ID: 1172707547

View in Genome Browser
Species Human (GRCh38)
Location 20:36893426-36893448
Sequence CTTTTATTGCAGAGGGGACC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 134}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172707547_1172707553 -4 Left 1172707547 20:36893426-36893448 CCTGGTCCCCTCTGCAATAAAAG 0: 1
1: 0
2: 0
3: 12
4: 134
Right 1172707553 20:36893445-36893467 AAAGGCCCAGGTCTACAAGATGG 0: 1
1: 0
2: 0
3: 9
4: 148
1172707547_1172707559 10 Left 1172707547 20:36893426-36893448 CCTGGTCCCCTCTGCAATAAAAG 0: 1
1: 0
2: 0
3: 12
4: 134
Right 1172707559 20:36893459-36893481 ACAAGATGGCAAAGAAGGGGAGG 0: 1
1: 0
2: 0
3: 25
4: 409
1172707547_1172707557 6 Left 1172707547 20:36893426-36893448 CCTGGTCCCCTCTGCAATAAAAG 0: 1
1: 0
2: 0
3: 12
4: 134
Right 1172707557 20:36893455-36893477 GTCTACAAGATGGCAAAGAAGGG 0: 1
1: 0
2: 0
3: 17
4: 211
1172707547_1172707556 5 Left 1172707547 20:36893426-36893448 CCTGGTCCCCTCTGCAATAAAAG 0: 1
1: 0
2: 0
3: 12
4: 134
Right 1172707556 20:36893454-36893476 GGTCTACAAGATGGCAAAGAAGG 0: 1
1: 0
2: 3
3: 12
4: 179
1172707547_1172707558 7 Left 1172707547 20:36893426-36893448 CCTGGTCCCCTCTGCAATAAAAG 0: 1
1: 0
2: 0
3: 12
4: 134
Right 1172707558 20:36893456-36893478 TCTACAAGATGGCAAAGAAGGGG 0: 1
1: 0
2: 0
3: 25
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172707547 Original CRISPR CTTTTATTGCAGAGGGGACC AGG (reversed) Exonic
902540154 1:17149000-17149022 CCTTTATTCCAGAGGGGACAAGG + Intergenic
909655375 1:78026021-78026043 TTTTTTTTGCATAGGGCACCAGG + Intronic
910137467 1:83989409-83989431 CTTTTATTGAACAGGGAAACAGG + Intronic
911154667 1:94626060-94626082 CTTATATTACAGAGGGGAGCTGG - Intergenic
913631365 1:120713198-120713220 CTTTTATTTCACAGTAGACCTGG - Intergenic
918125863 1:181582919-181582941 CTTTTATTGCATGGGTGTCCAGG + Intronic
919291421 1:195638147-195638169 ATTTTATTACAGAGGAAACCTGG + Intergenic
922868913 1:228884229-228884251 CTTTCAGTGGAGAGGGGACATGG - Intergenic
1066617595 10:37311199-37311221 CTTGTTTTGTTGAGGGGACCGGG + Intronic
1069356734 10:67595473-67595495 TTTTTATTGCACTGAGGACCTGG + Intronic
1070540617 10:77412696-77412718 CTTTTATTTCCGCGGGGTCCGGG - Intronic
1074436582 10:113439529-113439551 ATTTGACTGCTGAGGGGACCAGG - Intergenic
1078251412 11:9619788-9619810 CTTTTATTGCCCAGGGGCTCTGG + Intergenic
1079814331 11:25036794-25036816 ATTTTATTGCACTGGGGTCCAGG + Intronic
1080272576 11:30466556-30466578 CCTTTGATGCAGAGGGGAGCAGG + Intronic
1083222127 11:61259287-61259309 CTTTTCTTCCAGAGGAGACAGGG + Exonic
1084636204 11:70394523-70394545 CTTAGAGTGCAGATGGGACCTGG - Intergenic
1085717332 11:78884290-78884312 ATTTTATAGGAGAGGGAACCAGG - Intronic
1088941785 11:114466845-114466867 CTTTTATTGCAGGGGGAAGATGG + Intergenic
1090514379 11:127410356-127410378 ATTTTATTTCAGAGAGAACCAGG - Intergenic
1092164288 12:6333475-6333497 CTCTTCTTGCACAGTGGACCGGG - Exonic
1105578095 13:21671321-21671343 CATTTTTTGGAGGGGGGACCGGG + Intergenic
1108803081 13:54123398-54123420 CTTTTATTCCAGATGCCACCTGG + Intergenic
1118070677 14:62243870-62243892 CTTACATAGCAGAAGGGACCTGG + Intergenic
1119072428 14:71600329-71600351 CATTTATTGAAGAGGGGAAGAGG + Intronic
1119782424 14:77285622-77285644 CTTTTATGGCAGAATGGAACAGG - Exonic
1120496107 14:85238180-85238202 TTTTTATTGTTGAGGGGACAGGG - Intergenic
1120733716 14:88030380-88030402 CTGTTTCTGCAGAGGGGCCCAGG - Intergenic
1122069290 14:99195287-99195309 CTTTTCTTCCAGAGGAGCCCTGG - Intronic
1122678551 14:103437835-103437857 CTTTCATTGTAGAGGTGACAGGG + Intronic
1123683297 15:22779064-22779086 CTTTTGTGGTAGTGGGGACCTGG - Intronic
1124335497 15:28853457-28853479 CTTTTGTGGTAGTGGGGACCTGG - Intergenic
1128195688 15:65753177-65753199 CTTTTAGTACAGGGTGGACCTGG + Intronic
1131408544 15:92186529-92186551 TTTTGATTGCAGTGAGGACCAGG - Intergenic
1131795879 15:96016342-96016364 CATGTATTGCTGGGGGGACCTGG + Intergenic
1134223510 16:12374087-12374109 GTGGTATTCCAGAGGGGACCTGG - Intronic
1139583883 16:67888726-67888748 ATATTAATGCAGAGGGGACTGGG - Intronic
1141551922 16:84812018-84812040 CTTTTGTGGTAGAAGGGACCTGG + Intergenic
1141902072 16:86997451-86997473 CATTTACTGCAGAGCGGGCCAGG - Intergenic
1145841457 17:27998688-27998710 CTTATATTTTAGTGGGGACCTGG + Intergenic
1147749892 17:42724311-42724333 GTTCTGTTGGAGAGGGGACCAGG + Exonic
1149043687 17:52220021-52220043 CTTTTATTACAGGGGGTCCCAGG - Intergenic
1156360282 18:36378579-36378601 TTTTTGTGGCAGAGGGGTCCAGG - Intronic
1158346090 18:56518514-56518536 CTTTTGTTGCAAAGGAGACTTGG + Intergenic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1158872904 18:61706385-61706407 CTAATATTGGAGAGGGGAGCTGG - Intergenic
1159530418 18:69648771-69648793 ATTTTATTGCTGATGGGAACAGG - Intronic
1160113517 18:76056104-76056126 CTCATATTGCTGAGGGGGCCAGG + Intergenic
1167503810 19:49861218-49861240 CGTTTATTGTGGAGGGGAGCTGG + Exonic
1167675237 19:50879913-50879935 CTTTTATTGTACAGGGGATGAGG + Exonic
1168720396 19:58551579-58551601 CTTTTATTACAGAGGGGTTGTGG + Exonic
925764299 2:7215767-7215789 CTGTCATTGCAGAGAGGGCCTGG + Intergenic
926811788 2:16761257-16761279 CTTTTAATTCAGAGGGGAATGGG - Intergenic
927010312 2:18897252-18897274 CTGTCATTGCAGATGGGACTTGG + Intergenic
927186212 2:20484396-20484418 CTTCTATAGCAGAGGGAGCCAGG + Intergenic
929094929 2:38254426-38254448 CTTTCAATGGAGAGGGGACATGG + Intergenic
932357729 2:71080139-71080161 CTGTTCTTTCAGAAGGGACCTGG - Intergenic
935094959 2:99935415-99935437 CTTTTAAGGGAGAGGGGAGCAGG + Intronic
935932515 2:108143564-108143586 CTGTTATTTCAAAGTGGACCTGG + Intergenic
937223678 2:120356325-120356347 CTGTCATGGCAGAGGGGACCTGG + Intergenic
939015550 2:136899145-136899167 CTTATATTGTCGAGAGGACCTGG + Intronic
940347000 2:152638414-152638436 TGTTTATTGCAGAGGGGAGGAGG + Intronic
940971840 2:159904332-159904354 CTTCTGGTGCAGAGGGGACGCGG - Intronic
944219280 2:197286183-197286205 GTTTTATTGCAGAGTGGGACTGG - Intronic
945147847 2:206757615-206757637 CTCTTTTTGCTGAGGAGACCTGG + Intronic
945565686 2:211396757-211396779 CTATAATTGCAGTGTGGACCAGG + Intronic
947291853 2:228584185-228584207 CTTTTATCCCAGAGGGGATTTGG - Intergenic
947804731 2:232958181-232958203 TTTTTATTGCTGAGGGTACTTGG + Intronic
948528871 2:238590175-238590197 CTTGTTTTGCAGACTGGACCAGG + Intergenic
1172707547 20:36893426-36893448 CTTTTATTGCAGAGGGGACCAGG - Exonic
1175568497 20:60000156-60000178 CCTTCCTTGCAGAGGGGCCCCGG - Intronic
1176286952 21:5023381-5023403 CTTCTAATGGGGAGGGGACCTGG - Intronic
1177385024 21:20397298-20397320 CTTTCAGTGCAGAGGGGAGTTGG + Intergenic
1177398010 21:20562680-20562702 ATTGTATTGCACAGGGAACCAGG - Intergenic
1179614263 21:42571638-42571660 CTCTTACGGAAGAGGGGACCTGG + Intronic
1179870229 21:44240094-44240116 CTTCTAATGGGGAGGGGACCTGG + Intronic
1180176932 21:46095414-46095436 CATTGATTGCAGAGGTGGCCAGG - Intergenic
1181596325 22:23917294-23917316 GTTTTACCCCAGAGGGGACCAGG - Intergenic
1182000886 22:26918963-26918985 CTTGCATGGCAGAGGAGACCTGG + Intergenic
1182492917 22:30685498-30685520 CTTTTACTGCACAGGTGAGCAGG + Intergenic
1185236442 22:49716305-49716327 CTGTGAGTGCAGAGAGGACCAGG - Intergenic
949697799 3:6719508-6719530 CTTTTATTGGAGAATGGAACTGG - Intergenic
952861517 3:37816654-37816676 CTTTTCTTGCAGAGGGGAGAAGG + Intronic
954938772 3:54351820-54351842 ATTTTATTGCATAAGGCACCAGG - Intronic
956221397 3:66907666-66907688 CTGTAATTGCTGAGGGAACCAGG - Intergenic
956301274 3:67775163-67775185 CTCTTAGTGGAGAGGGGAGCTGG + Intergenic
957969608 3:87366141-87366163 CTTTTGTTGCTGAGGTCACCAGG + Intergenic
960418766 3:117417192-117417214 CATTTAATACAGAGGGGAACAGG + Intergenic
960927126 3:122805479-122805501 CTCTTTTTGCAGAGGGTACATGG - Intronic
962177748 3:133172792-133172814 CATGTATTGCAGGAGGGACCTGG + Intronic
965814054 3:172618670-172618692 CTTTTTTTGCGGGGGGGACAGGG - Intergenic
965887707 3:173468686-173468708 CTTTTATTCCAAAGAAGACCTGG - Intronic
967560483 3:190912478-190912500 CATTTCTTGCGGAGGGGACATGG - Intergenic
977504091 4:97879605-97879627 CATGTGTTGCAGGGGGGACCTGG - Intronic
981852386 4:149246230-149246252 CTTTTAGTGGAAAGGGGAGCTGG - Intergenic
986393905 5:7309570-7309592 CTTTTGTGGTAGTGGGGACCTGG - Intergenic
986702922 5:10429197-10429219 CTTCTTTGGCAGAGGGGACTGGG - Intronic
988162625 5:27540894-27540916 CTTTTTCAGCAGAGAGGACCTGG + Intergenic
988782733 5:34538140-34538162 CTTTCAGTGGAGAGGGGACAGGG + Intergenic
991142478 5:63260619-63260641 CTTTTATTCCACAGGGGAGAAGG - Intergenic
991253742 5:64592609-64592631 CTTTTATTCCAATGGGGACAAGG - Intronic
998325440 5:141275910-141275932 CTTTGATTGAAGAGGAGACTGGG + Intergenic
1000258006 5:159559207-159559229 CTTATATTGCAATGGGGAGCTGG + Intergenic
1003331253 6:5130390-5130412 CTGGCATTGCACAGGGGACCTGG + Intronic
1009937830 6:70254519-70254541 CTTTTTTTGCAGGGTGAACCAGG - Exonic
1009940158 6:70281287-70281309 TTTTTTTTTCAGAGAGGACCAGG - Intronic
1011410556 6:87061814-87061836 CATTTATTGCAGTGGGAAGCAGG - Intergenic
1012403359 6:98864256-98864278 TTTATCTGGCAGAGGGGACCTGG + Intergenic
1016714827 6:147212757-147212779 CTTTGTTTACAGAAGGGACCAGG + Intronic
1017478014 6:154819264-154819286 CTTTTATTCCAGAGGAGACTAGG - Intronic
1017750778 6:157488584-157488606 CTTTCATTGCAAAGTGTACCTGG + Intronic
1018404001 6:163457644-163457666 TTTTTTTTGGAGAGGGGACAGGG + Intronic
1024948868 7:54838025-54838047 CTTTTGCTGCAGAGCGGAACGGG - Intergenic
1025062580 7:55823372-55823394 CTCTCAGTGGAGAGGGGACCTGG - Intronic
1025618224 7:63142986-63143008 CTTTCAGTGGAGAGGGGACCTGG - Intergenic
1027233507 7:76284950-76284972 CCTTGATTGCAGAGGGGACAGGG + Intronic
1028647833 7:93118498-93118520 CATTTATTGCAGAGCAGACCAGG + Intergenic
1032960825 7:137031921-137031943 CTTTTGTTGATGAGGAGACCAGG - Intergenic
1033286834 7:140048647-140048669 TATTTCTTGCAGAGGGAACCTGG + Intronic
1033544390 7:142386663-142386685 CTTTTTGTGCAGAGGGCAGCTGG - Intergenic
1034689968 7:153006530-153006552 CTTTCATGTCAGAGGGGACCAGG + Intergenic
1039076388 8:33693829-33693851 CTCTTAATGGAGAGGGGAGCTGG - Intergenic
1039532452 8:38275754-38275776 CTTCCAGTGCAGAGGGAACCAGG + Exonic
1041702628 8:60808205-60808227 CTTTTGTTGCAGAAGGAATCTGG + Exonic
1042715981 8:71773147-71773169 CTTTTAGTGGAGAGGGGAAGAGG + Intergenic
1043438961 8:80260214-80260236 CTTTCAGTGAAGAGGGGAGCTGG + Intergenic
1043532293 8:81164758-81164780 CTTTTATAGAAGATGTGACCTGG + Intergenic
1043930413 8:86084047-86084069 CTTTTATTAGGGAGGGGTCCTGG - Intronic
1048330556 8:133467777-133467799 CTTCCATTGCAGTGGGGACTGGG - Intronic
1049035826 8:140075056-140075078 CTTTTATTGCAGAGGAGAGTGGG - Intronic
1049057579 8:140250983-140251005 CTTTTGTTATAGAGGGGACTAGG - Intronic
1049210490 8:141384316-141384338 CTGTCATTGCAGAGGGGGACTGG + Intergenic
1049634827 8:143682057-143682079 CTTTCAGTGGAGAGGGGACATGG + Intergenic
1050219727 9:3373597-3373619 CTTTTATTCCTGAAGGGGCCAGG - Intronic
1055037971 9:71838426-71838448 CTTTTTTTGGAGTGGGGAACGGG - Intergenic
1056059560 9:82870235-82870257 CTCTTAGTGGAGAGGGGAGCTGG - Intergenic
1186466864 X:9790147-9790169 CCTTGATTGCAGAGGGCACAGGG + Intronic
1187492373 X:19764112-19764134 CTTTTTTTGAAGTGGGGAGCAGG - Intronic
1190166891 X:48080603-48080625 CATTTACTGCAGAAGGGAACCGG - Intergenic
1195304921 X:103572403-103572425 ATTTTACTGCAGAGGAGACCTGG + Intergenic
1196123942 X:112080325-112080347 CTTTTGTAACAGAGGGGAGCAGG - Intronic
1196421644 X:115528289-115528311 TTTTTTTTGCAGAGGGGTTCAGG + Intergenic
1196873142 X:120131510-120131532 CTTTCAGTGGAGAGGGGAGCTGG + Intergenic
1197329024 X:125130859-125130881 CTTTCATTCCAGAGGGGATAGGG + Intergenic
1198080197 X:133232282-133232304 CTTTGATAGCAGAGGTGACTAGG - Intergenic
1199501281 X:148509317-148509339 TTTTTATTGTTTAGGGGACCCGG + Intronic
1200055065 X:153455971-153455993 GTTTGATTGCGGAGGAGACCGGG - Intronic