ID: 1172706759

View in Genome Browser
Species Human (GRCh38)
Location 20:36887683-36887705
Sequence CTGGCTTAGCGTGAGGTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172706759_1172706767 27 Left 1172706759 20:36887683-36887705 CCCTCAACCTCACGCTAAGCCAG 0: 1
1: 0
2: 1
3: 5
4: 114
Right 1172706767 20:36887733-36887755 CCCCACTGAAGTGTTACAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 94
1172706759_1172706763 -8 Left 1172706759 20:36887683-36887705 CCCTCAACCTCACGCTAAGCCAG 0: 1
1: 0
2: 1
3: 5
4: 114
Right 1172706763 20:36887698-36887720 TAAGCCAGTATTAAGGAGAAAGG 0: 1
1: 1
2: 1
3: 10
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172706759 Original CRISPR CTGGCTTAGCGTGAGGTTGA GGG (reversed) Intronic
900603426 1:3513059-3513081 CTTGCTTAGAGTCAGGTTGCAGG - Intronic
901980456 1:13030066-13030088 CTGGATTAGCGGGACGTTGACGG + Intronic
902007888 1:13246565-13246587 CTGGATTTGCGGGATGTTGATGG + Intergenic
902026864 1:13390360-13390382 CTGGATTTGCGGGATGTTGATGG + Exonic
902803962 1:18849332-18849354 CTGGCTGACCGTGTTGTTGATGG + Exonic
905171503 1:36112549-36112571 CTGCCTTAGGGTGAGGCTGTGGG - Intronic
906380111 1:45327248-45327270 CTGGCTTCGCGGGAGGTGGACGG + Exonic
918283100 1:183024111-183024133 CAGGTGCAGCGTGAGGTTGATGG - Exonic
921077700 1:211712870-211712892 CTGGCATAGAGTCAGGTTTAGGG - Intergenic
921482969 1:215684700-215684722 CTGGCTTAGAATGAAGTTGATGG - Intronic
924660156 1:246008419-246008441 CTGGCTTAGCCTGAGTTTCTGGG + Intronic
1067158139 10:43799867-43799889 CTGGGTTAGCGTGGGGTGGGAGG + Intergenic
1067202270 10:44183646-44183668 CTGGCTTTGTTTGAAGTTGAAGG + Intergenic
1073204504 10:101761799-101761821 GTGGCTTGGTGTGAGGGTGAGGG - Intergenic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1078740837 11:14064855-14064877 CTTCCTTAGGGTGAGGTAGAGGG + Intronic
1080713146 11:34770334-34770356 GTGGCTTAGCCTGGGGGTGAAGG + Intergenic
1081383176 11:42441400-42441422 CTGGCTTGGGGTGAGGTTGATGG - Intergenic
1084943650 11:72627377-72627399 CTGGCTCGGCCTGAGGTAGAGGG + Intronic
1085417691 11:76330186-76330208 CTGGCTTAGCCTGATGTTAAAGG + Intergenic
1086009525 11:82083326-82083348 CTGGCTTAGCATGTGGTGGTAGG + Intergenic
1091218304 11:133916921-133916943 CTGGCATAGGGTGAGTGTGAGGG - Intronic
1092221944 12:6720007-6720029 CTTGCTTAGAGTGAGATGGACGG - Intergenic
1102159964 12:110760688-110760710 CTGGCTCAGAGTGAAGTTGCCGG + Intergenic
1106979160 13:35256610-35256632 ATGGCTTAGCGTGAGCCTGCAGG - Intronic
1114030299 14:18572896-18572918 TTGGGTTAGGGTGAGGATGAGGG + Intergenic
1114061086 14:19016239-19016261 CTGGCAGCGTGTGAGGTTGATGG + Intergenic
1114101170 14:19383740-19383762 CTGGCAGCGTGTGAGGTTGATGG - Intergenic
1121558605 14:94857506-94857528 CTGGCTGTGCATGAGGTTGGGGG - Intergenic
1202899946 14_GL000194v1_random:29257-29279 TTGGATTAGTGTGAGGGTGAGGG + Intergenic
1128715986 15:69908338-69908360 CTGGCTCAGAGTGAGCTGGATGG - Intergenic
1132804615 16:1769710-1769732 CAGGCTCAGCCTCAGGTTGATGG + Exonic
1138598854 16:58043409-58043431 CTGGGTAGGCCTGAGGTTGAGGG - Intronic
1140988010 16:80177566-80177588 CTGGCTTTTTGTGAGGTGGATGG - Intergenic
1144078066 17:11736771-11736793 CTTGCTGAGCGTGAGGTTTCTGG + Intronic
1147130371 17:38404408-38404430 CTGGCTTCCCGGGAGGTAGATGG - Exonic
1151196926 17:72438300-72438322 AAGGCTTGGCGTGAGGTTGGTGG - Intergenic
1154498944 18:14984767-14984789 TTGGGTTAGGGTGAGGGTGAGGG - Intergenic
1156243904 18:35279298-35279320 CTGTCTTAGCTTCAGGTTGCTGG + Intronic
1156543882 18:37944606-37944628 TTGGCTTAGAGGGAGGATGATGG + Intergenic
1157172673 18:45422492-45422514 TAGGCTAAGCGTGAGGTGGAAGG + Intronic
1157307524 18:46528108-46528130 CTGGCTGAGGGTCAGGTTTAAGG + Intronic
1157314190 18:46574765-46574787 GTGTCTTATGGTGAGGTTGAGGG - Intronic
1158748109 18:60226171-60226193 GTGGCTTAGGGTGTGGTTGTTGG + Intergenic
1164664726 19:30020444-30020466 CTGTCTTAGGATGAGGGTGAAGG - Intergenic
1166716080 19:44968729-44968751 CTGGCTTAGTGTGTGGCTGTGGG - Intronic
1202647543 1_KI270706v1_random:156418-156440 TTGGATTAGTGTGAGGGTGAGGG - Intergenic
927862864 2:26570986-26571008 CTGGCTTAGGTGGAGGTTGGAGG + Intronic
930897213 2:56460384-56460406 CTGGCATAGGGTCAGATTGAAGG + Intergenic
932094656 2:68837014-68837036 CAGTGTTAGCGTGAGGATGAGGG + Intergenic
932790946 2:74654254-74654276 CCGGCTCAGCCTGAGGCTGAGGG - Exonic
933940570 2:87241423-87241445 ATGGCTAAGCCTGAGGTTGCAGG + Intergenic
934310330 2:91857215-91857237 TTGGGTTAGGGTGAGGGTGAGGG - Intergenic
936327261 2:111516171-111516193 ATGGCTTAGCTTGATGTTTATGG - Intergenic
936569785 2:113603460-113603482 TTGGGTTAGGGTGAGGGTGAGGG - Intergenic
938497907 2:131812854-131812876 TTGGGTTAGGGTGAGGGTGAGGG - Intergenic
938547837 2:132351883-132351905 TTGGGTTAGGGTGAGGGTGAGGG - Intergenic
939057056 2:137378741-137378763 CTGGCTTAGGGAGTGGTTGGGGG - Intronic
941797992 2:169622523-169622545 CTAGGTTAGCATGAGTTTGAGGG - Intronic
944065264 2:195612898-195612920 CTGGCTCAGTGTGAGGGAGAAGG + Intronic
945055938 2:205868981-205869003 GTGGTTTAGCGGGAGGCTGATGG + Intergenic
948658087 2:239489236-239489258 ATGGCTTAGAGTTAGGTTTAGGG + Intergenic
1171179768 20:23084104-23084126 CTGGCGTGGGGGGAGGTTGAGGG + Intronic
1171504865 20:25624711-25624733 CAGGCATAGCAAGAGGTTGAGGG + Intergenic
1171876704 20:30584656-30584678 TTGGGTTAGGGTGAGGGTGAGGG - Intergenic
1172706759 20:36887683-36887705 CTGGCTTAGCGTGAGGTTGAGGG - Intronic
1173728598 20:45313429-45313451 CAGGGTTAGGGTGAGGGTGAGGG - Intronic
1176604320 21:8816342-8816364 TTGGATTAGTGTGAGGGTGAGGG + Intergenic
1176619320 21:9044031-9044053 TTGGATTAGTGTGAGGGTGAGGG + Intergenic
1176820440 21:13650836-13650858 CTGGCTGCGAGTGAGGTTGGTGG + Intergenic
1180184878 21:46134527-46134549 CAGGTTTAGGGTGAGGGTGAGGG + Intergenic
1180346610 22:11707949-11707971 TTGGATTAGTGTGAGGGTGAGGG + Intergenic
1180354377 22:11826072-11826094 TTGGATTAGTGTGAGGGTGAGGG + Intergenic
1180383877 22:12166283-12166305 TTGGATTAGTGTGAGGGTGAGGG - Intergenic
1180454412 22:15499946-15499968 TTGGGTTAGGGTGAGGATGAGGG + Intergenic
1180479569 22:15738851-15738873 CTGGCAGCGTGTGAGGTTGATGG + Intergenic
1180537077 22:16403154-16403176 TTGGGTTAGGGTGAGGGTGAGGG - Intergenic
1180913150 22:19467469-19467491 CTGGCATGCAGTGAGGTTGACGG + Intronic
1183700781 22:39449813-39449835 CCAGCTAAGCGTGAGGTTTATGG + Intergenic
949934683 3:9107568-9107590 CTGCCTTAGCGTGTGGTCAACGG - Intronic
950153076 3:10703393-10703415 CTGGCTTCATGTGAGGGTGAGGG - Intronic
961466949 3:127087851-127087873 CTGGCTTGGCCAGAGGTGGAAGG + Intergenic
963216376 3:142753172-142753194 CTGGCTTGGTTTGAGGTTGGGGG + Intronic
963673784 3:148283243-148283265 CTGACTTAGCATCAGGGTGATGG - Intergenic
968001053 3:195207079-195207101 CTGGCTCAGCCTGTGGTAGAAGG - Intronic
972861975 4:43180262-43180284 CTTGGTTAGTGAGAGGTTGAGGG - Intergenic
973373799 4:49274607-49274629 TTGGATTAGTGTGAGGGTGAGGG - Intergenic
973383613 4:49335632-49335654 TTGGATTAGTGTGAGGGTGAGGG + Intergenic
973387218 4:49520645-49520667 TTGGATTAGTGTGAGGGTGAGGG + Intergenic
977710337 4:100117180-100117202 CTGGCATGGCATGAGGGTGAGGG + Intergenic
982234327 4:153238142-153238164 CTGGGTAAGGGTGAGCTTGAAGG + Intronic
986899434 5:12413385-12413407 TTGGCTTAGGGTTAGGGTGATGG + Intergenic
997361051 5:133295154-133295176 ATGGCTGAGCGTGAGGATAAGGG - Intronic
998521324 5:142803594-142803616 CGGCAATAGCGTGAGGTTGAAGG - Intronic
1001217798 5:169872050-169872072 CTTGCTTAGAGTGTAGTTGATGG - Intronic
1006431761 6:34001657-34001679 CAGGATTAGGGTGAGGCTGAGGG - Intergenic
1010272435 6:73929424-73929446 GTGGCTTAGCCTCAGGATGAAGG + Intergenic
1013857434 6:114591262-114591284 ATGCCTTAGCGTGGGGTGGATGG - Intergenic
1013908249 6:115241678-115241700 TTGGCTTCACGTGAGATTGACGG + Intergenic
1015721794 6:136250190-136250212 CTGGCTGAGCGTGAGGCTCCAGG - Exonic
1019030716 6:169008451-169008473 CTGGCTTAGGGGGAAGATGATGG - Intergenic
1023350625 7:39317055-39317077 CTGGCTTATCGTGAGAAGGAAGG - Intronic
1026442423 7:70456118-70456140 CTGGGTTAGGGGGAAGTTGAGGG - Intronic
1037672501 8:21027402-21027424 TTGGCTTAGGGTAAGGTAGAAGG + Intergenic
1038621821 8:29151174-29151196 CTGGGTTAGGGTTTGGTTGAGGG - Intronic
1039270310 8:35873637-35873659 CTGGCTTGGCGTTAGGTCCAGGG - Intergenic
1044529052 8:93287461-93287483 CTGCCTCAGAGTGGGGTTGAGGG + Intergenic
1048919350 8:139213707-139213729 CTGGCTTAGAGGGATGTGGAGGG - Intergenic
1049881633 8:145068329-145068351 TTGGGTTAGGGTGAGGGTGATGG + Intergenic
1050052007 9:1612310-1612332 CTGGCTTTGCCTGAGCTTGAGGG + Intergenic
1057041689 9:91852995-91853017 CTGGCGGAGCGCGAGGTTGTGGG + Intronic
1062494370 9:136824878-136824900 CTGGTTTGGGGTGAGGCTGATGG + Intronic
1203526811 Un_GL000213v1:98085-98107 CTGGCTGCGAGTGAGGTTGGTGG - Intergenic
1203526929 Un_GL000213v1:98724-98746 CTGGCTGCGAGTGAGGTTGGTGG - Intergenic
1203697496 Un_GL000214v1:112580-112602 TTGGATTAGTGTGAGGGTGAGGG - Intergenic
1203551714 Un_KI270743v1:168432-168454 TTGGATTAGTGTGAGGGTGAGGG + Intergenic
1187480967 X:19655288-19655310 CTGGCTTAGATTGAGGCTCATGG - Intronic
1191899189 X:66023252-66023274 CTGGATTAGCCTGATGCTGATGG + Intronic
1192810986 X:74547249-74547271 CTGGCTTAGACTGACCTTGATGG + Intergenic
1193906044 X:87245351-87245373 CTGGATTAGGGTTAGGTTTAGGG - Intergenic
1198627962 X:138600476-138600498 CTCTCTTGGCGTGAGGTAGAGGG + Intergenic