ID: 1172705382

View in Genome Browser
Species Human (GRCh38)
Location 20:36878793-36878815
Sequence AACTAGCCCAAAGCTCGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 36}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172705382_1172705392 20 Left 1172705382 20:36878793-36878815 CCCATGCGAGCTTTGGGCTAGTT 0: 1
1: 0
2: 0
3: 0
4: 36
Right 1172705392 20:36878836-36878858 CAGTTTCCTCATCTATAAGATGG 0: 12
1: 317
2: 2241
3: 7140
4: 13911
1172705382_1172705384 -7 Left 1172705382 20:36878793-36878815 CCCATGCGAGCTTTGGGCTAGTT 0: 1
1: 0
2: 0
3: 0
4: 36
Right 1172705384 20:36878809-36878831 GCTAGTTGTTCCACCCTCCCTGG No data
1172705382_1172705385 -6 Left 1172705382 20:36878793-36878815 CCCATGCGAGCTTTGGGCTAGTT 0: 1
1: 0
2: 0
3: 0
4: 36
Right 1172705385 20:36878810-36878832 CTAGTTGTTCCACCCTCCCTGGG 0: 1
1: 0
2: 2
3: 13
4: 104
1172705382_1172705393 21 Left 1172705382 20:36878793-36878815 CCCATGCGAGCTTTGGGCTAGTT 0: 1
1: 0
2: 0
3: 0
4: 36
Right 1172705393 20:36878837-36878859 AGTTTCCTCATCTATAAGATGGG 0: 6
1: 268
2: 1868
3: 6144
4: 12664

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172705382 Original CRISPR AACTAGCCCAAAGCTCGCAT GGG (reversed) Intronic
906718579 1:47988761-47988783 ACCTAGCCCAGCGCTCTCATGGG + Intronic
909528675 1:76657441-76657463 CACTAGCCCCAAGCTCCAATGGG - Intergenic
921904104 1:220478164-220478186 AATTAATCCAAAGCTCGCAAGGG + Intergenic
1072500045 10:96005845-96005867 AACTAACCCAAAACTCAGATTGG + Intronic
1096555672 12:52402056-52402078 AACTTGCCCACAGCTTGCACGGG - Intronic
1119930999 14:78546882-78546904 AATTAGCCCAAAGGTCACAGAGG + Intronic
1121449268 14:93997084-93997106 AAATAGCCCAAGTCTCACATGGG + Intergenic
1126579804 15:50232509-50232531 AATTAGCCCAGAGCTCCTATAGG + Intronic
1128639096 15:69322907-69322929 AACGAGCACAAAGAGCGCATGGG + Intronic
1131833790 15:96370415-96370437 ACCAAGCCTCAAGCTCGCATTGG + Intergenic
1138490054 16:57371565-57371587 CACTAGCCCAATGCTCTCTTTGG + Intergenic
1142052274 16:87966668-87966690 AACTAGCAAAAAGCTTGAATTGG + Intronic
1145006183 17:19339589-19339611 AAATAACCCCAAGCTCTCATTGG + Intronic
1152291885 17:79444462-79444484 AGCCAGCCCAAAGCCCACATAGG + Intronic
1158591987 18:58785528-58785550 AAGGAGCCCACAGCTCCCATGGG + Intergenic
935929680 2:108110658-108110680 AACAAACCCAAAGCTGGCAGGGG - Intergenic
938371766 2:130773361-130773383 AACTAACCCAAAGCCAGCAGAGG + Intergenic
940466599 2:154037372-154037394 AACAAACCCAAAGCTAACATGGG + Intronic
1172705382 20:36878793-36878815 AACTAGCCCAAAGCTCGCATGGG - Intronic
1174676566 20:52362840-52362862 AAATAGCCCTAAGATCTCATTGG + Intergenic
1182388106 22:29963891-29963913 AAGTAGCCCAAAGGTGGGATGGG - Intronic
949522191 3:4867921-4867943 AACTGGGGCCAAGCTCGCATAGG + Intronic
957221570 3:77389401-77389423 AAGTAGCCACAAGCCCGCATGGG - Intronic
960894708 3:122490537-122490559 AACTAGCTCCTAGCTCCCATTGG - Intronic
974945843 4:68528218-68528240 AACAAGCTAAAAGCTTGCATAGG + Intergenic
991439022 5:66626899-66626921 AACTATCCCAATGATCCCATTGG - Intronic
1007786651 6:44284042-44284064 AAGGAACCCAAAGCTCTCATCGG + Intronic
1017295503 6:152789370-152789392 AAGTAGCTCAAAGTTGGCATTGG + Intergenic
1020784707 7:12558497-12558519 AACAAGCTAAAAGCTTGCATAGG - Intergenic
1039794866 8:40904165-40904187 ATCTAGCCCAAAGGTCGCTCAGG + Intergenic
1052076473 9:24147107-24147129 AAGTAAGCCAAAGCTAGCATAGG - Intergenic
1061489287 9:130936375-130936397 AACAAGCCCAGAGCTGGCACAGG + Intronic
1062156331 9:135050699-135050721 AACCAGCTCAAGGCACGCATGGG + Intergenic
1193863678 X:86702386-86702408 ACCAAGCCCAAAGCTAGCAGGGG + Intronic
1194083864 X:89501706-89501728 AAATAGCACAAAGCTCCCAATGG - Intergenic
1197702813 X:129612226-129612248 AACTAGTTCAAAGCTTGAATTGG + Intergenic
1200436512 Y:3157586-3157608 AAATAGCACAAAGCTCCCAATGG - Intergenic