ID: 1172704534

View in Genome Browser
Species Human (GRCh38)
Location 20:36873161-36873183
Sequence TGGCCCCCTCTCTGGGGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172704527_1172704534 3 Left 1172704527 20:36873135-36873157 CCAGGTGGGCAGGGTCAGTGCCC No data
Right 1172704534 20:36873161-36873183 TGGCCCCCTCTCTGGGGATCAGG No data
1172704526_1172704534 6 Left 1172704526 20:36873132-36873154 CCACCAGGTGGGCAGGGTCAGTG No data
Right 1172704534 20:36873161-36873183 TGGCCCCCTCTCTGGGGATCAGG No data
1172704522_1172704534 17 Left 1172704522 20:36873121-36873143 CCGCAGACAGACCACCAGGTGGG No data
Right 1172704534 20:36873161-36873183 TGGCCCCCTCTCTGGGGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172704534 Original CRISPR TGGCCCCCTCTCTGGGGATC AGG Intergenic
No off target data available for this crispr