19:16535558-16535580 GCGGGGGCCAGCGGGGGCTGTGG + Exonic
1163659653 19:18569042-18569064 GTGGGTGCGGGGGTGGGCTGGGG - Exonic
1163727214 19:18929535-18929557 GCGGGAGCGGGCGCGGGCTGAGG - Exonic
1165058658 19:33194490-33194512 GCGGGGGCAGCGGCGGGCGGGGG + Intronic
1165065465 19:33225818-33225840 GCGGGCGCATGCGCTGGCTCCGG + Exonic
1165089263 19:33374034-33374056 GAGGCTGGAGGCGCGGGCGGCGG + Intronic
1165313483 19:35041673-35041695 GCGGGTGAAGGGGCGGGGAGGGG - Intronic
1165772034 19:38385712-38385734 GCGGGTGCGGGCGCGGACACAGG + Exonic
1165893439 19:39128001-39128023 GTGGGAGCAGGGGAGGGCTGAGG + Intronic
1165939888 19:39409771-39409793 GCGGGGGCGGGCGCGGGGCGGGG + Intergenic
1166118020 19:40667586-40667608 GCTGGGGCAGGCGCTGGCTCAGG + Exonic
1166389622 19:42401825-42401847 GCGGGGGTAGACGGGGGCTGCGG - Exonic
1166827084 19:45616422-45616444 CGGGGTGGCGGCGCGGGCTGGGG + Intronic
1166871318 19:45872756-45872778 GGGGCTGGAGGCGGGGGCTGGGG - Exonic
1166943467 19:46383239-46383261 GCGGGAGCAGGCGGGGCCGGAGG - Intronic
1167115045 19:47484183-47484205 GCGGGTTGGGGCGGGGGCTGCGG - Exonic
1167381878 19:49142979-49143001 GCGGGAGGAGGCGGGGGCTGAGG - Exonic
1167551346 19:50163032-50163054 GCAGCTGCAGGCGCGCGCCGGGG - Exonic
1168297412 19:55384177-55384199 GCGGGTGCTGGCGCGGCCGCCGG + Exonic
1168452453 19:56477128-56477150 GCGGGTGCTTGCGTGGGCGGTGG - Intronic
1168685670 19:58347713-58347735 GCAGGCGCGGGCGCGGCCTGGGG - Intronic
925298894 2:2795949-2795971 GAGGGTGCAGTCGCTGCCTGAGG - Intergenic
926055842 2:9773478-9773500 GCGGGTGCAGGAGCTGGAGGGGG - Intergenic
926154822 2:10448057-10448079 GCGGGAGCCGGGGCGGGCTGCGG - Intronic
927561486 2:24076922-24076944 GCGGGCGAAGGCGGGGCCTGAGG + Intronic
927652286 2:24920032-24920054 GCGGGTGCAGGGGAGGGGTCCGG - Intergenic
927652439 2:24920453-24920475 GCGGGCGCGGGCGCGGGCGTGGG + Intergenic
927652441 2:24920459-24920481 GCGGGCGCGGGCGTGGGCGGTGG + Intergenic
927988344 2:27429034-27429056 GCGGGTGGGGGCGGGGGCGGGGG + Intronic
928757884 2:34547535-34547557 GTGTGTGCAGGTGCTGGCTGTGG + Intergenic
931253828 2:60554054-60554076 GAGGCTGCAGCCCCGGGCTGGGG + Intergenic
932329448 2:70889362-70889384 GGGGGTGCGAGCGCGGGCTGGGG - Intergenic
932345829 2:70994651-70994673 GCGGGAGCCCGCGCGGGCCGGGG + Intronic
932780214 2:74554640-74554662 GCGGCTGCCGGCGGGGGCCGGGG + Exonic
934588245 2:95525319-95525341 GCGGCCGGAGGCGTGGGCTGGGG - Intergenic
935820164 2:106886458-106886480 GCAGCTGCAAGCGCGGGCGGCGG + Exonic
936145107 2:109975648-109975670 GAGGGTGCAGGCCCTGGGTGAGG + Intergenic
936199578 2:110395830-110395852 GAGGGTGCAGGCCCTGGGTGAGG - Intergenic
936412263 2:112271113-112271135 GCGGGTGATGGCGGTGGCTGAGG + Intergenic
936433256 2:112482215-112482237 GCGGTAGCCGGCGCGGGCGGCGG + Exonic
937045286 2:118848021-118848043 GCGGGTGCGGGCGCGGGTGGGGG - Intergenic
937208636 2:120253009-120253031 GCGGGGTGGGGCGCGGGCTGGGG + Intronic
937221746 2:120346068-120346090 GCGGGCGCGGGCGCGGGCGGGGG + Intergenic
937914629 2:127092840-127092862 GGGGGTGCAGGCGTGGGCTGTGG - Intronic
938066015 2:128282482-128282504 GCGGGTGCAGAGCTGGGCTGCGG + Intronic
938610769 2:132945284-132945306 GCGGGGGCAGGGGTGGGGTGGGG + Intronic
941020932 2:160407550-160407572 GCGGGTGCGGGCGCGGGCGCGGG + Intronic
941020934 2:160407556-160407578 GCGGGCGCGGGCGCGGGCGCGGG + Intronic
941808624 2:169734155-169734177 GCGGGGCCGGGCGCGGGCAGCGG + Intronic
942450996 2:176107932-176107954 GCGGGTGGCGGCGGGGGCTGCGG - Exonic
943589919 2:189784498-189784520 GCGGGTGCGGGTGCGGGGTTGGG + Exonic
943639588 2:190343815-190343837 GCGGCCGCAGGCGCGGCCAGAGG - Exonic
946073436 2:217053824-217053846 GGGGGTGGAGGAGGGGGCTGTGG - Intergenic
946185493 2:217978556-217978578 GCGGGGGCAGGGGCGGGCTGGGG - Intronic
946280017 2:218659779-218659801 GTGGCTGGAGGCGCGAGCTGGGG + Exonic
946395454 2:219441932-219441954 GCGGGAGCCGGCGCGGGTGGCGG - Intronic
946431034 2:219627581-219627603 GGAGGTGGAGCCGCGGGCTGCGG + Exonic
947801181 2:232929105-232929127 CCGGCTGCAGGCGCAGGCCGCGG - Intronic
948115827 2:235493991-235494013 GCGGGCGCGGGCGCGGGCGAGGG + Intergenic
948645329 2:239400748-239400770 GCGGGTGGCGGCGCAGGCTGAGG - Exonic
948679299 2:239621805-239621827 GCGGGTGCAGCCTGGGGCTGGGG + Intergenic
948874609 2:240820028-240820050 GTGGGTGCAGGTGCGGGCTGCGG + Intronic
948920473 2:241063854-241063876 GAGGGTGCTGGGGAGGGCTGAGG + Intronic
949003016 2:241628201-241628223 GCGGGTCCAGGGGAAGGCTGAGG - Intronic
949042989 2:241857965-241857987 GAGGGTCCAGGAGCGGGCTGTGG + Intronic
1168892668 20:1305180-1305202 GCGGGTGAGGGAGCGGGCAGGGG - Exonic
1169207420 20:3748291-3748313 GCTGGTGCAGGCGCAGCTTGCGG - Exonic
1169262535 20:4149026-4149048 CCGGGCGCAGGCAGGGGCTGCGG + Intronic
1169910928 20:10646882-10646904 GCAGGGGCAGGGGCAGGCTGGGG + Intronic
1170890173 20:20369222-20369244 GCGGCGGCGGGCGCGGGCCGCGG - Exonic
1172245440 20:33442831-33442853 CTGGGTGCAGGCACAGGCTGGGG - Intronic
1172702799 20:36863280-36863302 GCGGGTGCAGGCGCGGGCTGGGG + Exonic
1172838245 20:37886658-37886680 CCGGGTGGAGGCGAGGGATGAGG + Intergenic
1172974202 20:38894263-38894285 GTGGGTGTAGGCGTGGGATGGGG - Intronic
1173165955 20:40687696-40687718 GCGGGTGCGCGGGCGGGCAGGGG - Exonic
1173213230 20:41054293-41054315 GCAGGTGCGGGGGCGGGGTGGGG - Intronic
1173903067 20:46605036-46605058 ACGGGGCCAGGCGAGGGCTGTGG - Intronic
1174171468 20:48620424-48620446 GCTGGTGAAGGCGCTGGCAGCGG + Intergenic
1174607104 20:51768694-51768716 GGGGGCGCGGGCGCGGGCCGGGG - Intergenic
1175167349 20:57054289-57054311 GTGGGAGAAGGCGCTGGCTGTGG - Intergenic
1175199071 20:57265906-57265928 GGAGGTGCGGGCGCGGGCGGTGG + Exonic
1175337395 20:58205442-58205464 GTGGGTGCAGACGTGGGGTGCGG - Intergenic
1175344975 20:58266309-58266331 GTGGGTACAGGCTCCGGCTGTGG + Intergenic
1175443768 20:59007176-59007198 GCGGGAGCCGGCGCGGGATCTGG - Exonic
1175510942 20:59525771-59525793 CCGGCCGAAGGCGCGGGCTGCGG + Intergenic
1175720451 20:61282961-61282983 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720452 20:61282998-61283020 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720453 20:61283037-61283059 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720454 20:61283076-61283098 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720455 20:61283115-61283137 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720456 20:61283154-61283176 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720457 20:61283193-61283215 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720458 20:61283232-61283254 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720459 20:61283271-61283293 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720460 20:61283310-61283332 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720461 20:61283340-61283362 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175776347 20:61656235-61656257 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776353 20:61656255-61656277 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776359 20:61656275-61656297 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1175856392 20:62122937-62122959 CGGGGTGAAGGCGCGGGCAGGGG - Intronic
1176073740 20:63239262-63239284 GCTGGGGCAGGGGAGGGCTGAGG + Intronic
1176156921 20:63626744-63626766 GCGGTGGCGGGCGCGGGCGGCGG - Intronic
1176161846 20:63652497-63652519 GCGGGCGCAGGCCCGGGCGGGGG - Intronic
1176177215 20:63734411-63734433 GCAGGGGCAGGAGAGGGCTGCGG + Intronic
1176409121 21:6438239-6438261 GGGGGTGCAGGGGCCTGCTGAGG - Intergenic
1176745609 21:10649665-10649687 GCTGGTGCAGTCTGGGGCTGAGG - Intergenic
1178534704 21:33402662-33402684 CATGGTGCAGGCTCGGGCTGGGG + Intergenic
1178832764 21:36070277-36070299 GCTGGTGGAAGCGCGGGCTCAGG - Exonic
1178893843 21:36542831-36542853 GCAGGGGCAGGTGCGGGCTGCGG - Intronic
1179684614 21:43046561-43046583 GGGGGTGCAGGGGCCTGCTGAGG - Intergenic
1179803954 21:43825745-43825767 GAGGCTGCAGGCTGGGGCTGAGG - Intergenic
1179841156 21:44074795-44074817 GCAGGTGCAGGCGTAGCCTGGGG + Intronic
1180141073 21:45893596-45893618 CCGGGTGCAGACGGGGGGTGGGG + Intronic
1180970054 22:19810556-19810578 GCAGGGGCAGCCCCGGGCTGAGG - Intronic
1181514369 22:23402677-23402699 GCGGGCGCGGGCCCGGGCTGGGG + Intergenic
1182261334 22:29074092-29074114 GCGGGTGCAGCCGAGGACTCGGG - Intronic
1182360605 22:29744375-29744397 GCGGGGGCGGGCGGGGGGTGTGG + Intronic
1183081304 22:35458401-35458423 GGGGGTGCAGGTGCCGGCGGGGG + Intergenic
1183214144 22:36468222-36468244 GCAGCTGCAGGCCAGGGCTGGGG + Intronic
1183321429 22:37167311-37167333 GAGGGTGCCGGCTGGGGCTGGGG - Intronic
1183504807 22:38202966-38202988 GTGGCTGCGGGCGCGGGCTCTGG - Intronic
1183507920 22:38219794-38219816 GTGGGTGCAGACACAGGCTGAGG - Exonic
1183961127 22:41412621-41412643 GCAGGTGCAGGTGGGGACTGCGG - Intergenic
1184120017 22:42444111-42444133 GCGGGTTCAGGCCAGGGCAGCGG - Intergenic
1184337511 22:43862436-43862458 GCGGGCGCGGGCGCGGGCGCGGG - Exonic
1184399471 22:44265411-44265433 GCGGGTTCAGGTGTTGGCTGGGG - Intronic
1184523103 22:45007427-45007449 GCGGGGGCAGGCCCGGGCGGGGG + Intronic
1184670078 22:46007735-46007757 GAGGCTGCAGGCCCAGGCTGAGG + Intergenic
1184863573 22:47190517-47190539 GAGGGTGCGGGCGCTGGGTGGGG - Intergenic
1185038202 22:48490348-48490370 ACTGGCGCGGGCGCGGGCTGGGG + Intronic
1185173200 22:49305247-49305269 GCGGCTGCAGCCCCTGGCTGAGG - Intergenic
1185188549 22:49418059-49418081 GCGGGTGCACGTGTGGGGTGTGG - Intronic
1185245938 22:49772855-49772877 GCGGGTGCAGGAGCCAGGTGGGG - Intergenic
1185255204 22:49827760-49827782 GCGGGCGCGGGCGCGGGCGCGGG + Intergenic
1185255208 22:49827772-49827794 GCGGGCGCGGGAGCGGGCGGCGG + Intergenic
1185291609 22:50030355-50030377 GCGGCTGCTGGCGAGGGTTGGGG + Intronic
1185320194 22:50197184-50197206 GCGGGTGCGGGGGTGCGCTGGGG - Intronic
950046026 3:9949133-9949155 GCGGGTGGATCCGTGGGCTGGGG + Exonic
950086162 3:10259496-10259518 GTGGGTGCAAGAGGGGGCTGAGG + Intronic
950345321 3:12287842-12287864 GCGGGCGCGGGCGCCGGCTGGGG - Intronic
950345324 3:12287848-12287870 GCGGGGGCGGGCGCGGGCGCCGG - Intronic
950683695 3:14602315-14602337 GCAGGGGCAGGCCCGGGCAGGGG + Intergenic
950902969 3:16513560-16513582 GTGGGTGGAGGCGTGGGCGGTGG + Exonic
951717386 3:25664251-25664273 GCGGGAGCCGGCGTGGGCGGCGG - Exonic
952646441 3:35664673-35664695 GCAGGTGGCGGCGGGGGCTGTGG + Intronic
953128253 3:40112246-40112268 GGGGGTGGAGGCGGGGGCGGAGG + Intronic
953347948 3:42191489-42191511 GGTGGTGCAGGCAAGGGCTGAGG - Intronic
953925364 3:46979922-46979944 GCGGGTGCGGGCGCGGGGCGGGG - Intronic
953925368 3:46979928-46979950 GCGGGTGCGGGTGCGGGCGCGGG - Intronic
954882677 3:53846338-53846360 GCGGGGGTAGGCGCGCGCCGCGG + Exonic
955818785 3:62874833-62874855 GTGGGTGCAGGCGGCGGCGGGGG - Exonic
958977197 3:100682076-100682098 TGGGGTACAGGCGCAGGCTGTGG + Intronic
960586016 3:119322535-119322557 GTGGGTGGAGGCGCTGGCCGCGG - Intronic
961446333 3:126983329-126983351 GCGGGGGCCGGGCCGGGCTGGGG + Intergenic
961588339 3:127954715-127954737 GAGGCTGCAGGGGCAGGCTGGGG - Intronic
962808964 3:138946013-138946035 GCGGCTGCAGCCGCGGGCCCCGG - Exonic
963081929 3:141402491-141402513 GCGGGGCGAGGCGCGGCCTGCGG + Intronic
964412055 3:156408051-156408073 GGGGGTGCAGTGGCGGGCGGTGG + Intronic
968178192 3:196569048-196569070 GCGGGCGCGGGCGCGGGCTCGGG + Exonic
968178193 3:196569054-196569076 GCGGGCGCGGGCTCGGGCTCTGG + Exonic
968701433 4:2059835-2059857 GCGGGTGCTGCCGCAGGCCGCGG - Exonic
968729331 4:2262203-2262225 GCGGGCGCCGGGCCGGGCTGGGG + Exonic
968842392 4:3017031-3017053 GAGGGTGCAGGCAGGGGCAGAGG - Intronic
968908020 4:3463458-3463480 GGGGGCGCGGGCGCGGGCGGCGG + Intronic
968958354 4:3730423-3730445 GCGGGTGCTGGTGGGGGCTGGGG + Intergenic
968958391 4:3730501-3730523 GGGGGTGCTGGTGGGGGCTGGGG + Intergenic
968958415 4:3730561-3730583 GTGGGTGCCGGTGGGGGCTGGGG + Intergenic
968958441 4:3730621-3730643 GCGGGTGCCAGTGGGGGCTGGGG + Intergenic
969263356 4:6047444-6047466 GCAGGTGCAGGCACGGGGCGGGG - Intronic
969448610 4:7259955-7259977 GCTGGTGCAGGCAGGGGCTGAGG + Intronic
969675524 4:8612199-8612221 GGGGGTGCAGGGGCTGGGTGGGG + Intronic
970007785 4:11427783-11427805 CCGGGTGCCGGCGCGGGATGGGG - Intronic
970529495 4:16967604-16967626 GAGGGTGCGGGCGAGGGGTGTGG - Intergenic
971231003 4:24800153-24800175 GCGTGTGCGGGCCCGGGCTCTGG + Exonic
972974839 4:44621424-44621446 GCAGGTGGAGGGGCTGGCTGTGG + Intergenic
973635876 4:52861959-52861981 GCGAGTGCGCGCGTGGGCTGTGG + Intergenic
975485860 4:74933580-74933602 GTTTGTGCGGGCGCGGGCTGCGG - Intronic
979231468 4:118352821-118352843 GCGGGGGCGGGAGGGGGCTGGGG - Exonic
981615342 4:146638836-146638858 GCGGGGGTAGGCGCGGGGAGAGG + Intergenic
981782785 4:148445232-148445254 GCGGGGGGAGGCGAGGGCTGGGG + Intergenic
981898634 4:149835430-149835452 GCGGGGCAGGGCGCGGGCTGGGG - Intergenic
985068425 4:186144925-186144947 GCGGGCGCGGGCGCGGGCGCGGG + Exonic
985068427 4:186144931-186144953 GCGGGCGCGGGCGCGGGCGCGGG + Exonic
985068429 4:186144937-186144959 GCGGGCGCGGGCGCGGGCGCGGG + Exonic
985478417 5:92347-92369 GCGGGGGTAGGGGCGGGGTGGGG + Intergenic
985493443 5:192129-192151 GCACGTGCAGGAGCTGGCTGGGG - Exonic
985668730 5:1195614-1195636 GCAGGTGCAGGCCAGGCCTGTGG + Intergenic
986204417 5:5610399-5610421 GCAGGTGGAGACCCGGGCTGTGG + Intergenic
988348489 5:30070228-30070250 GCGGGTGCTGGGGGTGGCTGAGG - Intergenic
989484134 5:41968362-41968384 GCGGGCACCGGCGCGGGCTATGG - Intergenic
990376559 5:55176526-55176548 GCGGGAGCGGGCGCGGGCGCGGG - Intergenic
991351113 5:65721848-65721870 GCGGGTGCCGGTGCGGGCCCCGG + Intronic
994072798 5:95620747-95620769 GCGAGGGCACGCGCGGGCAGCGG - Exonic
995106539 5:108382070-108382092 GCGGGTGCGCGCGCCGGCGGCGG - Exonic
997470516 5:134114743-134114765 CGGGCTGCAGGCGCGGGCTAGGG - Exonic
997475084 5:134138122-134138144 GCAGGTGCAGGGGTGGGATGTGG - Exonic
998018303 5:138750539-138750561 GCAGGAGCAGGAGGGGGCTGAGG + Intronic
998138082 5:139684909-139684931 GCGGGGGCAGGCAGGGGCGGTGG + Intergenic
998461779 5:142315006-142315028 GTGGGTGCTGGAGCCGGCTGTGG + Exonic
999218797 5:149958241-149958263 GCGGGTGGAGGGGTGGGGTGGGG - Intergenic
999361292 5:150988712-150988734 GGAGGTGGAGGGGCGGGCTGGGG + Intergenic
999758499 5:154682759-154682781 GCGGGAGGAGGCGGGAGCTGGGG + Intergenic
1001266516 5:170278335-170278357 GGGAGTGCAGGGGGGGGCTGGGG + Intronic
1001375391 5:171251756-171251778 GCGGGGGCGGGCGCGGGAGGAGG - Intronic
1001702280 5:173715697-173715719 GCTGCTGCAGGCACGGGCTTGGG - Intergenic
1002172886 5:177385225-177385247 GTGGCTGCAGGTGTGGGCTGGGG - Intronic
1002487779 5:179551080-179551102 GCGGGTGCGGGAGCGCGCTCAGG - Intronic
1002636513 5:180611528-180611550 GAGGGTGGGGGCGAGGGCTGAGG - Intronic
1003058215 6:2841763-2841785 GCGGGGGCGGGCGCGGGGAGAGG - Intronic
1003113268 6:3266204-3266226 GCAGGTGCAGGCGCAGGCCCAGG - Intronic
1004561908 6:16760357-16760379 GCGGGTGCTGGCGGGGGCGCCGG + Intronic
1005966607 6:30731046-30731068 GCGGGTGCAGGTGCAGGTGGTGG - Exonic
1006137242 6:31902397-31902419 ACGGGTGCGCGCGCGCGCTGCGG - Intronic
1006230695 6:32584169-32584191 CCTGGAGCAGGCGCGGGCCGCGG - Exonic
1006578808 6:35064784-35064806 GGGGGTGGAGGTGGGGGCTGGGG - Intronic
1006985893 6:38175309-38175331 GCCGGGGCAGGCGTGGGCAGTGG - Intronic
1007473866 6:42106707-42106729 GGGGGTGCAGGAGGGGGCAGGGG + Exonic
1007665285 6:43509905-43509927 GGGGGTGGAGGCGGCGGCTGTGG + Exonic
1007785280 6:44276213-44276235 CCCGGTGGGGGCGCGGGCTGCGG + Exonic
1008034965 6:46735537-46735559 GCGGGTCCAGGTGCGGGCCATGG - Intronic
1010032866 6:71288725-71288747 GCGGGTTCAGGCGCGCGCGGCGG + Intergenic
1015149227 6:130019858-130019880 GCGGGAGAGGGCGCGGGCCGCGG + Intronic
1015149257 6:130019942-130019964 CCGGGTGCGGGCGCGGGCGCGGG + Intronic
1016340915 6:143060810-143060832 GCGGGCGCGGGCGCGGGGCGGGG - Intronic
1016375956 6:143420903-143420925 GTGGCTGCAGGCACGGGATGTGG + Intergenic
1018020923 6:159761899-159761921 GCCGGAGCAGGGGCGGGCGGAGG - Exonic
1018706864 6:166469806-166469828 GCGTGTGCAGGTGGGGACTGTGG + Intronic
1019147712 6:169985617-169985639 TCGGGGAGAGGCGCGGGCTGTGG - Intergenic
1019197541 6:170291128-170291150 GCGGGGGCAGGGGAGGACTGGGG - Intergenic
1019473379 7:1232928-1232950 GCGGCGGGAGGCGCGGGCGGCGG - Exonic
1019669826 7:2271443-2271465 CCGGATGCAGGTGTGGGCTGTGG + Intronic
1019689671 7:2403629-2403651 GCGGCTGCGGGCGCGAGGTGAGG + Exonic
1019828521 7:3302348-3302370 TCAGGAGCAGGCGGGGGCTGGGG - Intronic
1020224820 7:6272212-6272234 GCCGGGGCTGCCGCGGGCTGGGG - Intronic
1022114397 7:27249550-27249572 GCCGGTGCACACTCGGGCTGCGG - Intergenic
1022509071 7:30923661-30923683 GCAGGGGCAGGGGCGGGCGGAGG + Exonic
1022629363 7:32070853-32070875 GCGGGAGCCGGCGCGGGCGGTGG + Intronic
1023638534 7:42236913-42236935 GCGGCCGCAGGAGCGGGCTGCGG + Intronic
1023812923 7:43926417-43926439 GCGCGCGCAAGCGCAGGCTGCGG + Intronic
1024980712 7:55155528-55155550 GCAGGTGGAGGAGAGGGCTGAGG + Intronic
1025091041 7:56064479-56064501 GCGGCTGCAGCGGCAGGCTGGGG + Intronic
1025202379 7:56970265-56970287 GCGGATTCAGGCCTGGGCTGTGG - Intergenic
1025669569 7:63606662-63606684 GCGGATTCAGGCCTGGGCTGTGG + Intergenic
1025833513 7:65075198-65075220 GCGCCTGCAGCCGCCGGCTGGGG + Intergenic
1025903273 7:65764707-65764729 GCGCCTGCAGCCGCCGGCTGGGG + Intergenic
1027374517 7:77537124-77537146 GCGGCTGCTGGCGGGGGGTGGGG + Intergenic
1029372614 7:100158815-100158837 GAGAATGCAGGCGGGGGCTGCGG + Intergenic
1029448275 7:100626907-100626929 GGGTGGGGAGGCGCGGGCTGGGG + Intronic
1029640667 7:101817124-101817146 CCGGGTGCGGGCGCGGGAGGAGG + Intronic
1031665714 7:124480536-124480558 GCCGGTGCAGGGGCGGGGTCCGG + Intergenic
1033361230 7:140640462-140640484 GGGGGTGCAGGGTCGAGCTGGGG - Intronic
1034147328 7:148884468-148884490 GCGCGTGCGCGCGCGGGCGGCGG + Intergenic
1034192732 7:149224099-149224121 ACGGGGGCAGGCGGCGGCTGTGG + Exonic
1034461266 7:151199298-151199320 GGGGGTGCAGGCGGGGGCTGGGG - Intronic
1035167595 7:157000582-157000604 GCGGGGGCGGGGGCGGGGTGGGG + Intronic
1035291846 7:157844330-157844352 GAGGGTGCAGGCTGGGGATGGGG - Intronic
1035331933 7:158102116-158102138 CAGGGTGAAGGCGTGGGCTGAGG - Intronic
1037313253 8:17577591-17577613 GCTGGACCAGGCGCTGGCTGGGG - Intronic
1037319459 8:17629860-17629882 GTGGGTGCAGGTGAGGACTGTGG - Intronic
1038447615 8:27614844-27614866 GCCGGTGCAGCACCGGGCTGGGG + Exonic
1042611788 8:70608207-70608229 GCACCTGCAGGCGCGGGCGGCGG - Exonic
1043000719 8:74756482-74756504 GAGAGTGCAGGAGAGGGCTGTGG - Intronic
1043689040 8:83127045-83127067 GTGGGTGCAGGTGCAGCCTGAGG + Intergenic
1044857790 8:96494083-96494105 GCGGGAGCAGGCGCAGGAGGAGG + Exonic
1045488528 8:102653861-102653883 GCGGGCGGAGGCGCGGGCGGGGG + Intronic
1045583434 8:103501596-103501618 GCGGGCGGCGGCGCGGGCTAGGG + Intronic
1047248037 8:123161135-123161157 CCCGGCGCAGGCGCAGGCTGAGG - Intergenic
1049405318 8:142449706-142449728 GCGGGCGCAGGCGGCGGCGGCGG + Exonic
1049508990 8:143018459-143018481 GCGGGGGCAGGGGCGGGACGCGG - Intronic
1049645488 8:143733940-143733962 GCGGGTCGGGGCGCGGGCCGGGG - Intergenic
1049661525 8:143821745-143821767 GCAGGGGCAGGGGCGGGGTGCGG - Intronic
1049673098 8:143878345-143878367 GCGGGTGCGGGTGCGGGCTCGGG - Intronic
1049744079 8:144255758-144255780 GCGTGTGCACGCGCGTGGTGGGG + Intronic
1049828311 8:144684807-144684829 TCTGCGGCAGGCGCGGGCTGGGG - Intergenic
1052757121 9:32552390-32552412 GCGGGAGCTGGCGGGAGCTGCGG - Intronic
1052982358 9:34458400-34458422 GCGGATGCAGGGGTGGGCGGGGG + Exonic
1056291082 9:85144501-85144523 GCTGGAGCAGGCTGGGGCTGAGG + Intergenic
1056691440 9:88811895-88811917 GTGGGGGCAGGCGGGGGCGGAGG - Intergenic
1056960481 9:91118132-91118154 GCAGGTGCAGGCGGGGGCCGAGG + Intergenic
1057231800 9:93325723-93325745 GCAGGGGCAGGGGCAGGCTGGGG - Intronic
1057245603 9:93451878-93451900 GCGGGCGCGGGTGCGGGCGGGGG - Exonic
1057294325 9:93826609-93826631 GCGGAGGCAGGGGCGGGCGGGGG + Intergenic
1057716731 9:97501762-97501784 GCCGGCGCGGACGCGGGCTGCGG - Exonic
1058486597 9:105448099-105448121 GGCGGTGCCGGTGCGGGCTGGGG + Exonic
1058934493 9:109755685-109755707 GGGGGTGGAGGTGGGGGCTGGGG - Intronic
1058995130 9:110292185-110292207 GCGTGGGCAGCCGGGGGCTGTGG - Intergenic
1059417111 9:114168970-114168992 GTGGGTGCTGGTGCGGGCAGAGG - Exonic
1060301341 9:122376137-122376159 GCTGGGGGAGGCGGGGGCTGGGG + Intronic
1060402432 9:123356456-123356478 GTGGGTGCAGGCCTGAGCTGTGG + Intronic
1060403892 9:123363381-123363403 GCGGGTGCTGGCGTGGTGTGTGG + Intronic
1060584396 9:124777152-124777174 CAGGGTGCAGGCGCGGGGCGCGG + Intronic
1060664928 9:125427179-125427201 GGAGCTGCAGGCGGGGGCTGAGG + Intergenic
1060700760 9:125747417-125747439 GCGGGAGCGGGCGGCGGCTGAGG - Exonic
1060856051 9:126915309-126915331 GCGGCTGCAGGTGCGGGGGGCGG + Intronic
1061000425 9:127899444-127899466 GGGGGCGGAGGCGGGGGCTGGGG - Intronic
1061193209 9:129094169-129094191 GCGGATGCCGGGGTGGGCTGGGG - Intergenic
1061302761 9:129715134-129715156 ACGGGACCAGGCGGGGGCTGTGG - Intronic
1061575464 9:131503297-131503319 GCGGGTGCAGTCTCAGGGTGAGG + Intronic
1061910067 9:133717658-133717680 GTGGGTGGAGGCCTGGGCTGGGG - Intronic
1061958332 9:133975191-133975213 GGGGGTGCCGGGGCAGGCTGGGG - Intronic
1062306009 9:135907438-135907460 GCGGGGGCGGGAGCGGGCCGGGG + Intergenic
1062394966 9:136349115-136349137 GCAGGTGCAGACACTGGCTGGGG + Intronic
1062419687 9:136474173-136474195 GCAAGTGCAGGCACTGGCTGTGG + Exonic
1062567465 9:137169718-137169740 GCGCGCGCAGGCGCAGGCTCAGG + Exonic
1062575507 9:137205487-137205509 GCGGCGGCAGGCGCGGGCGAGGG - Exonic
1186107968 X:6226915-6226937 GCGGGTGCCAGCGCGGGCTGTGG + Intronic
1186670006 X:11758383-11758405 CAGGGAGGAGGCGCGGGCTGGGG + Intronic
1187154621 X:16712017-16712039 GCGGGCGCTGGCGCGGGCGGAGG + Exonic
1189275092 X:39779643-39779665 GCTGGAGGAGGAGCGGGCTGGGG - Intergenic
1192260617 X:69504267-69504289 GCGGGGGCTGGGGCGGGGTGGGG + Intergenic
1198116780 X:133551851-133551873 GAGGGTGCAGGCAGGTGCTGGGG - Intronic
1198480247 X:137034063-137034085 ACGGGCGCAGGCGGGGGCCGAGG - Intergenic
1198800135 X:140439718-140439740 CCGGGGGCGGGCCCGGGCTGGGG + Intergenic
1199872611 X:151912751-151912773 GGGGGTGCAGGTGTGGGGTGGGG - Intronic
1200061752 X:153486853-153486875 GGGGGTGGAGGGGCAGGCTGAGG + Exonic
1200218544 X:154379461-154379483 GCGGGTGCGGGCTCAGGCGGAGG - Exonic
1200238113 X:154478884-154478906 GCGGATGCAGACGCAGGCGGAGG - Exonic
1200292501 X:154886384-154886406 GCGGCTGCAGGCCTGGGCGGCGG + Exonic
1200339345 X:155382124-155382146 GCGGCTGCAGGCCTGGGCGGCGG + Exonic
1200347125 X:155458569-155458591 GCGGCTGCAGGCCTGGGCGGCGG - Exonic
1201577792 Y:15478859-15478881 GCTGGTGAAGGTGAGGGCTGAGG + Intergenic